| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Division of Hematology, University of
Washington School of Medicine, Seattle, WA.
Interferon (IFN)- Interferon (IFN)- Although some previous studies suggest that immune mechanisms mediate
the thrombocytopenic effects of IFN- Recently, work from other laboratories and from our own has led to the
cloning and characterization of thrombopoietin (TPO), the primary
regulator of MK and platelet production.22 Like other
members of the type 1 family of hematopoietic cytokine receptors, the
TPO receptor (c-Mpl) induces its biologic effects on ligand-induced multimerization by the activation of Janus kinase (JAK). Although a
member of the type 2 family of cell surface receptors, the IFN receptors also transduce cellular effects by the induction of JAK,
which, in turn, triggers many of the same signaling pathways initiated
by TPO and other hematopoietic cytokines. These findings suggest that
some form of cross-talk between TPO and IFN receptors might mediate the
effects of IFN- To address these issues we investigated the mechanism(s) of IFN- Reagents and cell lines
BaF3 cell culture and analysis
Marrow cell purification Marrow cells were flushed from the femurs and tibias of 8- to 10-week-old B6D2F1 mice (Jackson Laboratories, Bar Harbor, ME) that had been injected for 3 to 5 days with 2 µg rhTPO. To produce a low-density marrow cell fraction, whole marrow cells were applied to an Optiprep discontinuous gradient (density, 1.080 g/mL; Nycomed, Oslo, Norway) and subjected to 400g centrifugation for 20 minutes, and interface cells were collected, washed twice, and resuspended in phosphate-buffered saline containing 5% fetal calf serum. A lineage depleted (Lin ) marrow fraction was obtained using a
titrated mixture of rat antimouse monoclonal antibodies (7/4; Serotec,
Raleigh, NC), B220, CD5, TER119, Mac-1 (Pharmingen, San Diego, CA), and
Dynabeads M-450 (Dynal, Great Neck, NY) coated with sheep antirat IgG
as previously described.26 Finally, a purified MK
progenitor cell population was obtained by fluorescence-activated cell
sorter (FACS) purification of Lin cells. Phycoerythrin
(PE)-conjugated anti-CD41 (an IgG1) and fluorescein isothiocyanate
(FITC)-conjugated Gr-1 (IgG2b; both from Pharmingen) were added for 15 minutes on ice, and the CD41+/Gr-1 cells were
obtained by cell sorting on FACStar. Both PE-conjugated IgG1 and
FITC-conjugated rat IgG2b were used as isotype controls. Finally, to
obtain purified mature MK, whole marrow cells were placed in culture
for 3 days in the presence of 10 ng/mL murine TPO, and the cells were
applied to a discontinuous albumin gradient, as previously
described.27 The resultant cell preparation was 90% or
more pure, as assessed by acetylcholinesterase (AChE) staining.
Megakaryocyte cultures and analysis Whole bone marrow mononuclear cells were cultured at 5 or 10 × 104/0.1 mL and purified CD41+/Lin MK progenitors at from 1 to
1.5 × 103/0.1 mL in triplicate. Results from all cell
concentrations were virtually identical, allowing us to pool them from
all experiments for analysis. Cultures contained Iscove modified
Dulbecco medium supplemented with 10% fetal calf serum and
varying concentrations of rmTPO, with or without murine IFN- , and
were incubated for 4 days at 37°C in a fully humidified environment.
The cultures were then assessed for MK mass by AChE activity, for DNA
ploidy by culturing sorted CD41+/Gr-1 cells
with TPO for 3 days and staining with propidium iodide, and for cell
size by microscopic evaluation as previously
described.28,29 Additional agar-containing cultures to
enumerate colony-forming unit-MK-derived colonies were performed in
parallel using previously described methods,28 except that
whole agar plates were stained with AChE before enumeration to enhance
the accuracy of counting.
Western blotting for intracellular signaling mediators Polyclonal Mpl antiserum raised against the extracytoplasmic domain of the human Mpl protein was provided by Don Foster (ZymoGenetics), and an anti-STAT5b antibody was provided by James Ihle. Anti-phosphotyrosine mouse monoclonal antibody 4G10 and JAK2 rabbit antisera were purchased from Upstate Biotechnology (Lake Placid, NY). STAT3 polyclonal IgG and SOCS-3 antipeptide antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Dr Akihito Yoshimura (Osaka, Japan) kindly provided a polyvalent rabbit antiserum to SOCS-3. BaF3/mpl and MK lysates were prepared as described.25 Typically, 1 µg antibody was added to 500 µg protein extract for 2 hours at 20°C or overnight at 4°C, followed by protein A agarose beads (Santa Cruz Biotechnology), and the immunoprecipitate was size-fractionated by 7.5% polyacrylamide gel electrophoresis alongside prestained molecular weight markers. Proteins were transferred to nitrocellulose membranes and probed by standard techniques, typically using 1 µg/mL primary antibody 4G10, horseradish peroxidase-conjugated antimurine immunoglobulin antibody as a secondary antibody, and chemiluminescence reagents (Amersham Pharmacia, Buckinghamshire, UK).Reverse transcription-polymerase chain reaction analysis for SOCS gene expression Whole-cell RNA was obtained from BaF3/mMpl and from Lin /CD41+ MK grown for 3 days in mTPO using
the RNA preparation kit from Qiagen (Santa Clarita, CA). First-strand
cDNA was synthesized using oligo-dT primers and AMV reverse
transcriptase (Gibco) and was subjected to 24 to 30 cycles of
polymerase chain reaction (PCR) using murine SOCS-1-specific primers
(sense, 5' CACTCCGATTACCGGCGCATCAC 3'; antisense, 5'
GCTCCTGCAGCGGCCGCACG 3'), murine SOCS-3-specific primers (sense, 5'
AAAAGCGACTACCAGCTGGTGGT 3'; antisense, 5' TCTCGCCCCCAGAATAGATGTAG 3'),
or murine CIS-specific primers (sense, 5' CTGGAGCTGCCCGGGCCAGCC 3';
antisense, 5' TTTCAGGTGCACTGCAGTAGCCAC 3'), and the PCR reagents from
Promega (Madison, WI). The PCR products were visualized by ethidium
bromide staining of agarose gels, and their identities were verified by
DNA sequencing. Amplification of murine glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) mRNA served as a loading control. Only
experiments in which GAPDH band densities were in the linear range
were assessed.
Statistical analysis All statistical comparisons were performed using a Student 2-tailed t test for paired values.
IFN- on TPO-induced MK development. Using whole marrow cell cultures
and AChE assays, we found that IFN- significantly inhibited
TPO-induced MK growth in a dose-dependent manner by up to 45% at 500 U/mL (Figure 1). Megakaryopoiesis was
significantly inhibited at essentially all doses of TPO tested if at
least 100 U/mL IFN- was present, a level readily attainable in
patient plasma with commonly used doses of the drug. We also performed marrow cell cultures in semisolid medium to determine whether the
effects of IFN- extended to MK colony-forming cells. As shown in
Table 1, 500 U/mL IFN- inhibited
colony formation by a statistically significant 34% to 36% at the 2 concentrations of TPO assessed.
Because both semisolid and suspension cultures of whole marrow cells
contained numerous accessory cells that could have mediated the IFN-
IFN- . To develop a model system to study the
interaction between TPO and IFN- signaling, we tested whether the
latter cytokine affected TPO-induced cell growth in BaF3/mMpl cells.
Because BaF3 is a prolymphocytic cell line, we anticipated the
expression of IFN receptors. We found that 10 to 500 U/mL IFN-
blunted TPO-induced BaF3/mMpl cell proliferation to a degree similar to
that found for MK progenitor cells (Figure
3). To test whether IFN- affected TPO
signaling, we pretreated BaF3/mMpl cells and mature MK with IFN- for
4 hours before stimulation with TPO and assessed the phosphorylation of
c-Mpl, JAK2, STAT3, and STAT5. In BaF3/mMpl cells, IFN- inhibited
the phosphorylation of TPO-induced Mpl, JAK2, and STAT5
phosphorylation, commensurate with the level of inhibition seen in the
AChE assays (Figure 4). When the
intensity of the bands shown in Figure 4 was measured by densitometry
and adjusted for the amount of each immunoprecipitated protein detected by Western blot analysis, phosphorylation of JAK2, Mpl, and STAT5 was
reduced in the presence of TPO plus IFN- to 45%, 40%, and 25%,
respectively, that seen in cells cultured in TPO alone. Curiously, STAT3 phosphorylation did not change in 3 separate experiments (data
not shown). In primary murine MK cultured in TPO plus IFN- , Mpl,
JAK2, and STAT3, phosphorylation was reduced to 40%, 75%, and 67%,
respectively, compared to cultures containing TPO alone (Figure 4B).
Because we failed to identify significant phosphorylation of mature MK
STAT5 in response to TPO in a previous study,27 the
phosphorylation of STAT5 was not investigated in the current experiments.
IFN- or TPO induced
SOCS gene expression in BaF3/mMpl cells or purified MK. Using a
specific reverse transcription (RT)-PCR assay, we found that TPO was a
poor stimulus of mRNA specific for SOCS-1 in RT-PCR assays of BaF3/mMpl
cells or purified MK (Figure 5; data not
shown). In contrast, IFN- was a potent stimulus in both cell types.
Induction of SOCS-1 mRNA was maximal at 1 hour and began to wane by 4 hours after stimulation with IFN- . In contrast, the other SOCS
protein known to inhibit hematopoietic cytokine receptor and STAT
activation, SOCS-3, was markedly induced by TPO but only poorly induced
by IFN- in BaF3/mMpl cells (Figure 6).
The addition of IFN- to TPO failed to augment the SOCS-3 response to
TPO, either at low or high concentrations of the latter. We also used
RT-PCR to evaluate CIS induction but found little difference in levels
of CIS mRNA in the presence or absence of IFN- , TPO, or both (data
not shown).
The most important findings of this report are that IFN- In the current study we found that IFN- Since the purification of IFNs and the cloning of their receptors in
the mid-1980s, numerous investigators have examined the basis by which
these cytokines exert their physiologic effects. Several studies
suggest a direct inhibitory effect of IFN on growth factor-induced
proliferation pathways. For example, IFN- The effects of IFN- Thrombopoietin is the primary regulator of MK and platelet
production.22 The hormone acts by binding to its
high-affinity cell surface receptor, c-Mpl, first recognized in altered
form as the transforming oncogene of the murine myeloproliferative leukemia virus.45 The TPO receptor is a member of the type
1 family of hematopoietic cytokine receptors.46 Much is
known of the mechanisms by which hematopoietic growth factors affect the survival, proliferation, and differentiation of cells that give
rise to all the blood lineages.47 Signal transduction in this system is initiated by ligand-induced receptor oligomerization or
conformational changes, events that induce JAK cross-phosphorylation and activation, resulting in tyrosine phosphorylation of a number of
critical intracellular substrates. Included among the downstream mediators of hematopoietic growth factor receptor activation are JAK,
STAT, MAPK, and Phosphoinositol 3 kinase (PI3K), signaling molecules
that directly impact cellular development by modifying gene expression
or the activity of molecules vital to cell proliferation and survival.
Other investigators and we27,30-34 have determined that
each of these signal transduction pathways is activated in TPO-stimulated Mpl-bearing cell lines and primary marrow-derived cells.
In contrast, IFN acts through members of the type II cytokine receptor
family, which recruits a plethora of cytoplasmic mediators to initiate
signaling cascades.48-51 Of note, many of the secondary signaling pathways common to the interleukins, hematopoietic growth factors, and protein hormones, including JAK, STAT, MAPK, and PI3K,
have been described as mediators of IFN- Recently, Jaster et al38 reported that IFN- In addition to responding to extracellular signals for growth and
metabolic activation, cells must have mechanisms to extinguish growth
factor-induced processes. Previous studies53,54 have identified a number of such mechanisms, including the down-modulation of receptor expression and the activation of phosphatases that quench
growth factor receptor-mediated signals. The importance of these
counter-regulatory pathways is illustrated by the pathologic expansion
of hematopoiesis that can occur when either process fails.55 More recently, another mechanism of growth factor
signal termination has been identified, mediated by the SOCS proteins. The cloning of a STAT-inducible gene, CIS,56 and several
additional genes that bear substantial sequence
homology37,57 has yielded a family of proteins that can
directly suppress growth factor receptor-induced signals. Because IFNs
are potent inducers of STAT1 activation, they also lead to the
production of several SOCS proteins. In turn, SOCS proteins act to
eliminate the signal that initially led to their production. On the
basis of these findings, we tested whether SOCS proteins might be
candidates to mediate IFN- Hence, we tested whether CIS, SOCS-1, or SOCS-3 was inducible in
BaF3/mMpl or murine MK treated with IFN- Several lines of evidence support the hypothesis that SOCS-1 is
responsible for IFN- We found that SOCS-3 is induced by TPO in primary murine MKs. To our knowledge, this is the first report of the responsiveness of this signaling inhibitor to TPO. Numerous cytokines have been shown to induce SOCS-3 production, including growth hormone, prolactin, leptin, IL-2, IL-10, and EPO. In fact, the most obvious physiologic effect in mice genetically engineered to eliminate SOCS-3 expression is fetal erythrocytosis, likely caused by unregulated EPO signaling.67 Thus, given the similarity of signaling pathways used by EPO and TPO, our finding that TPO also induces SOCS-3 was not unexpected. Finally, the results reported here may have broader implications. As
noted, most of the signaling pathways used by TPO are shared with a
large number of interleukins, hematopoietic growth factors, and other
cytokines, mediators exerting stimulatory and inhibitory effects on
cell development. Several of these molecules have also been
demonstrated to induce SOCS protein production, and SOCS proteins block
signaling from many stimulatory cytokines.23 Of interest,
it was recently reported that IL-10 down-modulates IFN-
We thank Dr Don Foster at ZymoGenetics for the kind gift of recombinant murine and human TPO and anti-Mpl antiserum, Dr James Ihle for the anti-STAT5b antibody, Dr Douglas Hilton for the murine SOCS-1 cDNA and antiserum to the protein, and Dr Akihito Yoshimura for the SOCS-3 cDNA and the antiserum to SOCS-1 and SOCS-3 proteins.
Submitted February 25, 2000; accepted May 12, 2000.
Supported by National Institutes of Health grants R01 CA31615 and R01 DK 49855 (K.K.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Kenneth Kaushansky, Division of Hematology, University of Washington School of Medicine, Box 357710, 1959 NE Pacific St, Seattle, WA 98195; e-mail: kkaushan{at}u.washington.edu.
1. Zein NN. Interferons in the management of viral hepatitis. Cytokines Cell Mol Ther. 1998;4:229-241[Medline] [Order article via Infotrieve]. 2. Ahmed A, Keeffe EB. Treatment strategies for chronic hepatitis C: update since the 1997 National Institutes of Health Consensus Development Conference. J Gastroenterol Hepatol. 1999;14(suppl):S12-S18. 3. Lau DT, Miller KD, Detmer J, et al. Hepatitis G virus and human immunodeficiency virus coinfection: response to interferon-alpha therapy. J Infect Dis. 1999;180:1334-1337[Medline] [Order article via Infotrieve].
4.
Silver RT, Woolf SH, Hehlmann R, et al.
An evidence-based analysis of the effect of busulfan, hydroxyurea, interferon, and allogeneic bone marrow transplantation in treating the chronic phase of chronic myeloid leukemia: developed for the American Society of Hematology.
Blood.
1999;94:1517-1536 5. Tefferi A, Elliott MA, Solberg LA Jr, Silverstein MN. New drugs in essential thrombocythemia and polycythemia vera. Blood Rev. 1997;11:1-7[Medline] [Order article via Infotrieve]. 6. Aviles A, Diaz-Maqueo JC, Talavera A, Nambo MJ, Garcia EL. Maintenance therapy with interferon alfa 2b in Hodgkin's disease. Leuk Lymphoma. 1998;30:651-656[Medline] [Order article via Infotrieve]. 7. Ozer H, Wiernik PH, Giles F, Tendler C. Recombinant interferon-alpha therapy in patients with follicular lymphoma. Cancer. 1998;82:1821-1830[Medline] [Order article via Infotrieve]. 8. Fattovich G, Giustina G, Favarato S, Ruol A. A survey of adverse events in 11,241 patients with chronic viral hepatitis treated with alfa interferon. J Hepatol. 1996;24:38-47[Medline] [Order article via Infotrieve]. 9. Dusheiko G. Side effects of alpha interferon in chronic hepatitis C. Hepatology. 1997;26(suppl 1):112S-121S[Medline] [Order article via Infotrieve]. 10. Martin TG, Shuman MA. Interferon-induced thrombocytopenia: is it time for thrombopoietin? Hepatology. 1998;24:1430-1432. 11. Toccaceli F, Rosati S, Scuderi M, Iacomi F, Picconi R, Laghi V. Leukocyte and platelet lowering by some interferon types during viral hepatitis treatment. Hepatogastroenterology. 1998;45:1748-1752[Medline] [Order article via Infotrieve]. 12. Peck-Radosavljevic M, Wichlas M, Pidlich J, et al. Blunted thrombopoietin response to interferon alfa-induced thrombocytopenia during treatment for hepatitis C. Hepatology. 1998;28:1424-1429[Medline] [Order article via Infotrieve]. 13. Lopez-Morante AJ, Saez-Royuela F, Casanova-Valero F, et al. Immune thrombocytopenia after alpha-interferon therapy in a patient with chronic hepatitis C. Am J Gastroenterol. 1992;87:809-810[Medline] [Order article via Infotrieve]. 14. Shrestha R, McKinley C, Bilar BM, Everson GT. Possible idiopathic thrombocytopenic purpura associated with natural alpha interferon therapy for chronic hepatitis C infection. Am J Gastroenterol. 1995;90:1146-1147[Medline] [Order article via Infotrieve]. 15. Mazur EM, Richtsmeier WJ, South K. Alpha-interferon: differential suppression of colony growth from human erythroid, myeloid, and megakaryocytic hematopoietic progenitor cells. J Interferon Res. 1986;6:199-206[Medline] [Order article via Infotrieve]. 16. Han ZC, Briere J, Abgrall JF, Le Gall G, Parent D, Sencebe L. Effects of recombinant human interferon alpha on human megakaryocyte and fibroblast colony formation. J Biol Regul Homeost Agents. 1987;1:195-200[Medline] [Order article via Infotrieve].
17.
Ganser A, Carlo-Stella C, Greher J, Volkers B, Hoelzer-D.
Effect of recombinant interferons alpha and gamma on human bone marrow-derived megakaryocytic progenitor cells.
Blood.
1987;70:1173-1179 18. Gugliotta L, Bagnara GP, Catani L, et al. In vivo and in vitro inhibitory effect of alpha-interferon on megakaryocyte colony growth in essential thrombocythaemia. Br J Haematol. 1989;71:177-181[Medline] [Order article via Infotrieve]. 19. Wang JC, Lang HD, Liao P, Wong A. Recombinant alpha-interferon inhibits colony formation of bone marrow fibroblast progenitor cells (CFU-F). Am J Hematol. 1992;40:81-85[Medline] [Order article via Infotrieve]. 20. Bhatia R, Verfaillie CM. The effect of interferon alpha on beta 1 integrin mediated adhesion and growth regulation in chronic myelogenous leukemia. Leuk Lymphoma. 1998;28:241-254[Medline] [Order article via Infotrieve].
21.
Means RT, Krantz SB.
Inhibition of human erythroid colony-forming units by interferons
22.
Kaushansky K.
Thrombopoietin: the primary regulator of platelet production.
Blood.
1995;86:419-431 23. Hilton DJ. Negative regulators of cytokine signal transduction. Cell Mol Life Sci. 1999;55:1568-1577[Medline] [Order article via Infotrieve]. 24. Lok S, Kaushansky K, Holly RD, et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature. 1994;369:565-568[Medline] [Order article via Infotrieve].
25.
Drachman JG, Kaushansky K.
Dissecting the thrombopoietin receptor: functional elements of the mpl cytoplasmic domain.
Proc Natl Acad Sci U S A.
1997;94:2350-2355
26.
Hodohara K, Fujii N, Yamamoto N, Kaushansky K.
Stromal cell derived factor 1 acts synergistically with thrombopoietin to enhance the development of megakaryocytic progenitor cells.
Blood.
2000;95:769-776
27.
Drachman JD, Sabath DF, Fox NE, Kaushansky K.
Thrombopoietin signal transduction in purified murine megakaryocytes.
Blood.
1997;89:483-492 28. Kaushansky K, Lok S, Holly RD, et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature. 1994;369:568-571[Medline] [Order article via Infotrieve].
29.
Rojnuckarin P, Drachman JG, Kaushansky K.
Thrombopoietin-induced activation of the mitogen activated protein kinase pathway in normal megakaryocytes: role in endomitosis.
Blood.
1999;94:1273-1282
30.
Drachman J, Griffin JD, Kaushansky K.
Stimulation of tyrosine kinase activity by MPL-ligand (thrombopoietin).
J Biol Chem.
1995;270:4979-4982 31. Pallard C, Gouilleux F, B'enit L, et al. Thrombopoietin activates a STAT5-like factor in hematopoietic cells. EMBO J. 1995;14:2847-2856[Medline] [Order article via Infotrieve]. 32. Sattler M, Durstin MA, Frank DA, et al. The thrombopoietin receptor c-Mpl activates JAK2 and TYK2 tyrosine kinases. Exp Hematol. 1995;23:1040-1048[Medline] [Order article via Infotrieve].
33.
Mu SX, Xia M, Elliot G, et al.
Megakaryocyte growth and development factor and interleukin-3 induce patterns of protein-tyrosine phosphorylation that correlate with dominant differentiation over proliferation of mpl-transfected 32D cells.
Blood.
1995;86:4532-4543
34.
Miyakawa Y, Oda A, Druker BJ, et al.
Thrombopoietin induces tyrosine phosphorylation of Stat3 and Stat5 in human blood platelets.
Blood.
1996;87:439-446
35.
Yang W, Tabrizi M, Berrada K, Yi T.
SHP-1 phosphatase C-terminus interacts with novel substrates p32/p30 during erythropoietin and interleukin-3 mitogenic responses.
Blood.
1998;91:3746-3755
36.
Haspel RL, Darnell JE.
A nuclear protein tyrosine phosphatase is required for the inactivation of Stat1.
Proc Natl Acad Sci U S A.
1999;96:10188-10193 37. Starr R, Willson TA, Viney EM, et al. A family of cytokine-inducible inhibitors of signalling. Nature. 1997;387:917-921[Medline] [Order article via Infotrieve]. 38. Jaster R, Tschirch E, Bittorf T, Brock J. Interferon-alpha inhibits proliferation of Ba/F3 cells by interfering with interleukin-3 action. Cell Signal. 1999;11:769-775[Medline] [Order article via Infotrieve].
39.
Kuniyasu H, Yasui W, Kitahara K, et al.
Growth inhibitory effect of interferon-
40.
Wagner EF, Hleb M, Hanna N, Sharma S.
A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation.
J Immunol.
1998;161:1123-1131 41. Dukes PP, Izadi P, Ortega JA, Gomperts E. Inhibitory effect of interferon on mouse megakaryocytic progenitor cells in culture. Exp Hematol. 1980;8:1048-1053[Medline] [Order article via Infotrieve]. 42. Koike K, Ma F, Shiohara M, et al. Interferon gamma inhibits proliferation, but not commitment, of murine granulocyte macrophage progenitors. J Cell Physiol. 1990;153:528-533.
43.
Tsuji K, Muraoka K, Nakahata T.
Interferon-
44.
Dai CH, Price JO, Brunner T, Krantz SB.
Fas ligand is present in human erythroid colony-forming cells and interacts with Fas induced by interferon 45. Souyri M, Vigon I, Penciolelli J-F, Tambourin P, Wendling F. A putative truncated cytokine receptor gene transduced by the myeloproliferative leukemia virus immortalizes hematopoietic progenitors. Cell. 1990;63:1137-1147[Medline] [Order article via Infotrieve]. 46. Cosman D. The hematopoietin receptor superfamily. Cytokine. 1993;5:95-106[Medline] [Order article via Infotrieve]. 47. Ihle JN. Cytokine receptor signaling. Nature. 1995;377:591-594[Medline] [Order article via Infotrieve].
48.
Darnell JE Jr, Kerr IM, Stark GR.
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science.
1994;264:1415-1421
49.
David M, Petricoin E III, Benjamin C, Pine R, Weber MJ, Larner AC.
Requirement for MAP kinase (ERK2) activity in interferon alpha- and interferon beta-stimulated gene expression through STAT proteins.
Science.
1995;269:1721-1723
50.
Uddin S, Yenush L, Sun XJ, Sweet ME, White MF, Platanias LC.
Interferon-alpha engages the insulin receptor substrate-1 to associate with the phosphatidylinositol 3'-kinase.
J Biol Chem.
1995;270:15938-15941 51. Takaoka A, Tanaka N, Mitani Y, et al. Protein tyrosine kinase Pyk2 mediates the Jak-dependent activation of MAPK and Stat1 in IFN-gamma, but not IFN-alpha, signaling. EMBO J. 1999;18:2480-2488[Medline] [Order article via Infotrieve].
52.
Schindler C, Fu XY, Improta T, Aebersold R, Darnell JE Jr.
Proteins of transcription factor ISGF-3: one gene encodes the 91 and 84-kDa ISGF-3 proteins that are activated by interferon
53.
Yi T, Zhang J, Miura O, Ihle JN.
Hematopoietic cell phosphatase associates with erythropoietin (Epo) receptor after Epo-induced receptor tyrosine phosphorylation: identification of potential binding sites.
Blood.
1995;85:87-95 54. Tilbrook PA, Bittorf T, Callus BA, Busfield SJ, Ingley E, Klinkin SP. Regulation of the erythropoietin receptor and involvement of JAK2 in differentiation of J2E erythroid cells. Cell Growth Differ. 1996;7:511-519[Abstract]. 55. Van Zant G, Shultz L. Hematologic abnormalities of the immunodeficient mouse mutant, viable motheaten (mev). Exp Hematol. 1989;17:81-87[Medline] [Order article via Infotrieve]. 56. Yoshimura A, Ohkubo T, Kiguchi T, et al. A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors. EMBO J. 1995;14:2816-2826[Medline] [Order article via Infotrieve]. 57. Naka T, Narazaki M, Hirata M, et al. Structure and function of a new STAT-induced STAT inhibitor. Nature. 1997;387:924-929[Medline] [Order article via Infotrieve].
58.
Berger LC, Hawley R.
Interferon- 59. Nosaka T, Kawashima T, Misawa K, Ikuta K, Mui ALF, Kitamura T. STAT5 as a molecular regulator of proliferation, differentiation and apoptosis in hematopoietic cells. EMBO J. 1999;18:4754-4765[Medline] [Order article via Infotrieve].
60.
Sakamoto H, Yasukawa H, Masuhara M, et al.
A Janus kinase inhibitor, JAB, is an interferon- 61. Suzuki R, Sakamoto H, Yasukawa H, et al. CIS3 and JAB have different regulatory roles in interleukin-6 mediated differentiation and STAT3 activation in M1 leukemia cells. Oncogene. 1998;17:2271-2278[Medline] [Order article via Infotrieve]. 62. Naka T, Fujimoto M, Kishimoto T. Negative regulation of cytokine signaling: STAT-induced STAT inhibitor. Trends Biochem Sci. 1999;24:394-398[Medline] [Order article via Infotrieve]. 63. Marine JC, Topham DJ, McKay C, et al. SOCS1 deficiency causes a lymphocyte-dependent perinatal lethality. Cell. 1999;98:609-616[Medline] [Order article via Infotrieve]. 64. Metcalf D, Alexander WS, Elefanty AG, et al. Aberrant hematopoiesis in mice with inactivation of the gene encoding SOCS-1. Leukemia. 1999;13:926-934[Medline] [Order article via Infotrieve]. 65. Key LL, Ries WL, Rodriguiz RM, Hatcher HC. Recombinant human interferon gamma therapy for osteopetrosis. J Pediatr. 1992;121:119-124[Medline] [Order article via Infotrieve].
66.
Jett JR, Maksymiuk AW, Su JQ, et al.
Phase III trial of recombinant interferon gamma in complete responders with small cell lung cancer.
J Clin Oncol.
1994;12:2321-2326 67. Marine JC, McKay C, Wang DM, et al. SOCS3 is essential in the regulation of fetal liver erythropoiesis. Cell. 1999;98:617-627[Medline] [Order article via Infotrieve].
68.
Ito S, Ansari P, Sakatsume M, et al.
Interleukin-10 inhibits expression of both interferon alpha- and interferon gamma-induced genes by suppressing tyrosine phosphorylation of STAT1.
Blood.
1999;93:1456-1463
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
N. Fourouclas, J. Li, D. C. Gilby, P. J. Campbell, P. A. Beer, E. M. Boyd, A. C. Goodeve, D. Bareford, C. N. Harrison, J. T. Reilly, et al. Methylation of the suppressor of cytokine signaling 3 gene (SOCS3) in myeloproliferative disorders Haematologica, November 1, 2008; 93(11): 1635 - 1644. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Smieja, M. Jamaluddin, A. R. Brasier, and M. Kimmel Model-based analysis of interferon-{beta} induced signaling pathway Bioinformatics, October 15, 2008; 24(20): 2363 - 2369. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Hitchcock, M. M. Chen, J. R. King, and K. Kaushansky YRRL motifs in the cytoplasmic domain of the thrombopoietin receptor regulate receptor internalization and degradation Blood, September 15, 2008; 112(6): 2222 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamane, T. Nakamura, H. Suzuki, M. Ito, Y. Ohnishi, Y. Ikeda, and Y. Miyakawa Interferon-{alpha}2b-induced thrombocytopenia is caused by inhibition of platelet production but not proliferation and endomitosis in human megakaryocytes Blood, August 1, 2008; 112(3): 542 - 550. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Zimmerer, G. B. Lesinski, S. V. Kondadasula, V. I. Karpa, A. Lehman, A. RayChaudhury, B. Becknell, and W. E. Carson III IFN-{alpha}-Induced Signal Transduction, Gene Expression, and Antitumor Activity of Immune Effector Cells Are Negatively Regulated by Suppressor of Cytokine Signaling Proteins J. Immunol., April 15, 2007; 178(8): 4832 - 4845. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Matuskova, A. K. Chauhan, B. Cambien, S. Astrof, V. S. Dole, C. L. Piffath, R. O. Hynes, and D. D. Wagner Decreased Plasma Fibronectin Leads to Delayed Thrombus Growth in Injured Arterioles Arterioscler. Thromb. Vasc. Biol., June 1, 2006; 26(6): 1391 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Schmid, A Kreil, W Jessner, M Homoncik, C Datz, A Gangl, P Ferenci, and M Peck-Radosavljevic Suppression of haematopoiesis during therapy of chronic hepatitis C with different interferon {alpha} mono and combination therapy regimens Gut, July 1, 2005; 54(7): 1014 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Eriksen, V. H. Sommer, A. Woetmann, A. B. Rasmussen, C. Brender, A. Svejgaard, S. Skov, C. Geisler, and N. Odum Bi-phasic Effect of Interferon (IFN)-{alpha}: IFN-{alpha} UP- AND DOWN-REGULATES INTERLEUKIN-4 SIGNALING IN HUMAN T CELLS J. Biol. Chem., January 2, 2004; 279(1): 169 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Linden and K. Kaushansky The Glycan Domain of Thrombopoietin (TPO) Acts in trans to Enhance Secretion of the Hormone and Other Cytokines J. Biol. Chem., September 13, 2002; 277(38): 35240 - 35247. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Chacko and M. L. Adamo Double-Stranded RNA Decreases IGF-I Gene Expression in a Protein Kinase R-Dependent, but Type I Interferon-Independent, Mechanism in C6 Rat Glioma Cells Endocrinology, February 1, 2002; 143(2): 525 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bousquet, V. Chesnokova, A. Kariagina, A. Ferrand, and S. Melmed cAMP Neuropeptide Agonists Induce Pituitary Suppressor of Cytokine Signaling-3: Novel Negative Feedback Mechanism for Corticotroph Cytokine Action Mol. Endocrinol., November 1, 2001; 15(11): 1880 - 1890. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Greenhalgh and D. J. Hilton Negative regulation of cytokine signaling J. Leukoc. Biol., September 1, 2001; 70(3): 348 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lian, L. Wang, S. Yamaga, W. Bonds, Y. Beazer-Barclay, Y. Kluger, M. Gerstein, P. E. Newburger, N. Berliner, and S. M. Weissman Genomic and proteomic analysis of the myeloid differentiation program Blood, August 1, 2001; 98(3): 513 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Wang, E. Zorn, and J. Ritz Specific down-regulation of interleukin-12 signaling through induction of phospho-STAT4 protein degradation Blood, June 15, 2001; 97(12): 3860 - 3866. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||