|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Department of Pathology, Stanford University
School of Medicine, Stanford, CA.
Bone marrow-derived dendritic cells (DC) represent a family of
antigen-presenting cells (APC) with varying phenotypes. For example, in
mice, CD8 The generation of most T-cell-mediated immune
responses to protein antigens requires the participation of
antigen-specific T cells and specialized antigen-presenting cells
(APC). APC must be able to capture and process antigens and then
migrate from the sites of antigen capture to the T-cell regions of
draining lymph nodes (LN) to interact with antigen-specific T cells.
They must also be efficient in presenting antigen as major
histocompatibility complex (MHC) peptide complexes to the T cells.
Dendritic cells (DC) are a family of bone marrow-derived cells uniquely
capable of performing these tasks,1 and they are believed
to be the main APC responsible for sensitizing naive T cells to their
cognate antigens.
Experiments have established that DC can capture antigens in peripheral
tissues and then home to the T-cell areas of lymphoid organs.2 For example, afferent lymph DC contain protein
antigens that have been administered intradermally,3,4 and
DC bearing these antigens can later be isolated from draining LN.
Foreign antigens that reach the epidermal barrier are processed and
presented to the immune system by skin resident DC known as Langerhans
cells (LC). On contact with antigen (for example, allergens), these cells become mobile and gain access to lymphatic vessels and thereby to
the T-cell areas of the draining lymph nodes, where they sensitize host
T cells to the antigens they have captured and processed.
Experiments performed in murine systems have led to the recognition of
2 main DC subtypes that can be distinguished on the basis of their
expression of the myeloid marker CD11b (Mac-1) and the lymphoid marker
CD8 Animals
Cytokines and media
Immunofluorescence analysis and flow cytometry All cell preparations were preincubated with anti-CD32/16 to minimize nonspecific binding. Three-color analyses were performed on a FACScalibur (Becton Dickinson, Mountain View, CA), and sorting was performed on a FACSVantage (Becton Dickinson). Mouse monoclonal antibodies (mAb) to CD8 chain (Ly-2; IgG2a), CD11c (HL3; IgG1), IA-b
(Af6-120.1; IgG2a), Thy-1 (G7; IgG2c), Gr-1 (RB6-8C5; IgG2b), B-220
(RA3-6B2;IgG2a), CD11b (M1/70; IgG2b), CD3 (145-2C11; IgG1), TCR
chain (H57-597; IgG2), CD4 (GK1.5; IgG2b), CD86 (GL1; IgG2a), CD40
(HM40-3; IgM), CD16/CD32 (2.4G2; IgG2b), isotype controls, and the
second-step antibodies (APC-conjugated streptavidin, phycoerythrin [PE]-conjugated goat antirabbit IgG, and a PE-conjugated antirat IgG)
were purchased from Pharmingen (San Diego, CA). Mouse mAb to DEC-205
(NLDC-145; IgG2a) was purchased from Serotec (Raleigh, NC), and a mouse
polyclonal antibody recognizing E-cadherin was kindly provided by Dr
W. J. Nelson.11 A different clone of mAb recognizing
CD8 (CT-CD8a; IgG2a) was purchased from Caltag (Burlingame, CA). In
skin painting experiments, the DC-enriched population was stained with
biotin-conjugated CD11c and PE-conjugated IA-b, and APC-streptavidin
conjugate was used as a second step.
Isolation of epidermal Langerhans cells LC were obtained from epidermal sheets of mouse ears following a protocol modified from that of Schuler and Steinman.12 Briefly, ears were split with the aid of forceps into dorsal and ventral halves and incubated in a Petri dish containing 0.5% trypsin (Gibco BRL, Gaithersburg, MD) in PBS for 20 minutes at 37°C to allow the separation of epidermal sheets from the dermis. The epidermis was separated from the dermis with fine forceps. A suspension of epidermal cells was obtained by filtering the trypsinized epidermal sheets through a stainless steel sieve, followed by washing in PBS with 5% FCS. The resultant cell suspension was resuspended in CM and cultured in a 24-well plate in the presence of 10 ng/mL GM-CSF. Twenty-four hours later, nonadherent cells were collected and washed, and the cell concentration was adjusted to 4 × 106 cells/mL in PBS. Four microliters Nycoprep (Nycomed, Oslo, Norway) was gently layered under 6 mL of epidermal cells and centrifuged for 20 minutes (1800 rpm) at 4°C. The low-density fraction contained more than 30% LC, as assessed by flow cytometry.Langerhans cell migration assay in vivo Mice were painted on the shaved abdomens and footpads with 400 µL of 4 mg/mL fluorescein isothiocyanate (FITC) (F-7250; Sigma, St. Louis, MO) dissolved in 1:1 acetone:dibutylphalate (D-2270; Sigma). Draining inguinal and popliteal LN were excised 24 hours, 48 hours, 72 hours, or 4 days after exposure.Isolation of dendritic cells from lymph nodes DC were isolated from peripheral LN of normal and painted mice using the following protocol. Briefly, whole LN were injected with collagenase D (1 mg/mL) (Boehringer-Mannheim, Mannheim, Germany) in CM for 20 minutes at 37°C. Digested LN were filtered through a stainless steel sieve, and the cell suspension was washed twice in PBS-EDTA-FCS. EDTA was used throughout the procedure to dissociate DC-T complexes. Cells were resuspended in CM at 1 × 106 cells/mL and layered onto Nycoprep solution (density, 1.068 g/cm3; Nycomed). After centrifugation at 1800 rpm for 20 minutes, cells obtained from the interphase (accounting for 1% of the total) were washed twice in PBS-EDTA-FCS. FITC+CD8+CD11c+ and FITC+CD8-CD11c+ DC were sorted from DC-enriched cells obtained from the draining LN of painted mice.Immunofluorescence and confocal microscopy Draining popliteal and inguinal LN were harvested and frozen in liquid nitrogen 24 hours after skin painting and 24 hours after LC injection into the footpads of CD8 knockout mice (see below).
Cryostat-cut LN sections (5 µm) were fixed in acetone, air dried, and
washed in PBS. Tissue sections were blocked with anti-FC R II/III
(CD16/CD32) antibodies for 30 minutes and then stained with
biotin-labeled anti-CD8, followed by streptavidin-PE and
FITC-conjugated CD11c where indicated. Sections were analyzed using a
confocal microscope equipped with a krypton-argon laser. Separate
green and red images were collected for each section analyzed. Final
image processing was performed using Adobe Photoshop software (Adobe,
Mountain View, CA). To orient the reader to the normal architecture of
the LN, adjacent tissue sections were fixed in methanol, air dried, and
stained with hematoxylin and eosin. Hematoxylin and eosin-stained
sections were analyzed using a bright-field microscope
(Microphot-FXA; Nikon).
Generation of bone marrow-derived Langerhans cells in vitro Bone marrow cells were obtained from the femurs and tibiae of 5- to 7-week-old C57BL/6 female mice. Lineage-negative hematopoietic progenitor cells (HPC) were isolated from bone marrow by negative selection with magnetic beads. The bone marrow cell preparation was stained with a cocktail of biotin-conjugated mAb to CD3, CD4, CD8, Thy-1, B220, IA-b, CD11c, CD11b, and Gr-1, and labeled cells were then depleted with streptavidin microbeads (Miltenyi Biotech, Auburn, CA). A modification of the protocol of Zhang et al8 was used to generate bone marrow-derived LC (BM-LC). Briefly, purified HPC were incubated at 1 × 105 cells/mL in CM in the presence of GM-CSF (5 ng/mL), transforming growth factor (TGF)- (2.5 ng/mL), and
SCF (5 ng/mL). The culture was split on day 4, and fresh medium and
cytokines were added on day 7. On day 13, TGF- was omitted, and
GM-CSF (10 ng/mL), TNF- (10 ng/mL), and IL-4 (10 ng/mL) were added
to the cultures for 3 more days. Cell samples obtained at days 13 and
16 were analyzed by flow cytometry. CD8 CD11c+
IA-b+ LC were sorted by flow cytometry. The purity of LC
after sorting was greater than 90% based on their coexpression of
IA-b, CD11c, CD11b, and
E-cadherin. Purified LC were
resuspended at a concentration of 3 × 106/50 µL in PBS
and injected into the footpads of CD8KD mice (1 footpad per mouse).
Twenty-four hours later, the draining and contralateral LN were
harvested and analyzed for the presence of CD8+ LC.
Induction and measurement of cytokine secretion from migratory
Langerhans cells and CD8 CD8CD11c+ cells were
isolated by sorting. Within each population, 1 × 105
cells were stimulated in vitro with LPS (1 µg/mL) or IL-12 (10 ng/mL). After 48-hour culture, supernatants of LPS-stimulated cells
were assayed for IL-12, whereas culture supernatants of IL-12-stimulated cells were assayed for IFN-. Cytokine secretion was quantified by enzyme-linked immunosorbent assay (ELISA).
Antigen capture and presentation assay Ovalbumin (grade VI; Sigma) mixed with complete Freund's adjuvant (DIFCO, Detroit, MA) was injected intradermally into the footpads of mice. Two days later, the skin was sensitized as described above, and the draining lymph nodes were harvested 24 hours later. The purified and sorted FITC+CD8+CD11c+ and FITC+CD8-CD11c+ populations were cultured in the presence of an ovalbumin-specific, MHC class I-restricted T-cell hybridoma (B3Z) for 24 hours at a ratio of 1 FITC+ cell:10 B3Z cells. IL-2 release from the hybridoma cells was analyzed by ELISA.Mixed lymphocyte reaction Graded numbers of a purified population of FITC+CD8+CD11c+ or FITC+CD8CD11c+ cells were
irradiated (30 Gy) and added to allogeneic (B10.BR) T cells
(2 × 105/well) in a final volume of 0.2 mL in 96-well
flat-bottom plates (Corning, Corning, NY). Cell proliferation was
measured by adding 1 µCi 3H-thymidine/well after 3 days.
Cells were harvested 16 to 18 hours later, and the incorporated
3H-thymidine was counted in a -plate counter (Wallac,
Gaithersburg, MD). Results are presented as the mean of
triplicate cultures.
ELISA Cytokine secretion was quantified by ELISA adapted from Pharmingen protocols. In brief, ELISA plates (Corning) were coated overnight at 4° with 50 µL antimouse IL-2, IL-12, and IFN-
antibodies (Pharmingen) diluted in 0.1 mol/L NaHCO3 to a
concentration of 2 µg/mL. The plates were then blocked with PBS-5%
FCS for 3 to 4 hours and were washed several times with PBS/0.1% Tween
20. Serial dilutions of the standard were made at a starting
concentration of 5 ng/mL for IL-2 (R&D, Minneapolis, MN) and 50 ng/mL
for IL-12 and IFN- (Preprotech). Fifty microliters of the sample or
the standard was added to the plate at room temperature. After 4 hours of incubation, the plates were washed, and biotinylated detection antibody (Pharmingen) was added at a concentration of 2 µg/mL. Three
hours later, the plates were washed and incubated with
streptavidin-horseradish peroxidase (Vector Laboratories, Burlingame,
CA) diluted at 1:2000. One hour later, the plates were washed and the
bound peroxidase was detected with TMB substrate (Zymed, San Francisco,
CA). The amount of reaction product was assessed on an ELISA plate
reader (Bio-Rad, Hercules, CA) at an optical density of 650 nm. The
detection limit was 50 pg/mL.
Reverse transcription-polymerase chain reaction Total RNA was extracted from purified FITC+CD8+CD11c+ cells, FITC+CD8-CD11c+ cells, FITC-CD8+CD11c+ (resident DC), and total LN cells using an RNeasy kit (Qiagen, Valencia, CA) and treated with DNase. RNA was quantified by spectrophotometry. First-strand cDNA was synthesized from total RNA using the Superscript II RNase H-reverse transcriptase (Gibco BRL) with random primers, as described by the manufacturer. For all samples, synthesis of cDNA was controlled by reverse transcription-polymerase chain reaction (RT-PCR) using-actin primers for 30 cycles. CD8 chain mRNA was examined by
using the primers (sense primer, cacgaataataagtacgttctcacc; antisense
primer, atgtaaatatcacaggcgaagtcca) and CD3 by using the following
primers: gaaagaatcaggctgctcaga (sense) and tggagatggtgatgaccatccga (antisense). CCR6 mRNA was examined by using the primers
ctgcagttcgaagtcatc (sense) and gtcatcaccaccataatgttg (antisense). CCR7
mRNA was examined by using the primers acagcggcctccagaagaacagcgg
(sense) and tgacgtcataggcaatgttgagctg (antisense). Thymus and
activation-regulated chemokine (TARC) mRNA was examined by using the
primers caggaagttggtgagctggtata (sense) and ttgtgttcgcctgtagtgcata
(antisense). Monocyte-derived chemokine (MDC) mRNA was examined using
the primers gtggctctcgtccttcttgc (sense) and ggacagtttatggagtagctt (antisense).
Migratory Langerhans cells in draining lymph nodes, but not in
skin, express CD8 R, the DEC-205 multilectin
receptor,14 and the epithelial marker
E-cadherin15 (Figure 1A).
These LC, however, do not express CD8. After skin sensitization by
FITC painting, the FITC+ cells found in the draining LN
express a similar phenotype to LC isolated from the skin (Figure 1B).
However, all FITC+ cells found in the LN had high levels of
MHC class II and costimulatory molecules, suggesting that these cells
represent LC that encountered FITC in the skin, became activated, and
migrated to the LN. Surprisingly, these cells expressed CD8 on their
surfaces but did not express other T-cell markers, such as CD3 or TCR
(Figure 1B). The level of CD8 staining was similar, with 2 different
anti-CD8 antibodies, and was stable from day 1 through day 4 after FITC
painting (data not shown). To evaluate the distribution of CD8 on
migratory LC, DC were isolated from the draining LN of painted mice,
and FITC+CD8+CD11c+ cells were
purified by FACS. Sorted cells were then assessed by confocal
microscopy to determine whether any doublet cells, composed of LC and
adherent lymphocytes, were present. No doublets were found, and, as
shown in Figure 2, panel A, the FITC
staining pattern was diffusely intracellular, whereas CD8 was evenly
distributed on the surface. This distribution of staining was typical
of all the cells examined.
Migratory Langerhans cells express CD8 was synthesized by the
FITC+ DC or was acquired passively from T cells that might
have shed CD8 molecules, the presence of the CD8 chain message in
sorted FITC+ DC (more than 90% purity) was assessed by
RT-PCR analysis. As shown in Figure 2 panel B, the sorted
FITC+CD8+CD11c+ DC expressed a
clear CD8 chain message but no CD3 message. The production by DC of
CD8 mRNA makes it highly unlikely that CD8 antigens detected by flow
cytometry were passively acquired, and the absence of the CD3 message
confirms that the sorted cells were not contaminated by T cells.
Bone marrow-derived Langerhans cells injected into CD8 knockout mice. As
described in "Materials and methods," these cells were generated in
vitro from lineage-negative HPC cultured in the presence of cytokines, including GM-CSF, TGF-, and SCF. Cells obtained at day 13 were typical monocytes, as evidenced by their morphology and endocytic activity (data not shown). After 3 additional days of culture in the
presence of GM-CSF, TNF-, and IL-4, most cells differentiated into
DC. They expressed high levels of MHC class II molecules, CD11c and
CD11b antigens, the epithelial marker E-cadherin, and costimulatory
molecules, whereas a small subset of the cells (less than 10%)
differentiated into macrophages (data not shown). None of these cells
expressed CD8 or TCR molecules (Figure
3). Purified CD8CD11c+ IA-b+ LC were injected
subcutaneously into the footpads of CD8 knockout mice. Twenty-four
hours after injection, a subset of DC from the draining LN expressed
CD8 (Figure 4A,B) but no other T-cell
markers (not shown), whereas none of the DC from the contralateral LN expressed CD8 (Figure 4B).
CD8+ Langerhans cells express CCR6 and CCR7 receptors, migrate to the T-cell zones of lymph nodes, and secrete chemokines that attract T cells To generate an immune response, antigen-loaded DC must rapidly interact with antigen-specific T cells in lymphoid organs. Mechanisms that would be expected to increase encounters between DC and T cells include the localization of migratory DC to T-cell areas of the LN or their production of T-cell attracting chemokines. To address these possibilities, we analyzed the geographic localization, chemokine receptors, and chemokine expression of FITC+CD8+ cells present in the LN and freshly isolated LC from the skin. Twenty-four hours after skin sensitization with FITC, the draining LN were harvested and analyzed by immunohistochemistry. Frozen sections of the LN were stained to identify the T-cell zone and examined by confocal microscopy. As shown in Figure 5A, most FITC+ cells in the LN expressed CD8 antigen and were located in the T-cell
zone and not in the follicles. Using an RT-PCR assay, we then analyzed
the expression of chemokine and chemokine receptor mRNA. RNA was
extracted from a sorted population of FITC+CD8+
cells isolated from the LN and from LC freshly isolated from the skin.
As shown in Figure 6,
FITC+CD8+ LC expressed CCR6 and CCR7 and the
T-cell attracting chemokines MDC and TARC. In contrast, freshly
isolated LC from the skin express CCR6 but not CCR7, MDC, or
TARC.
CD8+ Langerhans cells capture, process, and present antigens to T cells To assess the capacity of migratory LC to stimulate allogeneic T cells, we isolated FITC+CD8+CD11c+ and FITC+CD8CD11c+ cells from the
LN of painted mice and cocultured them with freshly isolated allogeneic
T cells. As shown in Figure 7, panel A,
the CD8+ LC stimulated allogeneic T cells to proliferate
vigorously in the mixed lymphocyte reaction. To assess the capacity of
migratory LC to process and present external antigen in association to
MHC class I molecules, we injected ovalbumin mixed with complete
Freund's adjuvant intradermally into the footpads of mice and
subsequently painted the mice with FITC. Twenty-four hours later,
FITC+CD8+CD11c+ and
FITC+CD8CD11c+ cells isolated
from the draining LN were cultured with the ovalbumin-specific, MHC
class I-restricted T-cell hybridoma, B3Z. As shown in Figure 7 panel B,
in the presence of CD8+ LC, the B3Z cells secreted high
levels of IL-2. However,
FITC+CD8CD11c+ cells failed to
stimulate either B3Z hybridoma cells or allogeneic T cells
(Figure 7A,B).
CD8+ LC secrete a higher level of Th1 cytokines than
CD8 CD11c+, and
FITCCD8 CD11c+ cells were
purified from LN and stimulated in vitro overnight with
lipopolysaccharide or IL-12. As shown in Figure
8, significant amounts of Th1 cytokines,
such as IFN- and IL-12, were secreted by CD8+ DC. The
amount of IFN- and IL-12 secreted by CD8+ DC was greater
than that secreted by CD8 DC.
Although the lymphoid origin of CD8+ thymic DC has
been conclusively demonstrated (reviewed in Sprent et al9;
also see Ardavin et al10), the lineage of CD8+
DC in peripheral lymphoid organs has not yet been determined. CD8+ DC were initially identified by Ardavin et al
in the thymus of mice, in which they appear to develop from an
endogenous precursor rather than to arrive preformed from the
circulation.10 On transfer to irradiated mice, this
precursor gave rise to T, B, and natural killer cells and to
CD8+ DC.16 In a subsequent study the same
investigators identified CD8 We show here that freshly isolated LC and LC derived from HPC do
not express the CD8 antigen. However, when LC are activated in vivo
with a skin sensitizer that results in their migration to the draining
LN, CD8 expression is induced on the surfaces of the cells. In our
studies CD8 expression on migratory LC was not caused by the presence
of contaminating cells or the passive absorption of CD8 molecules shed
by T cells because migratory LC in the LN did not express CD3 or TCR
antigen. Moreover, these cells expressed CD8 mRNA, showing that they
are able to synthesize CD8 despite their lack of any detectable CD3
mRNA. Finally, we showed that CD8 The results presented here also demonstrate that CD8+
LC are uniquely equipped to attract and interact with T cells. They
express the chemokine receptors CCR6 and CCR7, facilitating their
recruitment in the periphery and their migration to the T-cell zones of
secondary lymphoid organs. CCR6 is the receptor for
MIP-3 CD8+ and CD8 The findings presented here, together with previous results,
suggest that CD8
We thank Tomoharu Sugie for critical discussion, Patricia Lovelace for help with flow cytometry, Claudia Benike for critical review of the manuscript, and Donna Jones for formatting the manuscript.
Submitted January 13, 2000; accepted May 9, 2000.
Supported in part by National Institutes of Health grants CA71725, HL57443, and CA72103. M.M. was supported by a grant from the Association Francaise Contre le Cancer. L.F. was supported by a Physician-Scientist Award from the National Cancer Institute (K23 CA82584-01).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: M. Merad, Stanford Blood Center, 800 Welch Rd, Palo Alto, CA 94304; e-mail: meradm{at}leland.stanford.edu.
1. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[Medline] [Order article via Infotrieve].
2.
Larsen CP, Steinman RM, Witmer-Pack M, Hankins DF, Morris PJ, Austyn JM.
Migration and maturation of Langerhans cells in skin transplants and explants.
J Exp Med.
1990;172:1483-1493
3.
Bujdoso R, Hopkins J, Dutia BM, Young P, McConnell I.
Characterization of sheep afferent lymph dendritic cells and their role in antigen carriage.
J Exp Med.
1989;170:1285-1301
4.
Macatonia SE, Knight SC, Edwards AJ, Griffiths S, Fryer P.
Localization of antigen on lymph node dendritic cells after exposure to the contact sensitizer fluorescein isothiocyanate: functional and morphological studies.
J Exp Med.
1987;166:1654-1667
5.
Vremec D, Zorbas M, Scollay R, et al.
The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells.
J Exp Med.
1992;176:47-58 6. Maurer D, Stingl G. Dendritic cells in the context of skin immunity. In: Lotze MT,Thomson AW, eds. Dendritic Cells: Biology and Clinical Implications. San Diego: Academic Press; 1999.
7.
Geissmann F, Prost C, Monnet JP, Dy M, Brousse N, Hermine O.
Transforming growth factor beta1, in the presence of granulocyte/macrophage colony-stimulating factor and interleukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells.
J Exp Med.
1998;187:961-966
8.
Zhang Y, Zhang YY, Ogata M, et al.
Transforming growth factor- 9. Sprent J, Webb SR. Intrathymic and extrathymic clonal deletion of T cells. Curr Opin Immunol. 1995;7:196-205[Medline] [Order article via Infotrieve]. 10. Ardavin C, Wu L, Li CL, Shortman K. Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature. 1993;362:761-763[Medline] [Order article via Infotrieve]. 11. Vestweber D, Kemler R. Rabbit antiserum against a purified surface glycoprotein decompacts mouse preimplantation embryos and reacts with specific adult tissues. Exp Cell Res. 1984;152:169-178[Medline] [Order article via Infotrieve].
12.
Schuler G, Steinman RM.
Murine epidermal Langerhans cells mature into potent immunostimulatory dendritic cells in vitro.
J Exp Med.
1985;161:526-546
13.
Metlay JP, Witmer-Pack MD, Agger R, Crowley MT, Lawless D, Steinman RM.
The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies.
J Exp Med.
1990;171:1753-1771
14.
Kraal G, Breel M, Janse M, Bruin G.
Langerhans' cells, veiled cells, and interdigitating cells in the mouse recognized by a monoclonal antibody.
J Exp Med.
1986;163:981-997 15. Borkowski TA, Van Dyke BJ, Schwarzenberger K, McFarland VW, Farr A, Udey MC. Expression of E-cadherin by murine dendritic cells: E-cadherin as a dendritic cell differentiation antigen characteristic of epidermal Langerhans cells and related cells. Eur J Immunol. 1994;24:2767-2774[Medline] [Order article via Infotrieve].
16.
Wu L, Li C, Shortman K.
Thymic dendritic cell precursors: relationship to the T lymphocyte lineage and phenotype of the dendritic cell progeny.
J Exp Med.
1996;184:903-911 17. Wu L, Vremec D, Ardavin C, et al. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur J Immunol. 1995;25:418-425[Medline] [Order article via Infotrieve].
18.
Brocker T, Riedinger M, Karjalainen K.
Targeted expression of major histocompatibility complex (MHC) class II molecules demonstrates that dendritic cells can induce negative but not positive selection of thymocytes in vivo.
J Exp Med.
1997;185:541-550
19.
Pulendran B, Smith JL, Caspary G, et al.
Distinct dendritic cell subsets differentially regulate the class of immune response in vivo.
Proc Natl Acad Sci U S A.
1999;96:1036-1041
20.
Maldonado-Lopez R, De Smedt T, Michel P, et al.
CD8 21. Fung-Leung WP, Schilham MW, Rahemtulla A, et al. CD8 is needed for development of cytotoxic T cells but not helper T cells. Cell. 1991;65:443-449[Medline] [Order article via Infotrieve].
22.
Power CA, Church DJ, Meyer A, et al.
Cloning and characterization of a specific receptor for the novel CC chemokine MIP-3alpha from lung dendritic cells.
J Exp Med.
1997;186:825-835
23.
Greaves DR, Wang W, Dairaghi DJ, et al.
CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells.
J Exp Med.
1997;186:837-844 24. Rossi DL, Vicari AP, Franz-Bacon K, McClanahan TK, Zlotnik A. Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3alpha and MIP-3beta. J Immunol. 1997;158:1033-1036[Abstract].
25.
Dieu MC, Vanbervliet B, Vicari A, et al.
Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites.
J Exp Med.
1998;188:373-386
26.
Yang D, Chertov O, Bykovskaia SN, et al.
beta-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6.
Science.
1999;286:525-528 27. Schweickart VL, Raport CJ, Godiska R, et al. Cloning of human and mouse EBI1, a lymphoid-specific G-protein-coupled receptor encoded on human chromosome 17q12-q21.2. Genomics. 1994;23:643-650[Medline] [Order article via Infotrieve]. 28. Hedrick JA, Zlotnik A. Identification and characterization of a novel beta chemokine containing six conserved cysteines. J Immunol. 1997;159:1589-1593[Abstract].
29.
Gunn MD, Tangemann K, Tam C, Cyster JG, Rosen SD, Williams LT.
A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes.
Proc Natl Acad Sci U S A.
1998;95:258-263
30.
Chan VW, Kothakota S, Rohan MC, et al.
Secondary lymphoid-tissue chemokine (SLC) is chemotactic for mature dendritic cells.
Blood.
1999;93:3610-3616
31.
Gunn MD, Kyuwa S, Tam C, et al.
Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization [see comments].
J Exp Med.
1999;189:451-460
32.
Saeki H, Moore AM, Brown MJ, Hwang ST.
Cutting edge: secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) participate in the emigration pathway of mature dendritic cells from the skin to regional lymph nodes.
J Immunol.
1999;162:2472-2475
33.
Godiska R, Chantry D, Raport CJ, et al.
Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells.
J Exp Med.
1997;185:1595-1604
34.
Tang HL, Cyster JG.
Chemokine up-regulation and activated T cell attraction by maturing dendritic cells.
Science.
1996;284:819-822
35.
Imai T, Yoshida T, Baba M, Nishimura M, Kakizaki M, Yoshie O.
Molecular cloning of a novel T cell-directed CC chemokine expressed in thymus by signal sequence trap using Epstein-Barr virus vector.
J Biol Chem.
1996;271:21514-21521 36. De St Groth B. The evolution of self-tolerance: a new cell arises to meet the challenge of self-reactivity. Immunol Today. 1998;19:448-454[Medline] [Order article via Infotrieve].
37.
Reis e Sousa C, Germain R.
Analysis of adjuvant function by direct visualization of accumulation of antigen-bearing dendritic cells in the T cell area of lymphoid tissue.
J Immunol.
1999;162:6552-6561
38.
Inaba K, Pack M, Inaba M, Sakuta H, Isdell F, Steinman RM.
High levels of a major histocompatibility complex II-self-peptide complex on dendritic cells from the T cell areas of lymph nodes.
J Exp Med.
1997;186:665-672
39.
Reis e Sousa C, Hieny S, Scharton-Kersten T, et al.
In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas [see comments].
J Exp Med.
1997;186:1819-1829
40.
Ohteki T, Fukao T, Suzue K, et al.
Interleukin 12-dependent interferon gamma production by CD8alpha+ lymphoid dendritic cells.
J Exp Med.
1999;189:1981-1986
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  H. K. Lee, M. Zamora, M. M. Linehan, N. Iijima, D. Gonzalez, A. Haberman, and A. Iwasaki Differential roles of migratory and resident DCs in T cell priming after mucosal or skin HSV-1 infection J. Exp. Med., February 16, 2009; 206(2): 359 - 370. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Mende, H. Karsunky, I. L. Weissman, E. G. Engleman, and M. Merad Flk2+ myeloid progenitors are the main source of Langerhans cells Blood, February 15, 2006; 107(4): 1383 - 1390. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. H. Tan and H. C. O'Neill Maturation requirements for dendritic cells in T cell stimulation leading to tolerance versus immunity J. Leukoc. Biol., August 1, 2005; 78(2): 319 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Morelli, A. T. Larregina, W. J. Shufesky, M. L. G. Sullivan, D. B. Stolz, G. D. Papworth, A. F. Zahorchak, A. J. Logar, Z. Wang, S. C. Watkins, et al. Endocytosis, intracellular sorting, and processing of exosomes by dendritic cells Blood, November 15, 2004; 104(10): 3257 - 3266. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Swanson, Y. Zheng, K. M. Heidler, Z.-D. Zhang, T. J. Webb, and D. S. Wilkes Flt3-Ligand, IL-4, GM-CSF, and Adherence-Mediated Isolation of Murine Lung Dendritic Cells: Assessment of Isolation Technique on Phenotype and Function J. Immunol., October 15, 2004; 173(8): 4875 - 4881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A J Stagg, A L Hart, S C Knight, and M A Kamm The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria Gut, October 1, 2003; 52(10): 1522 - 1529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Naik, D. Vremec, L. Wu, M. O'Keeffe, and K. Shortman CD8{alpha}+ mouse spleen dendritic cells do not originate from the CD8{alpha}- dendritic cell subset Blood, July 15, 2003; 102(2): 601 - 604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Edwards, D. Chaussabel, S. Tomlinson, O. Schulz, A. Sher, and C. Reis e Sousa Relationships Among Murine CD11chigh Dendritic Cell Subsets as Revealed by Baseline Gene Expression Patterns J. Immunol., July 1, 2003; 171(1): 47 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nikolic, M. F. T. R. d. Bruijn, M. B. Lutz, and P. J. M. Leenen Developmental stages of myeloid dendritic cells in mouse bone marrow Int. Immunol., April 1, 2003; 15(4): 515 - 524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Donskoy and I. Goldschneider Two Developmentally Distinct Populations of Dendritic Cells Inhabit the Adult Mouse Thymus: Demonstration by Differential Importation of Hematogenous Precursors Under Steady State Conditions J. Immunol., April 1, 2003; 170(7): 3514 - 3521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Alferink, I. Lieberam, W. Reindl, A. Behrens, S. Weiss, N. Huser, K. Gerauer, R. Ross, A. B. Reske-Kunz, P. Ahmad-Nejad, et al. Compartmentalized Production of CCL17 In Vivo: Strong Inducibility in Peripheral Dendritic Cells Contrasts Selective Absence from the Spleen J. Exp. Med., March 3, 2003; 197(5): 585 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A H Lau and A W Thomson Dendritic cells and immune regulation in the liver Gut, February 1, 2003; 52(2): 307 - 314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tsujimura, T. Tamura, C. Gongora, J. Aliberti, C. Reis e Sousa, A. Sher, and K. Ozato ICSBP/IRF-8 retrovirus transduction rescues dendritic cell development in vitro Blood, February 1, 2003; 101(3): 961 - 969. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Aliberti, O. Schulz, D. J. Pennington, H. Tsujimura, C. R. e Sousa, K. Ozato, and A. Sher Essential role for ICSBP in the in vivo development of murine CD8alpha + dendritic cells Blood, January 1, 2003; 101(1): 305 - 310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schiavoni, F. Mattei, P. Sestili, P. Borghi, M. Venditti, H. C. Morse III, F. Belardelli, and L. Gabriele ICSBP Is Essential for the Development of Mouse Type I Interferon-producing Cells and for the Generation and Activation of CD8{alpha}+ Dendritic Cells J. Exp. Med., December 2, 2002; 196(11): 1415 - 1425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Weigel, N. Nath, P. A. Taylor, A. Panoskaltsis-Mortari, W. Chen, A. M. Krieg, K. Brasel, and B. R. Blazar Comparative analysis of murine marrow-derived dendritic cells generated by Flt3L or GM-CSF/IL-4 and matured with immune stimulatory agents on the in vivo induction of antileukemia responses Blood, December 1, 2002; 100(12): 4169 - 4176. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Scheinecker, R. McHugh, E. M. Shevach, and R. N. Germain Constitutive Presentation of a Natural Tissue Autoantigen Exclusively by Dendritic Cells in the Draining Lymph Node J. Exp. Med., October 21, 2002; 196(8): 1079 - 1090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang, Y. Zhang, H. Yoneyama, N. Onai, T. Sato, and K. Matsushima Identification of CD8alpha +CD11c- lineage phenotype-negative cells in the spleen as committed precursor of CD8alpha + dendritic cells Blood, June 28, 2002; 100(2): 569 - 577. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Basak, A. Harui, M. Stolina, S. Sharma, K. Mitani, S. M. Dubinett, and M. D. Roth Increased dendritic cell number and function following continuous in vivo infusion of granulocyte macrophage-colony-stimulating factor and interleukin-4 Blood, April 15, 2002; 99(8): 2869 - 2879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bacci, C. Montagnoli, K. Perruccio, S. Bozza, R. Gaziano, L. Pitzurra, A. Velardi, C. F. d'Ostiani, J. E. Cutler, and L. Romani Dendritic Cells Pulsed with Fungal RNA Induce Protective Immunity to Candida albicans in Hematopoietic Transplantation J. Immunol., March 15, 2002; 168(6): 2904 - 2913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. McLellan, M. Kapp, A. Eggert, C. Linden, U. Bommhardt, E.-B. Brocker, U. Kammerer, and E. Kampgen Anatomic location and T-cell stimulatory functions of mouse dendritic cell subsets defined by CD4 and CD8 expression Blood, March 15, 2002; 99(6): 2084 - 2093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Merad, T. Sugie, E. G. Engleman, and L. Fong In vivo manipulation of dendritic cells to induce therapeutic immunity Blood, March 1, 2002; 99(5): 1676 - 1682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Martin, S. R. Ruiz, G. M. del Hoyo, F. Anjuere, H. H. Vargas, M. Lopez-Bravo, and C. Ardavin Dramatic increase in lymph node dendritic cell number during infection by the mouse mammary tumor virus occurs by a CD62L-dependent blood-borne DC recruitment Blood, February 15, 2002; 99(4): 1282 - 1288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. O'Connell, W. Li, Z. Wang, S. M. Specht, A. J. Logar, and A. W. Thomson Immature and Mature CD8{alpha}+ Dendritic Cells Prolong the Survival of Vascularized Heart Allografts J. Immunol., January 1, 2002; 168(1): 143 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bjorck Isolation and characterization of plasmacytoid dendritic cells from Flt3 ligand and granulocyte-macrophage colony-stimulating factor-treated mice Blood, December 15, 2001; 98(13): 3520 - 3526. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nakano, M. Yanagita, and M. D. Gunn Cd11c+B220+Gr-1+ Cells in Mouse Lymph Nodes and Spleen Display Characteristics of Plasmacytoid Dendritic Cells J. Exp. Med., October 15, 2001; 194(8): 1171 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schlecht, C. Leclerc, and G. Dadaglio Induction of CTL and Nonpolarized Th Cell Responses by CD8{alpha}+ and CD8{alpha}- Dendritic Cells J. Immunol., October 15, 2001; 167(8): 4215 - 4221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Maldonado-Lopez, C. Maliszewski, J. Urbain, and M. Moser Cytokines Regulate the Capacity of CD8{alpha}+ and CD8{alpha}- Dendritic Cells to Prime Th1/Th2 Cells In Vivo J. Immunol., October 15, 2001; 167(8): 4345 - 4350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Izon, K. Rudd, W. DeMuth, W. S. Pear, C. Clendenin, R. C. Lindsley, and D. Allman A Common Pathway for Dendritic Cell and Early B Cell Development J. Immunol., August 1, 2001; 167(3): 1387 - 1392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Grohmann, F. Fallarino, R. Bianchi, M. L. Belladonna, C. Vacca, C. Orabona, C. Uyttenhove, M. C. Fioretti, and P. Puccetti IL-6 Inhibits the Tolerogenic Function of CD8{{alpha}}+ Dendritic Cells Expressing Indoleamine 2,3-Dioxygenase J. Immunol., July 15, 2001; 167(2): 708 - 714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Henri, D. Vremec, A. Kamath, J. Waithman, S. Williams, C. Benoist, K. Burnham, S. Saeland, E. Handman, and K. Shortman The Dendritic Cell Populations of Mouse Lymph Nodes J. Immunol., July 15, 2001; 167(2): 741 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Manz, D. Traver, T. Miyamoto, I. L. Weissman, and K. Akashi Dendritic cell potentials of early lymphoid and myeloid progenitors Blood, June 1, 2001; 97(11): 3333 - 3341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Martinon-Ego, R. Berthier, F. Cretin, V. Collin, A.-M. Laharie, and P. N. Marche Murine Dendritic Cells Derived from Myeloid Progenitors of the Thymus Are Unable to Produce Bioactive IL-12p70 J. Immunol., April 15, 2001; 166(8): 5008 - 5017. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Y. Vermaelen, I. Carro-Muino, B. N. Lambrecht, and R. A. Pauwels Specific Migratory Dendritic Cells Rapidly Transport Antigen from the Airways to the Thoracic Lymph Nodes J. Exp. Med., January 1, 2001; 193(1): 51 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Banchereau, B. Pulendran, R. Steinman, and K. Palucka Will the Making of Plasmacytoid Dendritic Cells in Vitro Help Unravel Their Mysteries? J. Exp. Med., December 18, 2000; 192(12): f39 - f44. [Full Text] [PDF]
|
|
|
|
 |
|
 D. Traver, K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, and I. L. Weissman Development of CD8{alpha}-Positive Dendritic Cells from a Common Myeloid Progenitor Science, December 15, 2000; 290(5499): 2152 - 2154. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
-positive dendritic cells in vivo
Top
Abstract
Introduction
