| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Medicine Branch, National Cancer Institute,
Division of Clinical Sciences, National Institutes of Health, Bethesda,
MD; Center for Biologics Evaluation and Research, Rockville, MD; and
Laboratory of Pathology, National Cancer Institute, Division of
Clinical Science, National Institutes of Health, Bethesda, MD.
Solid tumors are dependent on preexisting vasculature and
neovascularization for their growth. Successful cancer therapies targeting the tumor vasculature would be expected to block the existing
tumor blood supply and to prevent tumor neovascularization. We tested
the antitumor activity of experimental therapy with 2 distinct
antiangiogenic drugs. Vasostatin inhibits endothelial cell growth and
neovascularization, and interleukin-12 (IL-12) targets the tumor
vasculature acting through interferon- The survival, growth, and spread of tumors are
dependent on an adequate blood supply achieved through cooption of
existing blood vessels, neovascularization, and formation of blood
channels.1-6 Drugs that selectively inhibit angiogenesis
may offer a treatment modality that is complementary to drugs
that target tumor cells directly.
Endothelial cell disruption of intercellular junctions, changes in
vessel permeability, proteolysis of the extracellular matrix proteins,
endothelial cell proliferation and migration into the interstitial
matrix, and assembly into patent tubes represent angiogenesis steps
potentially amenable to selective regulation.7-10 Mature
vascular endothelium is heterogeneous with respect to expression of
surface determinants, patterns of cell growth, and expression of
metalloproteinases that degrade the extracellular
matrix.11-13 The tumor vasculature can display peculiar
morphologies,14 in part because of decreased densities of
periendothelial support cells,15 increased
permeability,14 and enhanced endothelial cell
proliferation.16 Tumor tissues may contain abnormally high levels of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) that promote angiogenesis, as well as
decreased levels of thrombospondin and IFN- Current efforts at targeting the tumor vasculature exploit the
existence of distinct stages of angiogenesis, the heterogeneity of the
vascular endothelium, and potential alterations of the tumor
vasculature. Neutralizing antibodies directed at VEGF, VEGF receptor 2, or soluble VEGF receptors can block VEGF-induced endothelial cell
proliferation,21-23 and antisense targeting of bFGF and
FGF receptor 1 can suppress bFGF-induced intratumoral
angiogenesis.24 Antibodies to the integrin
We tested the anticancer efficacy of a novel therapeutic approach that
combines distinct antiangiogenic agents. Individually, vasostatin,
which specifically inhibits proliferating endothelial cells, and IL-12,
which inhibits angiogenesis indirectly, produced distinct efficacy
profiles. In combination, these drugs halted tumor growth in mice.
Cell cultures
Matrigel angiogenesis assay
Mouse tumor models BALB/c nu/nu or athymic nude mice 6 weeks of age (National Cancer Institute, Frederick, MD) maintained in pathogen-limited conditions received 400 rad (1 rad = 0.01 Gy) total body irradiation and 24 hours later were injected subcutaneously in the right abdominal quadrant with human Burkitt lymphoma (8 × 106 CA46 cells), colon carcinoma (107 SW620 cells), or human ovarian carcinoma (8 × 106 OVCAR cells). Beginning 1 to 5 days after cell inoculation and continuing daily thereafter, 6 days a week the mice received subcutaneously inoculations (0.1 mL total injection volume) of test drugs or formulation buffer control proximal to the site of original cell injection. Formulation buffer consisted of sterile saline solution containing 50 mg/mL human albumin and 5 mg/mL mannitol (endotoxin less than 5 EU/mL). Recombinant vasostatin (MBP-vasostatin) was purified from Escherichia coli as previously described28 and was found to contain less than 5 EU/10 µg protein. Recombinant murine IL-12 was a gift of Genetics Institute Inc (Cambridge, MA) and contained less than 8 EU/mg protein. Tumor size was estimated in centimeters squared (cm2) as the product of 2-dimensional caliper measurements (longest perpendicular length and width). Tumor weight was measured after the tumors were removed in toto from the animals.Immunohistochemistry Paraffin-embedded tissue sections were deparaffinized twice in xylene and rehydrated through graded ethanol washes as previously described.33 Staining for the human Ki-67 antigen with MIB-1 monoclonal antibody (Immunotech, Westbrook, ME) followed previously described methods.36 Staining for murine CD31 was performed on trypsin-treated sections using a rat monoclonal primary antibody (PharMingen, San Diego, CA) and a biotinylated goat antirat secondary antibody (Vector Labs, Burlingame, CA), followed by a Vectastain ABC peroxidase complex (Vector Labs). Apoptosis was detected on tissue sections by Tumor TACS in situ kit (R&D Systems, Inc, Minneapolis, MN). Staining for murine perforin was performed on paraffin-embedded tumor tissue sections using a rat antimouse perforin monoclonal antibody (Kamiya Biomedical Co, Seattle, WA) and a biotynilated goat antirat secondary antibody (Pharmingen), as previously described.37Semiquantitative reverse transcriptase-polymerase chain reaction Total cellular RNA was extracted from tumor tissues by Trizol (Gibco-BRL, Gaithersburg, MD); 4 µg RNA was reverse transcribed using Rnase H-RT (Supercript, Gibco/BRL) as described.33 The primers for murine IP-10 and perforin (not cross-reactive with human) were previously described.33 The murine mitocondrial cytochrome oxidase subunit II gene (MOXII, GenBank accession no J01420), was selected as the housekeeping gene for murine tissues38; the primer pair sequence was 5': TGGCCTACCCATTCCAACTT and 3': GGTTAACGCTCTTAGCTTCA. The semiquantitative polymerase chain reaction (PCR) assays for murine IP-10 and perforin were previously described.33 The semiquantitative PCR assay for MOXII (25 cycles at 60 °C), amplified selectively murine complementary DNA (cDNA).Statistical analysis The means, least square means, and standard deviations were derived using conventional formulas. The slopes of tumor growth were estimated by fitting linear regression lines to tumor size data. Slopes of tumor growth, tumor measurements at completion of the experiments, and tumor weights were analyzed by 2-way analysis of variance with interaction. Dunnett's method was used for pairwise comparisons with controls. Additional pairwise comparisons of the combined effect of drugs were made by t test, using estimates of variance from the 2-way analysis of variance.39
Vasostatin can directly inhibit the proliferation of primary
cultures of human umbilical vein endothelial cells (HUVEC) and fetal
bovine heart endothelial (FBHE) cells induced by either bFGF or
VEGF,27,28 whereas human and murine IL-12 do
not.34,35 As expected, neither vasostatin nor murine IL-12
inhibited the spontaneous proliferation in vitro of the human Burkitt
lymphoma (CA46), colon carcinoma (SW620), and ovarian carcinoma (OVCAR) cell lines (not shown). A Matrigel-based assay was used to evaluate the
effects of vasostatin and murine (mu) IL-12, alone and together, on
bFGF-induced angiogenesis in vivo (Table
1). In this assay, bFGF promotes the
invasion of von Willebrand factor-positive endothelial cells and
vascular structures into the Matrigel plug.33 Vasostatin at concentrations of 50 or 10 µg/mL inhibited bFGF-induced
neovascularization by 57% and 25%, respectively, whereas muIL-12 at
concentrations of 50 and 10 ng/mL inhibited bFGF-induced
neovascularization by 44% and 29%, respectively. When added together
at the higher and lower concentrations, vasostatin and muIL-12
inhibited neovascularization by 79% and 58%, respectively.
We tested the effects of vasostatin and muIL-12, alone and together, on
human Burkitt lymphoma, colon carcinoma, and ovarian carcinoma
established in nude mice (Figure 1).
These tumors were selected on the basis of previous experiments in
which vasostatin was either very effective (Burkitt lymphoma, CA46 cell
line), moderately effective (colon carcinoma, SW620 cell line), or
marginally effective (ovarian carcinoma, OVCAR cell line) at reducing
tumor growth under similar experimental conditions. The Burkitt cell line CA46 was inoculated subcutaneously (sc) into athymic mice, and 5 days later the established tumors were treated with daily sc
inoculations (6 days per week) of either formulation buffer (buffer)
alone, vasostatin alone (100 µg/d), muIL-12 alone (200 ng/d for 8 days, followed by 100 ng/d), or the combination of vasostatin and
muIL-12 (same dose used as single agents). All mice were killed after
16 days of treatment (Figure 1). The rate of tumor growth and tumor
size were significantly reduced by treatment with vasostatin, muIL-12,
or the combination of vasostatin plus muIL-12, compared with the
control group treated with buffer alone (P < .05 for all
comparisons). In addition, the combination treatment of vasostatin plus
muIL-12 reduced tumor growth more effectively than vasostatin or
muIL-12 alone (P < .05, both comparisons).
Treatment with vasostatin and muIL-12 in combination was also very effective at reducing the growth of the colon carcinoma SW620 and the ovarian carcinoma OVCAR cell lines in nude mice (Figure 1). In both experiments, vasostatin (100 µg/d; 6 days per week) and muIL-12 (100 ng/d; 6 days per week) were injected sc beginning 1 day and 2 days, respectively, after cell inoculation. The growth rate and weight of colon carcinoma tumors were significantly reduced by vasostatin, muIL-12, and the combination of vasostatin and muIL-12, compared with the control group (P < .05, all comparisons). Furthermore, the combination treatment of vasostatin plus muIL-12 was significantly more effective at reducing tumor size and weight than each drug alone (P < .05, both comparisons). With ovarian carcinoma (Figure 1), muIL-12 alone or in combination with vasostatin significantly reduced tumor growth rate and weight compared with buffer alone (P < .05 both comparisons). As expected, the effect of vasostatin alone did not reach statistical significance (P > .05). In combination, muIL-12 plus vasostatin appeared more effective than vasostatin alone and muIL-12 alone at reducing tumor weight. The effect was significant when the combination treatment was compared with vasostatin alone (P < .05) and approached significance when compared with muIL-12 alone (P = .065). Thus, treatment with 2 distinct inhibitors of angiogenesis, vasostatin and IL-12, was very effective at reducing experimental tumor growth, and the combined effect, in most cases, was significantly more effective than each agent used alone. Histologically, the Burkitt tumor tissue from mice treated with
formulation buffer alone or vasostatin alone (Figure
2) consisted of a mostly viable
monomorphic population of large lymphoid cells with prominent nucleoli
and numerous mitoses. There was minimal tumor tissue necrosis and
inflammation. Tumors treated with IL-12 alone displayed massive zonal
tissue necrosis interspersed with islands of viable tumor. Infiltration
by lymphocytes and macrophages was noted within the necrotic tumor
tissue. Mice treated with vasostatin plus mIL-12 displayed only a few
small foci of viable Burkitt tumor cells and residual foci of necrotic
tumor. The surrounding soft tissue was edematous with infiltration by
macrophages and lymphocytes.
Staining these Burkitt tissues for human Ki-67 nuclear antigen
revealed that the proportion of proliferating cells within the viable
tumor was similar in control, vasostatin-, or IL-12-treated animals
(Figure 3). Because of the extensive
tumor tissue necrosis, Ki-67 staining was restricted to the islands of
viable tumor tissue in IL-12-treated animals. Ki-67 positive cells
were rare in tumors treated with both drugs together, presumably
because of the paucity of residual viable tumor cells. The proportion
of apoptotic cells in Burkitt tumor tissues, estimated by TUNEL, was on
the average, 28 positive cells per low power (40×) field in the
control, as opposed to 49 in the vasostatin group. Large areas of
confluent tumor cells and numerous scattered individual cells (92 per
field) were TUNEL-positive in the IL-12-treated group. There were
numerous TUNEL-positive cells confined to small areas of residual tumor tissues from the group that received vasostatin plus IL-12. The tumor
vasculature, assessed by staining for the murine endothelial cell
antigen CD31, was recognized throughout Burkitt tumor tissues treated
with buffer alone (Figure 4A). By
contrast, CD31-positive structures and cells were noted infrequently in
vasostatin-treated tumors (Figure 4B). Tumors treated with IL-12
displayed abundant and disorganized proliferation CD31-positive cells
not resulting in the formation of distinct vascular channels (Figure
4C). There were virtually no CD31 positive vascular structures or cells
within tumor tissues from animals treated with IL-12 plus vasostatin (Figure 4D). By semiquantitative reverse transcriptase (RT)-PCR analysis, expression of the murine IFN
The microscopic features of colon and ovarian carcinomas treated with vasostatin, muIL-12, or vasostatin plus muIL-12 mimicked closely the patterns noted with Burkitt tumors. From the control and vasostatin-treated groups, colon carcinomas were composed of confluent sheets of poorly differentiated epithelial cells with occasional small foci of dead tumor cells, whereas ovarian carcinomas were composed mostly of glandular structures with a modest fibrovascular core (Figure 2). By contrast, colon and ovarian carcinomas treated with IL-12 alone displayed large areas of zonal necrotic tumor tissue mixed with viable tumor tissue (Figure 2). After treatment with IL-12 plus vasostatin, only small islands of viable tumor remained in colon carcinomas, whereas in ovarian carcinomas, a higher proportion of viable tumor was noted (Figure 2). Staining for human Ki-67 nuclear antigen revealed that the proportion of proliferating cells was similar in control and vasostatin-treated colon and ovarian carcinomas (Figure 3). However, in tumors treated with IL-12 with or without vasostatin, Ki-67 positive cells were confined to viable areas of the tumor. In the viable tumor, which was infrequent in animals bearing colon carcinomas treated with IL-12 plus vasostatin, the proportion of proliferating cells was similar to the controls (Figure 3). By TUNEL, apoptotic cells were more numerous in vasostatin than in buffer-treated colon and ovarian carcinomas (on the average, 92 as opposed to 52 positive cells per field [40×] in colon carcinomas, and 58 as opposed to 17 in ovarian carcinomas, respectively). Large areas of nonviable tissue from colon and ovarian carcinoma tumors treated with IL-12 stained positive for TUNEL. Within residual viable ovarian carcinoma tissues, the number of apoptotic cells was similar in the IL-12 plus vasostatin-treated group (66 and 58 positive cells per field, respectively). In colon carcinomas, accurate determinations of TUNEL-positive cells in tumors treated with IL-12 plus vasostatin could not be made because of the extensive tissue necrosis. Perforin-positive cells were identified in IL-12-treated colon (Figure 6) and ovarian (Figure 6) tumors with or without vasostatin, but rarely in buffer or vasostatin only-treated tumors.
These studies reveal that combination therapy with distinct
angiogenesis inhibitors is extremely effective at reducing experimental tumor growth. Although human Burkitt lymphoma, colon carcinoma, and
ovarian carcinoma cell lines grow rapidly as sc tumors in nude mice,
vasostatin and IL-12 in combination essentially halted their growth.
Vasostatin is a direct and specific inhibitor of new vessel formation
that suppresses endothelial cell growth.27,28 IL-12
targets the tumor vasculature, acting indirectly through the downstream
IFN- Burkitt, colon, and ovarian tumors from mice treated with vasostatin alone differed from the controls for their smaller size but were otherwise indistinguishable from controls, macroscopically and microscopically. The only noted differences included a small increase in the frequency of tumor cell death detected by TUNEL and an overall reduction of CD31-positive tumor vasculature in the vasostatin as opposed to the control groups. This pattern would be expected from a pure inhibitor of new vessel formation that blocks endothelial cell growth, leaving quiescent blood vessels intact. In the absence of neovascularization, a tumor should not grow or grow only to the extent to which the existing vasculature or the formation of nonendothelial blood channels would permit it. Because tumor cells generally die by apoptosis when deprived of nutrients,41 tumor size would be the result of a balance between tumor cell growth and subsequent cell death. In contrast to tumors from mice treated with vasostatin alone, tumors
from mice treated with IL-12 alone were remarkable, not only for their
reduced size compared with the controls but also for the extensive
zonal tissue necrosis involving all parts of the tumor. The substantial
amount of tumor tissue necrosis indicates that the tumor grew and
subsequently died. The presence of abundant CD31-positive cells that
did not form distinct vascular structures and the zonal distribution of
tissue necrosis point toward a drug effect on tumor vessels, resulting
in the starvation of the tumor zones fed by those vessels. In this
system, murine IL-12 is not expected to have a direct or
IFN The mechanism by which IP-10 and Mig target the endothelium is
controversial, in part because of conflicting reports as to the
expression of the CXCR3 IP-10 and Mig receptor on endothelial cells,
and the possibility that their antiangiogenic effect may be
indirect.47-49 We have previously shown that NK cells play
a critical role as mediators of the antiangiogenic activities of IL-12
in nude mice.33 Because NK cells activated by IL-12 are strongly cytotoxic for primary cultures of syngeneic endothelial cells,
we have proposed that NK-cell-mediated cytotoxicity of endothelial
cells contributes to inhibition of angiogenesis by IL-12. In this
scenario, NK cells would play a dual role as a source of muIFN The results of dual therapy with vasostatin and IL-12 suggest that this novel approach to cancer treatment can be very effective. Tumors from mice treated with vasostatin and IL-12 in combination were in most cases significantly smaller than tumors from mice treated with each agent alone. Within the small residual tumor tissue, there was tissue necrosis often mixed in with foci of viable tumor tissue or just clusters of tumor cells. Few, if any, vessels or cells staining for CD31 were identified within or immediately surrounding the small residual tumor tissue. Both the size and the morphology of tumors from mice treated with vasostatin plus IL-12 could be explained as the result of antiangiogenic agents acting independently. By inhibiting new vessel formation, vasostatin would reduce progressive tumor growth. By targeting unique characteristics of the tumor vasculature, IL-12 would compromise tumor angiogenesis occurring despite inhibition by vasostatin. As a result, there would be tissue necrosis within already small tumors. There is considerable new evidence that angiogenesis is essential to tumor growth.6 The encouraging results of therapy that combines distinct inhibitors of angiogenesis supports the view that antiangiogenic therapy can be an effective approach to cancer treatment. Should these angiogenesis inhibitors be combined with treatment modalities that target directly the tumor cells such as chemotherapy and radiation therapy, perhaps complete eradication of cancer might be possible.
We thank Drs Josh Farber, Parris Burd, Hynda Kleinman, Robert Yarchoan, and Hira Nakhasi for their contributions to different aspects of this work, and Genetics Institute, Inc, for donating muIL-12.
Submitted January 5, 2000; accepted April 26, 2000.
Supported in part by a National Cancer Institute intramural grant (IRA AWD-7).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Giovanna Tosato, NIH Bethesda Campus, Bldg 10, Rm 12N226, 8800 Rockville Pike, Bethesda, MD 20892; e-mail: tosatog{at}mail.nih.gov.
1.
Folkman J.
What is the evidence that tumors are angiogenesis dependent? [editorial].
J Natl Cancer Inst.
1990;82:4 2. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med. 1971;285:1182. 3. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell. 1996;86:353[Medline] [Order article via Infotrieve].
4.
Holash J, Maisonpierre PC, Compton D, et al.
Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF.
Science.
1999;284:1994
5.
Asahara T, Murohara T, Sullivan A, et al.
Isolation of putative progenitor endothelial cells for angiogenesis.
Science.
1997;275:964 6. Lyden D, Young AZ, Zagzag D, et al. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts [In Process Citation]. Nature. 1999;401:670[Medline] [Order article via Infotrieve].
7.
Folkman J, Shing Y.
Angiogenesis.
J Biol Chem.
1992;267:10931 8. D'Amore PA. Mechanisms of endothelial growth control. Am J Respir Cell Mol Biol. 1992;6:1. 9. Jain RK, Schlenger K, Hockel M, Yuan F. Quantitative angiogenesis assays: progress and problems. Nat Med. 1997;3:1203[Medline] [Order article via Infotrieve]. 10. Sage EH. Angiogenesis inhibition in the context of endothelial cell biology. Adv Oncol. 1996;12:17. 11. Montesano R. 1992 Mack Forster Award Lecture: review, regulation of angiogenesis in vitro. Eur J Clin Invest. 1992;22:504[Medline] [Order article via Infotrieve]. 12. Cornelius LA, Nehring LC, Roby JD, Parks WC, Welgus HG. Human dermal microvascular endothelial cells produce matrix metalloproteinases in response to angiogenic factors and migration. J Invest Dermatol. 1995;105:170[Medline] [Order article via Infotrieve]. 13. Campbell JJ, Haraldsen G, Pan J, et al. The chemokine receptor CCR4 in vascular recognition by cutaneous but not intestinal memory T cells. Nature. 1999;400:776[Medline] [Order article via Infotrieve].
14.
Jain RK.
Determinants of tumor blood flow: a review.
Cancer Res.
1988;48:2641 15. Schlingemann RO, Rietveld FJ, Kwaspen F, van de Kerkhof PC, de Waal RM, Ruiter DJ. Differential expression of markers for endothelial cells, pericytes, and basal lamina in the microvasculature of tumors and granulation tissue. Am J Pathol. 1991;138:1335[Abstract].
16.
Cavallo T, Sade R, Folkman J, Cotran RS.
Tumor angiogenesis: rapid induction of endothelial mitoses demonstrated by autoradiography.
J Cell Biol.
1972;54:408 17. Rastinejad F, Polverini PJ, Bouck NP. Regulation of the activity of a new inhibitor of angiogenesis by a cancer suppressor gene. Cell. 1989;56:345[Medline] [Order article via Infotrieve].
18.
Dameron KM, Volpert OV, Tainsky MA, Bouck N.
Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1.
Science.
1994;265:1582 19. O'Reilly MS, Holmgren L, Shing Y, et al. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma [see comments]. Cell. 1994;79:315[Medline] [Order article via Infotrieve]. 20. Dong Z, Kumar R, Yang X, Fidler IJ. Macrophage-derived metalloelastase is responsible for the generation of angiostatin in Lewis lung carcinoma. Cell. 1997;88:801[Medline] [Order article via Infotrieve].
21.
Kendall RL, Thomas KA.
Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor.
Proc Natl Acad Sci U S A.
1993;90:10705 22. Kim KJ, Li B, Winer J, et al. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature. 1993;362:841[Medline] [Order article via Infotrieve]. 23. Skobe M, Rockwell P, Goldstein N, Vosseler S, Fusenig NE. Halting angiogenesis suppresses carcinoma cell invasion. Nat Med. 1997;3:1222[Medline] [Order article via Infotrieve]. 24. Wang Y, Becker D. Antisense targeting of basic fibroblast growth factor and fibroblast growth factor receptor-1 in human melanomas blocks intratumoral angiogenesis and tumor growth. Nat Med. 1997;3:887[Medline] [Order article via Infotrieve]. 25. Brooks PC, Montgomery AM, Rosenfeld M, et al. Integrin alpha v beta 3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell. 1994;79:1157[Medline] [Order article via Infotrieve]. 26. Eliceiri BP, Cheresh DA. The role of alphav integrins during angiogenesis: insights into potential mechanisms of action and clinical development. J Clin Invest. 1999;103:1227[Medline] [Order article via Infotrieve].
27.
Pike SE, Yao L, Setsuda J, et al.
Calreticulin and calreticulin fragments are endothelial cell inhibitors that suppress tumor growth [In Process Citation].
Blood.
1999;94:2461
28.
Pike SE, Yao L, Jones KD, et al.
Vasostatin, a calreticulin fragment, inhibits angiogenesis and suppresses tumor growth.
J Exp Med.
1998;188:1 29. Stetler-Stevenson WG. Matrix metalloproteinases in angiogenesis: a moving target for therapeutic intervention. J Clin Invest. 1999;103:1237[Medline] [Order article via Infotrieve]. 30. O'Reilly MS, Holmgren L, Chen C, Folkman J. Angiostatin induces and sustains dormancy of human primary tumors in mice. Nat Med. 1996;2:689[Medline] [Order article via Infotrieve]. 31. O'Reilly MS, Boehm T, Shing Y, et al. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell. 1997;88:277[Medline] [Order article via Infotrieve].
32.
O'Reilly MS, Pirie-Shepherd S, Lane WS, Folkman J.
Antiangiogenic activity of the cleaved conformation of the serpin antithrombin [see comments].
Science.
1999;285:1926
33.
Yao L, Sgadari C, Furuke K, Bloom ET, Teruya-Feldstein J, Tosato G.
Contribution of natural killer cells to inhibition of angiogenesis by interleukin-12.
Blood.
1999;93:1612
34.
Sgadari C, Angiolillo AL, Tosato G.
Inhibition of angiogenesis by interleukin-12 is mediated by the interferon-inducible protein 10.
Blood.
1996;87:3877
35.
Voest EE, Kenyon BM, O'Reilly MS, Truitt G, D'Amato RJ, Folkman J.
Inhibition of angiogenesis in vivo by interleukin 12 [see comments].
J Natl Cancer Inst.
1995;87:581 36. Quintanilla-Martinez L, Franklin JL, Guerrero I, et al. Histological and immunophenotypic profile of nasal NK/T cell lymphomas from Peru: high prevalence of p53 overexpression. Hum Pathol. 1999;30:849[Medline] [Order article via Infotrieve]. 37. Watanabe H, Miyaji C, Kawachi Y, et al. Relationships between intermediate TCR cells and NK1.1+ T cells in various immune organs: NK1.1+ T cells are present within a population of intermediate TCR cells. J Immunol. 1995;155:2972[Abstract].
38.
Ruvolo M, Pan D, Zehr S, Goldberg T, Disotell TR, von Dornum M.
Gene trees and hominoid phylogeny.
Proc Natl Acad Sci U S A.
1994;91:8900 39. Dunnett CW. A multiple comparison procedure for comparing several treatment with a control. J Am Stat Assoc. 1995;50:1096. 40. Coughlin CM, Salhany KE, Gee MS, et al. Tumor cell responses to IFNgamma affect tumorigenicity and response to IL-12 therapy and antiangiogenesis. Immunity. 1998;9:25[Medline] [Order article via Infotrieve].
41.
Cherney BW, Bhatia K, Tosato G.
A role for deregulated c-Myc expression in apoptosis of Epstein-Barr virus-immortalized B cells.
Proc Natl Acad Sci U S A.
1994;91:12967 42. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-gamma. Annu Rev Immunol. 1997;15:749[Medline] [Order article via Infotrieve].
43.
Tosato G, Sgadari C, Taga K, et al.
Regression of experimental Burkitt's lymphoma induced by Epstein-Barr virus-immortalized human B cells.
Blood.
1994;83:776
44.
Tannenbaum CS, Tubbs R, Armstrong D, Finke JH, Bukowski RM, Hamilton TA.
The CXC chemokines IP-10 and Mig are necessary for IL-12-mediated regression of the mouse RENCA tumor.
J Immunol.
1998;161:927 45. Kanegane C, Sgadari C, Kanegane H, et al. Contribution of the CXC chemokines IP-10 and Mig to the antitumor effects of IL-12. J Leukoc Biol. 1998;64:384[Abstract]. 46. Farber JM. Mig and IP-10: CXC chemokines that target lymphocytes. J Leukoc Biol. 1997;61:246[Abstract].
47.
Luster A, Greenberg S, Leder P.
The IP-10 chemokine binds to a specific cell surface heparan sulfate site shared with platelet factor 4 and inhibits endothelial cell proliferation.
J Exp Med.
1995;182:219 48. Piali L, Weber C, LaRosa G, et al. The chemokine receptor CXCR3 mediates rapid and shear-resistant adhesion-induction of effector T lymphocytes by the chemokines IP10 and Mig. Eur J Immunol. 1998;28:961[Medline] [Order article via Infotrieve].
49.
Soto H, Wang W, Strieter RM, et al.
The CC chemokine 6Ckine binds the CXC chemokine receptor CXCR3.
Proc Natl Acad Sci U S A.
1998;95:8205
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. Zipin-Roitman, T. Meshel, O. Sagi-Assif, B. Shalmon, C. Avivi, R. M. Pfeffer, I. P. Witz, and A. Ben-Baruch CXCL10 Promotes Invasion-Related Properties in Human Colorectal Carcinoma Cells Cancer Res., April 1, 2007; 67(7): 3396 - 3405. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pal, J. Wu, J. K. Murray, S. H. Gellman, M. A. Wozniak, P. J. Keely, M. E. Boyer, T. M. Gomez, S. M. Hasso, J. F. Fallon, et al. An antiangiogenic neurokinin-B/thromboxane A2 regulatory axis J. Cell Biol., September 25, 2006; 174(7): 1047 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Hong, P. Kumar, L. Wang, B. Damania, M. L. Gulley, H.-J. Delecluse, P. J. Polverini, and S. C. Kenney Epstein-Barr Virus Lytic Infection Is Required for Efficient Production of the Angiogenesis Factor Vascular Endothelial Growth Factor in Lymphoblastoid Cell Lines J. Virol., November 15, 2005; 79(22): 13984 - 13992. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nyberg, L. Xie, and R. Kalluri Endogenous Inhibitors of Angiogenesis Cancer Res., May 15, 2005; 65(10): 3967 - 3979. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Vucenik, A. Passaniti, M. I. Vitolo, K. Tantivejkul, P. Eggleton, and A. M. Shamsuddin Anti-angiogenic activity of inositol hexaphosphate (IP6) Carcinogenesis, November 1, 2004; 25(11): 2115 - 2123. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Rakhmilevich, A. T. Hooper, D. J. Hicklin, and P. M. Sondel Treatment of experimental breast cancer using interleukin-12 gene therapy combined with anti-vascular endothelial growth factor receptor-2 antibody Mol. Cancer Ther., August 1, 2004; 3(8): 969 - 976. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. TOSETTI, N. FERRARI, S. DE FLORA, and A. ALBINI Angioprevention': angiogenesis is a common and key target for cancer chemopreventive agents FASEB J, January 1, 2002; 16(1): 2 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Marchand, N. Noiseux, J.-F. Tanguay, and M. G. Sirois Blockade of in vivo VEGF-mediated angiogenesis by antisense gene therapy: role of Flk-1 and Flt-1 receptors Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H194 - H204. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Kerbel Clinical Trials of Antiangiogenic Drugs: Opportunities, Problems, and Assessment of Initial Results J. Clin. Oncol., September 15, 2001; 19(90001): 45s - 51. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||