|
|
 Previous Article | Table of Contents | Next Article 
Blood, 15 September 2000, Vol. 96, No. 6, pp. 2093-2099
HEMATOPOIESIS
Interferon- directly represses megakaryopoiesis by inhibiting
thrombopoietin-induced signaling through induction of
SOCS-1
Qin Wang,
Yoshitaka Miyakawa,
Norma Fox, and
Kenneth Kaushansky
From the Division of Hematology, University of
Washington School of Medicine, Seattle, WA.
 |
Abstract |
Interferon (IFN)- has proven useful for treating several
clinical conditions, including chronic viral hepatitis and chronic myeloproliferative and lymphoproliferative disorders. In addition to
its well-known antiviral effects, the cytokine exerts antiproliferative effects on many cell types, helping to explain its therapeutic usefulness in these latter conditions. However, this same property accounts for several undesirable effects, including thrombocytopenia, which can interfere with the successful clinical application of IFN-. Unfortunately, the mechanisms responsible for the
myelosuppressive effects of the cytokine are incompletely understood.
The effects of IFN- on megakaryocyte (MK) development were studied.
Using several marrow cell purification techniques and quantitative
culture methods, it was found that IFN- directly inhibits
thrombopoietin (TPO)-induced MK growth. Previous studies indicated
that Janus kinase (JAK) and its substrates mediate the effects of
TPO on cellular proliferation and survival. It was found that IFN-
directly suppresses TPO-induced phosphorylation of the JAK2 substrates c-Mpl and STAT 5 in a TPO-dependent hematopoietic cell line and of Mpl
and STAT3 in primary murine MK. Moreover, IFN- induces SOCS-1
production in these cells, which has been shown to inhibit TPO-induced
cell growth. Because SOCS protein expression is induced by many
cytokines and has been reported to extinguish signaling from several
hematopoietic cytokine receptors, these results identify a molecular
mechanism responsible for cytokine receptor cross-talk.
(Blood. 2000;96:2093-2099)
© 2000 by The American Society of Hematology.
| |
Introduction |
Interferon (IFN)- has proven a useful
therapeutic agent in a number of clinical settings, including chronic
viral infections (eg, hepatitis B, C, and G)1-3 and
several neoplastic disorders (eg, chronic myelogenous leukemia
[CML],4 essential thrombocythemia,5 Hodgkin
disease,6 and non-Hodgkin lymphoma7). The
efficacy of the cytokine is in large measure mediated by its
antiproliferative effect on a variety of cells, at least in the latter
settings. However, in addition to its desired effect to reduce viral or pathologic cell growth, the antiproliferative effects of the cytokine are associated with detrimental actions. For example, in several series
of patients treated with IFN- for viral hepatitis, thrombocytopenia developed8-12 and interfered with continued full-dose
therapy in the more severely affected patients.8-10
Although some previous studies suggest that immune mechanisms mediate
the thrombocytopenic effects of IFN-,13,14 other investigations have focused on the myelosuppressive effects of the
cytokine. Several studies using murine or human marrow cells have shown
that IFN- can suppress megakaryocyte (MK) formation. Concentrations
of 10 to 1000 U/mL IFN- inhibit MK colony formation by 30% to 60%
and MK growth in suspension cultures by a similar degree.15-18 However, all the reported studies have used
whole marrow cells or minimally purified fractions of whole marrow (eg, low-density, adherence-depleted cells). Because IFN- has also been
shown to inhibit the growth of marrow-derived
fibroblasts,16,19 cells that are present in whole marrow
cultures and in minimally fractionated cell populations and that form a
large part of the hematopoietic microenvironment, it is possible that
IFN- exerts only an indirect effect on megakaryopoiesis. Work with
other hematopoietic cells also suggests that the effects of IFN- may
be indirect, mediated by the marrow microenvironment. For example,
neoplastic cells derived from patients with CML adhere poorly to marrow
stromal cells; IFN- has been shown to enhance CML cell adhesion to
marrow stromal cells, re-establishing the capacity of the marrow
microenvironment to regulate hematopoietic cell growth.20
Moreover, IFN--induced erythroid cell suppression is reportedly
caused by a soluble factor released from T lymphocytes.21
Unfortunately, whether these IFN- effects on the marrow stroma,
cellular adhesion, or T cells underlie its role in the growth of MK and
the molecular mechanisms by which IFN- leads to myelosuppression is
not yet fully understood.
Recently, work from other laboratories and from our own has led to the
cloning and characterization of thrombopoietin (TPO), the primary
regulator of MK and platelet production.22 Like other
members of the type 1 family of hematopoietic cytokine receptors, the
TPO receptor (c-Mpl) induces its biologic effects on ligand-induced multimerization by the activation of Janus kinase (JAK). Although a
member of the type 2 family of cell surface receptors, the IFN receptors also transduce cellular effects by the induction of JAK,
which, in turn, triggers many of the same signaling pathways initiated
by TPO and other hematopoietic cytokines. These findings suggest that
some form of cross-talk between TPO and IFN receptors might mediate the
effects of IFN- on MK development. The recent cloning and
characterization of suppressors of cytokine signaling (SOCS;
alternatively termed cytokine-inducible SH-2 protein [CIS], signal
transduction and activators of transcription [STAT]-induced STAT
inhibitor [SSI], and JAK binding [JAB] protein), a recently discovered family of STAT-induced proteins that serves to extinguish cytokine signaling (reviewed in Hilton23), provide an
attractive molecular mechanism to link these 2 events.
To address these issues we investigated the mechanism(s) of IFN-
inhibition of TPO-induced MK growth in suspension and semisolid clonal
assays, using whole marrow cells and purified populations of marrow
progenitors. Additionally, to investigate the molecular basis of the
effects of IFN- on hematopoiesis, we tested whether the cytokine
inhibits TPO-induced signaling, specifically through the induction of
SOCS proteins. Our results indicate that IFN- acts directly on MK
progenitors to inhibit their proliferation and to reduce TPO-induced
Mpl receptor signaling and that the induction of SOCS-1 is likely, at
least in part, responsible for these findings.
| |
Materials and methods |
Reagents and cell lines
Murine IFN- was purchased from Calbiochem (San Diego, CA). Dr
Donald Foster (ZymoGenetics, Seattle, WA) kindly provided purified recombinant (r), murine (m), and human (h) TPO. Dr Douglas Hilton (Walter and Eliza Hall Institute, Melbourne, Australia) provided SOCS-1
cDNA, and Dr Akihito Yoshimura (Kurume University, Kurume, Japan)
provided SOCS-3 cDNA.
BaF3 cell culture and analysis
BaF3/mMpl cells and derived cell lines were cultured in IL-3, as
previously described,24 until use. Aliquots of
1 × 104 cells were incubated in triplicate 0.1-mL
cultures in the presence of various concentrations of mTPO, with or
without increasing concentrations of mIFN-, at 37°C in a fully
humidified environment for 48 hours. Cell growth was assessed by the
capacity of cultures to reduce
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT;
Sigma, St Louis, MO) as previously
described.25
Marrow cell purification
Marrow cells were flushed from the femurs and tibias of 8- to
10-week-old B6D2F1 mice (Jackson Laboratories, Bar Harbor, ME) that had
been injected for 3 to 5 days with 2 µg rhTPO. To produce a
low-density marrow cell fraction, whole marrow cells were applied to an
Optiprep discontinuous gradient (density, 1.080 g/mL; Nycomed, Oslo,
Norway) and subjected to 400g centrifugation for 20 minutes, and interface cells were collected, washed twice, and resuspended in
phosphate-buffered saline containing 5% fetal calf serum. A lineage
depleted (Lin ) marrow fraction was obtained using a
titrated mixture of rat antimouse monoclonal antibodies (7/4; Serotec,
Raleigh, NC), B220, CD5, TER119, Mac-1 (Pharmingen, San Diego, CA), and
Dynabeads M-450 (Dynal, Great Neck, NY) coated with sheep antirat IgG
as previously described.26 Finally, a purified MK
progenitor cell population was obtained by fluorescence-activated cell
sorter (FACS) purification of Lin cells. Phycoerythrin
(PE)-conjugated anti-CD41 (an IgG1) and fluorescein isothiocyanate
(FITC)-conjugated Gr-1 (IgG2b; both from Pharmingen) were added for 15 minutes on ice, and the CD41+/Gr-1 cells were
obtained by cell sorting on FACStar. Both PE-conjugated IgG1 and
FITC-conjugated rat IgG2b were used as isotype controls. Finally, to
obtain purified mature MK, whole marrow cells were placed in culture
for 3 days in the presence of 10 ng/mL murine TPO, and the cells were
applied to a discontinuous albumin gradient, as previously
described.27 The resultant cell preparation was 90% or
more pure, as assessed by acetylcholinesterase (AChE) staining.
Megakaryocyte cultures and analysis
Whole bone marrow mononuclear cells were cultured at 5 or
10 × 104/0.1 mL and purified
CD41+/Lin MK progenitors at from 1 to
1.5 × 103/0.1 mL in triplicate. Results from all cell
concentrations were virtually identical, allowing us to pool them from
all experiments for analysis. Cultures contained Iscove modified
Dulbecco medium supplemented with 10% fetal calf serum and
varying concentrations of rmTPO, with or without murine IFN-, and
were incubated for 4 days at 37°C in a fully humidified environment.
The cultures were then assessed for MK mass by AChE activity, for DNA
ploidy by culturing sorted CD41+/Gr-1 cells
with TPO for 3 days and staining with propidium iodide, and for cell
size by microscopic evaluation as previously
described.28,29 Additional agar-containing cultures to
enumerate colony-forming unit-MK-derived colonies were performed in
parallel using previously described methods,28 except that
whole agar plates were stained with AChE before enumeration to enhance
the accuracy of counting.
Western blotting for intracellular signaling mediators
Polyclonal Mpl antiserum raised against the extracytoplasmic
domain of the human Mpl protein was provided by Don Foster
(ZymoGenetics), and an anti-STAT5b antibody was provided by James Ihle.
Anti-phosphotyrosine mouse monoclonal antibody 4G10 and JAK2 rabbit
antisera were purchased from Upstate Biotechnology (Lake Placid, NY).
STAT3 polyclonal IgG and SOCS-3 antipeptide antibody were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). Dr Akihito Yoshimura
(Osaka, Japan) kindly provided a polyvalent rabbit antiserum to SOCS-3. BaF3/mpl and MK lysates were prepared as described.25
Typically, 1 µg antibody was added to 500 µg protein extract for 2 hours at 20°C or overnight at 4°C, followed by protein A agarose
beads (Santa Cruz Biotechnology), and the immunoprecipitate was
size-fractionated by 7.5% polyacrylamide gel electrophoresis alongside
prestained molecular weight markers. Proteins were transferred to
nitrocellulose membranes and probed by standard techniques, typically
using 1 µg/mL primary antibody 4G10, horseradish
peroxidase-conjugated antimurine immunoglobulin antibody as a secondary
antibody, and chemiluminescence reagents (Amersham Pharmacia,
Buckinghamshire, UK).
Reverse transcription-polymerase chain reaction analysis for
SOCS gene expression
Whole-cell RNA was obtained from BaF3/mMpl and from
Lin/CD41+ MK grown for 3 days in mTPO using
the RNA preparation kit from Qiagen (Santa Clarita, CA). First-strand
cDNA was synthesized using oligo-dT primers and AMV reverse
transcriptase (Gibco) and was subjected to 24 to 30 cycles of
polymerase chain reaction (PCR) using murine SOCS-1-specific primers
(sense, 5' CACTCCGATTACCGGCGCATCAC 3'; antisense, 5'
GCTCCTGCAGCGGCCGCACG 3'), murine SOCS-3-specific primers (sense, 5'
AAAAGCGACTACCAGCTGGTGGT 3'; antisense, 5' TCTCGCCCCCAGAATAGATGTAG 3'),
or murine CIS-specific primers (sense, 5' CTGGAGCTGCCCGGGCCAGCC 3';
antisense, 5' TTTCAGGTGCACTGCAGTAGCCAC 3'), and the PCR reagents from
Promega (Madison, WI). The PCR products were visualized by ethidium
bromide staining of agarose gels, and their identities were verified by
DNA sequencing. Amplification of murine glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) mRNA served as a loading control. Only
experiments in which GAPDH band densities were in the linear range
were assessed.
Statistical analysis
All statistical comparisons were performed using a Student
2-tailed t test for paired values.
| |
Results |
IFN- directly inhibits thrombopoietin-induced
megakaryopoiesis
Numerous cellular assays were performed to identify the effects of
IFN- on TPO-induced MK development. Using whole marrow cell cultures
and AChE assays, we found that IFN- significantly inhibited
TPO-induced MK growth in a dose-dependent manner by up to 45% at 500 U/mL (Figure 1). Megakaryopoiesis was
significantly inhibited at essentially all doses of TPO tested if at
least 100 U/mL IFN- was present, a level readily attainable in
patient plasma with commonly used doses of the drug. We also performed marrow cell cultures in semisolid medium to determine whether the
effects of IFN- extended to MK colony-forming cells. As shown in
Table 1, 500 U/mL IFN- inhibited
colony formation by a statistically significant 34% to 36% at the 2 concentrations of TPO assessed.
View larger version (14K):
[in this window]
[in a new window]
| Figure 1.
Effects of IFN- on AChE activity in whole marrow cell
cultures.
Whole marrow cells were obtained from mice previously injected for 3 days with TPO. Five to 10 × 105 cells/mL were placed in
suspension culture for 4 days with the indicated concentrations of mTPO
and IFN-. Results represent the mean AChE values of triplicate
cultures of 5 independent experiments. *P < .05 in
comparison with cultures devoid of IFN-.
|
|
Because both semisolid and suspension cultures of whole marrow cells
contained numerous accessory cells that could have mediated the IFN-
effect, we subsequently used purified MK progenitor cell populations in
TPO and IFN- dose-response assays. As did results using whole marrow
cultures, IFN- exerted a dose-dependent inhibition of TPO-induced
AChE activity in cultures of low-density, lineage-depleted
CD41+ cells (Figure 2).
Megakaryocyte number, size, and level of polyploidy were also affected
by IFN- (Table 2). These results
indicated that the cytokine directly affected the MK and its
progenitors and did not depend on the presence of accessory cells in
the culture.
View larger version (13K):
[in this window]
[in a new window]
| Figure 2.
Effects of IFN- on AChE activity in cultures of
CD41+/Lin marrow cells.
Purified MK progenitor cells were obtained as described in "Materials
and methods," and 1 to 1.5 × 104/mL was placed in
suspension culture with the indicated concentrations of mTPO and
IFN-. Results represent the mean AChE values of triplicate cultures
of 4 independent experiments, except for the 1000 pg/mL mTPO data, for
which only a single experiment was performed (hence, the absence of
statistical significance). *P < .05 in comparison with
cultures devoid of IFN-.
|
|
IFN- blunts thrombopoietin-induced
signaling
Numerous studies have indicated that the addition of TPO to Mpl
receptor-bearing cells leads to the rapid phosphorylation and
activation of JAK2, TYK2, STAT3, STAT5, the mitogen-activated protein
kinases (MAPKs) ERK1 and ERK2, and several other signaling intermediates.30-34 Our results with purified MK
progenitors suggested that TPO-induced signaling might be altered by
the presence of IFN-. To develop a model system to study the
interaction between TPO and IFN- signaling, we tested whether the
latter cytokine affected TPO-induced cell growth in BaF3/mMpl cells.
Because BaF3 is a prolymphocytic cell line, we anticipated the
expression of IFN receptors. We found that 10 to 500 U/mL IFN-
blunted TPO-induced BaF3/mMpl cell proliferation to a degree similar to
that found for MK progenitor cells (Figure
3). To test whether IFN- affected TPO
signaling, we pretreated BaF3/mMpl cells and mature MK with IFN- for
4 hours before stimulation with TPO and assessed the phosphorylation of
c-Mpl, JAK2, STAT3, and STAT5. In BaF3/mMpl cells, IFN- inhibited
the phosphorylation of TPO-induced Mpl, JAK2, and STAT5
phosphorylation, commensurate with the level of inhibition seen in the
AChE assays (Figure 4). When the
intensity of the bands shown in Figure 4 was measured by densitometry
and adjusted for the amount of each immunoprecipitated protein detected by Western blot analysis, phosphorylation of JAK2, Mpl, and STAT5 was
reduced in the presence of TPO plus IFN- to 45%, 40%, and 25%,
respectively, that seen in cells cultured in TPO alone. Curiously, STAT3 phosphorylation did not change in 3 separate experiments (data
not shown). In primary murine MK cultured in TPO plus IFN-, Mpl,
JAK2, and STAT3, phosphorylation was reduced to 40%, 75%, and 67%,
respectively, compared to cultures containing TPO alone (Figure 4B).
Because we failed to identify significant phosphorylation of mature MK
STAT5 in response to TPO in a previous study,27 the
phosphorylation of STAT5 was not investigated in the current experiments.
View larger version (13K):
[in this window]
[in a new window]
| Figure 3.
Effects of IFN- on the proliferation of BaF3/mMpl
cells.
BaF3/mMpl cells were washed free of IL-3 and placed in culture in the
indicated concentrations of mTPO and IFN-. After 2 days, MTT assays
were performed; the mean value of 7 experiments is shown.
*P < .05 in comparison with cultures devoid of
IFN-.
|
|
View larger version (29K):
[in this window]
[in a new window]
| Figure 4.
IFN- blunts Mpl, JAK2, and STAT-5 phosphorylation in
BaF3/mMpl cells and primary murine megakaryocytes.
(A) BaF3/mMpl cells were grown in IL-3 and were washed and starved for
16 hours. Four hours before the addition of 10 ng/mL mTPO, 500 U/mL
IFN- or sham was added to the culture; 10 minutes after TPO was
added, the cells were lysed and immunoprecipitated with antibodies to
mMpl, JAK2, or STAT5. Immunoprecipitates were size fractionated by
denaturing PAGE, and the proteins were transferred and blotted for
phosphotyrosine. After probing, the blots were stripped and reprobed
for c-Mpl, JAK2, and STAT5. Similar results were obtained from 3 additional experiments. (B) A similar protocol to that in A was
followed, except that MK was obtained by elution from an albumin
gradient and the cells were starved for 4 hours before the addition of
TPO after a 4-hour pretreatment with IFN- or control. This
experiment was repeated twice with similar results. Densitometry of
bands in the JAK2 lanes reveal a 20% reduction in JAK2 phosphorylation
in MK pretreated with IFN- and TPO compared with TPO
alone.
|
|
IFN-, but not thrombopoietin, induces
SOCS-1 expression
In addition to turning on a growth factor or a cytokine-induced
signal, cells must retain the capacity to turn that signal off. Several
pathways that extinguish cytokine signaling have been identified. For
example, tyrosine phosphatases such as SHP-1 have been shown to reduce
the level of erythropoietin (EPO) signaling,35 and nuclear
phosphatases that act on STAT proteins have been
identified.36 Moreover, ligand-induced receptor
internalization can down-regulate the effects of cytokines on
hematopoietic cells. Recently, another mechanism of cytokine signal
suppression has been identified, mediated by members of the SOCS family
of proteins, which act to inhibit JAK-induced signaling
events.37 Thus, we tested whether IFN- or TPO induced
SOCS gene expression in BaF3/mMpl cells or purified MK. Using a
specific reverse transcription (RT)-PCR assay, we found that TPO was a
poor stimulus of mRNA specific for SOCS-1 in RT-PCR assays of BaF3/mMpl
cells or purified MK (Figure 5; data not
shown). In contrast, IFN- was a potent stimulus in both cell types.
Induction of SOCS-1 mRNA was maximal at 1 hour and began to wane by 4 hours after stimulation with IFN-. In contrast, the other SOCS
protein known to inhibit hematopoietic cytokine receptor and STAT
activation, SOCS-3, was markedly induced by TPO but only poorly induced
by IFN- in BaF3/mMpl cells (Figure 6).
The addition of IFN- to TPO failed to augment the SOCS-3 response to
TPO, either at low or high concentrations of the latter. We also used
RT-PCR to evaluate CIS induction but found little difference in levels
of CIS mRNA in the presence or absence of IFN-, TPO, or both (data
not shown).
View larger version (22K):
[in this window]
[in a new window]
| Figure 5.
RT-PCR analysis of BaF3/mMpl and MK RNA after
stimulation with TPO or IFN-.
BaF3/mMpl (A) or purified MK (B) were starved for 14 or 7 hours,
respectively, and either untreated or stimulated with 10 ng/mL mTPO for
10 minutes, 500 U/mL IFN- for 4 hours, or both. After RNA harvest,
RT-PCR was conducted with SOCS-1-specific oligo-deoxynucleotide
primers for 30 (A) or 24 (B) cycles, and the products were analyzed by
ethidium bromide staining of agarose gels. Amplification of both c-Mpl
and GAPDH served as controls. Similar experiments were performed twice
with BaF3/mMpl cells and 3 times with MK.
|
|
View larger version (12K):
[in this window]
[in a new window]
| Figure 6.
Thrombopoietin, but not IFN-, induces SOCS-3 protein
expression.
Cell lysates from BaF3/mMpl were prepared from unstimulated cells or
those grown for 4 hours with 10 ng/mL TPO, 500 U/mL IFN-, or both.
Thirty minutes before lysate preparation, a proteosome inhibitor,
MG132, was added to the cells. A polyvalent antiserum raised against
the carboxyl terminus of SOCS-3 was used to immunoprecipitate specific
protein, which was then size fractionated by SDS-PAGE,
transferred to nitrocellulose, and probed for SOCS-3 with a monoclonal
antibody to the protein. This experiment was repeated 3 times with
identical results. Relative molecular weight markers are shown on the
left in kilodaltons.
|
|
| |
Discussion |
The most important findings of this report are that IFN-
acts directly on megakaryocytic progenitor cells to inhibit their TPO-induced development, IFN- blunts the JAK/STAT signaling response induced by TPO, and IFN- induction of SOCS-1 appears responsible for
impaired TPO signaling. These conclusions derive from cell growth and
signaling studies carried out in an IFN- and TPO-responsive cell
line and, most important, in primary murine megakaryocytes, lending
physiologic relevance to the conclusions. The findings also offer a
mechanism to help explain the common finding of cytokine receptor
cross-talk.
In the current study we found that IFN- inhibits the growth of
murine MK in the presence of purified rmTPO. Essentially identical results were obtained using either whole marrow cells or highly purified MK progenitors. Although previous studies using whole marrow
cells and plasma as a source of MK stimulating activity have recognized
the inhibitory effect of IFN- on megakaryopoiesis, the experiments
reported here establish that the cytokine adversely affects MK
directly, even in the presence of large doses of purified rmTPO. Hence,
these observations extend our understanding of the thrombocytopenia
that can occur in patients treated with IFN- for chronic viral
hepatitis or neoplastic disorders, and they suggest that treatment of
such patients with recombinant TPO may not alleviate the adverse
effects of IFN-.10
Since the purification of IFNs and the cloning of their receptors in
the mid-1980s, numerous investigators have examined the basis by which
these cytokines exert their physiologic effects. Several studies
suggest a direct inhibitory effect of IFN on growth factor-induced
proliferation pathways. For example, IFN- has been shown to augment
double-stranded RNA-activated protein kinase activity, an enzyme that
inhibits translation initiation factor-2, implicating a reduction of
the growth factor-induced protein synthesis necessary for cytokine
response.38 We have not investigated this possibility in
primary cells, but we believe it could contribute to the inhibitory
effect of IFN- on TPO-induced MK growth because cell size was
reduced slightly in our studies with purified progenitor cells. Other
studies have suggested that IFN induces expression of the cell cycle
inhibitor p27kip1, an event that arrests cells
in G0/G1.39 We have not
investigated cell cycle inhibitors in the current study, but it is
known that several lymphokines reduce p27kip1 expression in
lymphocytes,40 making it possible that the blockade of TPO
signaling by IFN- might also be associated with increased MK
p27kip1.
The effects of IFN- on megakaryopoiesis have been more
controversial, with reports suggesting both suppression and stimulation of MK progenitor cell growth.17,41-43 Substantial insights
into the antiproliferative hematopoietic response to IFN have come from
investigations of the effects of IFN- on erythropoiesis, studies
showing that the cytokine promotes programmed cell death in cultures of
purified erythroid progenitor cells.44 However, in
contrast to this effect of IFN-, we failed to find evidence for
enhanced apoptosis in purified MK progenitor cells treated with 500 U/mL IFN- (data not shown). Given the profound differences in the
biologic activities of IFN- and IFN- and in how these 2 cytokines
signal, it is perhaps not surprising that the results of our studies of
IFN- and those of IFN- differ.
Thrombopoietin is the primary regulator of MK and platelet
production.22 The hormone acts by binding to its
high-affinity cell surface receptor, c-Mpl, first recognized in altered
form as the transforming oncogene of the murine myeloproliferative leukemia virus.45 The TPO receptor is a member of the type
1 family of hematopoietic cytokine receptors.46 Much is
known of the mechanisms by which hematopoietic growth factors affect the survival, proliferation, and differentiation of cells that give
rise to all the blood lineages.47 Signal transduction in this system is initiated by ligand-induced receptor oligomerization or
conformational changes, events that induce JAK cross-phosphorylation and activation, resulting in tyrosine phosphorylation of a number of
critical intracellular substrates. Included among the downstream mediators of hematopoietic growth factor receptor activation are JAK,
STAT, MAPK, and Phosphoinositol 3 kinase (PI3K), signaling molecules
that directly impact cellular development by modifying gene expression
or the activity of molecules vital to cell proliferation and survival.
Other investigators and we27,30-34 have determined that
each of these signal transduction pathways is activated in TPO-stimulated Mpl-bearing cell lines and primary marrow-derived cells.
In contrast, IFN acts through members of the type II cytokine receptor
family, which recruits a plethora of cytoplasmic mediators to initiate
signaling cascades.48-51 Of note, many of the secondary signaling pathways common to the interleukins, hematopoietic growth factors, and protein hormones, including JAK, STAT, MAPK, and PI3K,
have been described as mediators of IFN- activity. In fact, the STAT
proteins were first recognized as ligand-induced transcription factors
in IFN-treated cells.52 These findings immediately
suggested that IFN- affects TPO-induced signaling. Thus, our results
that IFN- reduced TPO-induced phosphorylation (activation) of the Mpl receptor, JAK2, STAT3, and STAT5 (Figure 4), the timing and degree
of which were commensurate with the IFN--induced blockade of
TPO-induced cell growth, lend support to the hypothesis.
Recently, Jaster et al38 reported that IFN- reduced
IL-3-induced growth of Ba/F3 cells, a prolymphocytic cell line also used in the current studies. In contrast to our results, these investigators concluded that IFN- had no effect on the IL-3-induced activation of STAT5. Although it is possible that the opposing conclusions can be attributed to true differences between IL-3 and TPO,
this is not likely. Alternatively, we believe the difference lies in
the assays used to detect receptor activation. We studied Mpl, JAK2,
and STAT phosphorylation using Western blot analysis. Jaster et
al38 studied the capacity of Ba/F3 protein extracts to
shift a STAT5 DNA binding probe in electrophoretic mobility shift
assays, without providing a quantitative assessment of STAT5 activation. Thus, though their suggestion that reduced protein translation is responsible for the IFN- effect on IL-3-induced cell
growth may also be correct, their experimental approach cannot exclude
the molecular mechanism we propose reduced growth factor-induced signaling events.
In addition to responding to extracellular signals for growth and
metabolic activation, cells must have mechanisms to extinguish growth
factor-induced processes. Previous studies53,54 have identified a number of such mechanisms, including the down-modulation of receptor expression and the activation of phosphatases that quench
growth factor receptor-mediated signals. The importance of these
counter-regulatory pathways is illustrated by the pathologic expansion
of hematopoiesis that can occur when either process fails.55 More recently, another mechanism of growth factor
signal termination has been identified, mediated by the SOCS proteins. The cloning of a STAT-inducible gene, CIS,56 and several
additional genes that bear substantial sequence
homology37,57 has yielded a family of proteins that can
directly suppress growth factor receptor-induced signals. Because IFNs
are potent inducers of STAT1 activation, they also lead to the
production of several SOCS proteins. In turn, SOCS proteins act to
eliminate the signal that initially led to their production. On the
basis of these findings, we tested whether SOCS proteins might be
candidates to mediate IFN--induced blunting of TPO signaling.
Because only 3 of the 8 CIS and SOCS proteins thus far identified have
been shown to play important roles in cytokine signaling (CIS, SOCS-1, and SOCS-3),23 we concentrated our efforts on these genes.
Hence, we tested whether CIS, SOCS-1, or SOCS-3 was inducible in
BaF3/mMpl or murine MK treated with IFN-. We found that CIS was not
inducible at the RNA level in either cell system (data not shown) and
that SOCS-3 was not induced in BaF3 cells by IFN- at the protein
level, though TPO was a potent stimulus (Figure 6). It was also
possible that IFN- might augment TPO-induced SOCS-3 expression to
help explain its inhibition of TPO signaling. We failed to obtain
evidence to support this hypothesis; the addition of IFN- to TPO
failed to increase the SOCS-3 expression induced by the latter, either
at high-dose (Figure 6) or low-dose (data not shown) TPO. In contrast,
our results pointed to a role for SOCS-1 in the inhibition of TPO
signaling. In BaF3/mMpl cells, we found that TPO could induce only
low-level expression of SOCS-1 mRNA, a level that was consistently
lower than the levels found after stimulation with IFN-. In murine
MK, IFN-, but not TPO, induced the expression of SOCS-1 mRNA.
Unfortunately, we could not confirm these conclusions at the protein
level because the several antibodies to SOCS-1 we tested failed in the
Western blotting experiments. Nevertheless, the induction of SOCS-1 by
IFN- could explain the ability of the cytokine to interfere
with TPO-induced MK development.
Several lines of evidence support the hypothesis that SOCS-1 is
responsible for IFN--induced diminution of the TPO response. First,
the timing of IFN- effects on TPO-induced cell signaling is
consistent with an SOCS protein-mediated process. Pretreatment with
IFN- for 4 hours was required to exert an effect on TPO-induced JAK,
Mpl, and STAT phosphorylation, consistent with the need for IFN--induced STAT activation, SOCS mRNA transcription, and protein synthesis. Second, IFN- , which acts through the same receptor as
IFN-, was reported to abrogate IL-6-induced growth of a myeloma cell line by interfering with the formation of essential signaling complexes leading to the activation of p21 Ras,58 findings
consistent with the interruption of IL-6-induced JAK-mediated signals.
Moreover, the approximately 50% degree of IFN--mediated inhibition
of IL-6-induced Ras activation in that study is remarkably similar to
the level of IFN--induced inhibition of TPO-induced proliferation
we found in the experiments presented here. Third, SOCS-1 has been
shown to block signaling from IL-3 and TPO.23,59 Fourth,
SOCS-1, but not SOCS-3, confers resistance to IFN- signaling in
myeloid leukemia cells.60 Fifth, the pattern of inhibition
of signaling molecules exerted by IFN- in our studiesreduction of
JAK2, Mpl, and STAT3/5 phosphorylationis most consistent with SOCS-1
action for several reasons. In contrast to CIS, which acts to inhibit growth factor signaling by competing for JAK substrate binding to
tyrosine-phosphorylated cytokine receptor scaffolds (and, hence, reducing phosphorylation of STAT but not JAK or the receptors), SOCS-1
and SOCS-3 bind to the activation loop of JAK, inhibiting JAK
activation and all downstream signaling events.61,62 Our finding that JAK2, Mpl, and STAT phosphorylation were blunted by
IFN- is most consistent with the action of an SOCS protein that
binds to and directly inhibits JAK. The differential capacity of
IFN- to induce SOCS-1, but not SOCS-3, expression in the experiments reported herein also argues for a role for SOCS-1 in IFN--induced suppression of TPO-induced MK development. Sixth, mice nullizygous for
SOCS-1, in which much of the pathologic condition is caused by the
enhanced biologic activity of IFN,63 are
thrombocytopenic.64 Because the administration of IFN-
does not suppress thrombopoiesis in vivo,65,66 and though
some other MK-suppressive cytokine may be overactive in
SOCS-1/ mice, these observations are again
supportive of a role for SOCS-1 in IFN--mediated blunting of
TPO-induced MK development.
We found that SOCS-3 is induced by TPO in primary murine MKs. To our
knowledge, this is the first report of the responsiveness of this
signaling inhibitor to TPO. Numerous cytokines have been shown to
induce SOCS-3 production, including growth hormone, prolactin, leptin, IL-2, IL-10, and EPO. In fact, the most obvious
physiologic effect in mice genetically engineered to eliminate SOCS-3
expression is fetal erythrocytosis, likely caused by unregulated EPO
signaling.67 Thus, given the similarity of signaling
pathways used by EPO and TPO, our finding that TPO also induces SOCS-3
was not unexpected.
Finally, the results reported here may have broader implications. As
noted, most of the signaling pathways used by TPO are shared with a
large number of interleukins, hematopoietic growth factors, and other
cytokines, mediators exerting stimulatory and inhibitory effects on
cell development. Several of these molecules have also been
demonstrated to induce SOCS protein production, and SOCS proteins block
signaling from many stimulatory cytokines.23 Of interest,
it was recently reported that IL-10 down-modulates IFN- and IFN-
signaling in monocytes and acts to induce the expression of SOCS-3,
suggesting a causal link between the 2 observations.68 By
demonstrating that IFN- is associated with the induction of SOCS-1
and can blunt TPO-induced proliferation, we extend those studies and
provide additional support for an SOCS-based cross-talk hypothesis. It
thus appears that SOCS proteins can not only extinguish the signals
generated by the inducing cytokine but also attenuate cellular
responses to other cytokines simultaneously present. These results
provide a molecular mechanism to help explain a common finding in
cytokine-responsive cells: receptor cross-talk.
| |
Acknowledgments |
We thank Dr Don Foster at ZymoGenetics for the kind gift of
recombinant murine and human TPO and anti-Mpl antiserum, Dr James Ihle
for the anti-STAT5b antibody, Dr Douglas Hilton for the murine SOCS-1
cDNA and antiserum to the protein, and Dr Akihito Yoshimura for the
SOCS-3 cDNA and the antiserum to SOCS-1 and SOCS-3 proteins.
| |
Footnotes |
Submitted February 25, 2000; accepted May 12, 2000.
Supported by National Institutes of Health grants R01 CA31615 and R01
DK 49855 (K.K.).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Kenneth Kaushansky, Division of Hematology,
University of Washington School of Medicine, Box 357710, 1959 NE
Pacific St, Seattle, WA 98195; e-mail:
kkaushan{at}u.washington.edu.
| |
References |
1.
Zein NN.
Interferons in the management of viral hepatitis.
Cytokines Cell Mol Ther.
1998;4:229-241[Medline]
[Order article via Infotrieve].
2.
Ahmed A, Keeffe EB.
Treatment strategies for chronic hepatitis C: update since the 1997 National Institutes of Health Consensus Development Conference.
J Gastroenterol Hepatol.
1999;14(suppl):S12-S18.
3.
Lau DT, Miller KD, Detmer J, et al.
Hepatitis G virus and human immunodeficiency virus coinfection: response to interferon-alpha therapy.
J Infect Dis.
1999;180:1334-1337[Medline]
[Order article via Infotrieve].
4.
Silver RT, Woolf SH, Hehlmann R, et al.
An evidence-based analysis of the effect of busulfan, hydroxyurea, interferon, and allogeneic bone marrow transplantation in treating the chronic phase of chronic myeloid leukemia: developed for the American Society of Hematology.
Blood.
1999;94:1517-1536[Abstract/Free Full Text].
5.
Tefferi A, Elliott MA, Solberg LA Jr, Silverstein MN.
New drugs in essential thrombocythemia and polycythemia vera.
Blood Rev.
1997;11:1-7[Medline]
[Order article via Infotrieve].
6.
Aviles A, Diaz-Maqueo JC, Talavera A, Nambo MJ, Garcia EL.
Maintenance therapy with interferon alfa 2b in Hodgkin's disease.
Leuk Lymphoma.
1998;30:651-656[Medline]
[Order article via Infotrieve].
7.
Ozer H, Wiernik PH, Giles F, Tendler C.
Recombinant interferon-alpha therapy in patients with follicular lymphoma.
Cancer.
1998;82:1821-1830[Medline]
[Order article via Infotrieve].
8.
Fattovich G, Giustina G, Favarato S, Ruol A.
A survey of adverse events in 11,241 patients with chronic viral hepatitis treated with alfa interferon.
J Hepatol.
1996;24:38-47[Medline]
[Order article via Infotrieve].
9.
Dusheiko G.
Side effects of alpha interferon in chronic hepatitis C.
Hepatology.
1997;26(suppl 1):112S-121S[Medline]
[Order article via Infotrieve].
10.
Martin TG, Shuman MA.
Interferon-induced thrombocytopenia: is it time for thrombopoietin?
Hepatology.
1998;24:1430-1432.
11.
Toccaceli F, Rosati S, Scuderi M, Iacomi F, Picconi R, Laghi V.
Leukocyte and platelet lowering by some interferon types during viral hepatitis treatment.
Hepatogastroenterology.
1998;45:1748-1752[Medline]
[Order article via Infotrieve].
12.
Peck-Radosavljevic M, Wichlas M, Pidlich J, et al.
Blunted thrombopoietin response to interferon alfa-induced thrombocytopenia during treatment for hepatitis C.
Hepatology.
1998;28:1424-1429[Medline]
[Order article via Infotrieve].
13.
Lopez-Morante AJ, Saez-Royuela F, Casanova-Valero F, et al.
Immune thrombocytopenia after alpha-interferon therapy in a patient with chronic hepatitis C.
Am J Gastroenterol.
1992;87:809-810[Medline]
[Order article via Infotrieve].
14.
Shrestha R, McKinley C, Bilar BM, Everson GT.
Possible idiopathic thrombocytopenic purpura associated with natural alpha interferon therapy for chronic hepatitis C infection.
Am J Gastroenterol.
1995;90:1146-1147[Medline]
[Order article via Infotrieve].
15.
Mazur EM, Richtsmeier WJ, South K.
Alpha-interferon: differential suppression of colony growth from human erythroid, myeloid, and megakaryocytic hematopoietic progenitor cells.
J Interferon Res.
1986;6:199-206[Medline]
[Order article via Infotrieve].
16.
Han ZC, Briere J, Abgrall JF, Le Gall G, Parent D, Sencebe L.
Effects of recombinant human interferon alpha on human megakaryocyte and fibroblast colony formation.
J Biol Regul Homeost Agents.
1987;1:195-200[Medline]
[Order article via Infotrieve].
17.
Ganser A, Carlo-Stella C, Greher J, Volkers B, Hoelzer-D.
Effect of recombinant interferons alpha and gamma on human bone marrow-derived megakaryocytic progenitor cells.
Blood.
1987;70:1173-1179[Abstract/Free Full Text].
18.
Gugliotta L, Bagnara GP, Catani L, et al.
In vivo and in vitro inhibitory effect of alpha-interferon on megakaryocyte colony growth in essential thrombocythaemia.
Br J Haematol.
1989;71:177-181[Medline]
[Order article via Infotrieve].
19.
Wang JC, Lang HD, Liao P, Wong A.
Recombinant alpha-interferon inhibits colony formation of bone marrow fibroblast progenitor cells (CFU-F).
Am J Hematol.
1992;40:81-85[Medline]
[Order article via Infotrieve].
20.
Bhatia R, Verfaillie CM.
The effect of interferon alpha on beta 1 integrin mediated adhesion and growth regulation in chronic myelogenous leukemia.
Leuk Lymphoma.
1998;28:241-254[Medline]
[Order article via Infotrieve].
21.
Means RT, Krantz SB.
Inhibition of human erythroid colony-forming units by interferons and |
Top
Abstract
Introduction