| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Biological and Clinical
Hematology, and CNRS UMR8603, Hôpital Necker-Enfants
Malades and Université Paris V; Biological Hematology,
Hôpital de La Pitié-Salpêtrière; and Biological
Hematology, Hôpital Saint-Louis; Paris, France.
B-cell precursor acute lymphoblastic leukemias (BCP-ALLs) are
increasingly treated on risk-adapted protocols based on presenting clinical and biological features. Residual molecular positivity of
clonal immunoglobulin (IG) and T-cell receptor
(TCR) rearrangements allows detection of patients at an
increased risk of relapse. If these rearrangements are to be used for
universal follow-up, it is important to determine the extent to which
they are informative in different BCP-ALL subsets. We show that
IGH V-D-J rearrangements occur in 89% of 163 BCP-ALL, with
no significant variation according to age or genotype (BCR-ABL,
TEL-AML1, MLL-AF4, and E2A-PBX1). In contrast,
TCRG rearrangements, which occur in 60% of patients overall, are frequent in BCR-ABL and TEL-AML1,
are less so in MLL-AF4, and are virtually absent in infants
aged predominantly from 1 to 2 years and in E2A-PBX1 ALLs.
Incidence of the predominant TCRD V B-cell precursor acute lymphoblastic
leukemias (BCP-ALLs) represent approximately 85% and 75% of pediatric
and adult ALLs, respectively. They include a number of subtypes that
can be individualized on the basis of clinical presentation,
immunophenotype, and genotype, as assessed by cytogenetic and molecular
techniques. This has allowed identification of patients with markedly
different prognoses and the increasing use of risk-adapted protocols.
BCP-ALL with MLL-AF4, for example, is frequent in infants
younger than 1 year old who present with marked leukocytosis and a poor
response to treatment.1 It is also common in older
adults.2 BCR-ABL identifies a group of
poor-prognosis adults.3 The TEL-AML1 (ETV6-CBFA2) fusion transcript (FT) occurs almost
exclusively in childhood BCP-ALL4 and is of standard or
favorable prognostic significance depending on the clinical
protocol.5 E2A-PBX1 FT predominates in
young adults with relatively mature blasts. Its previously poor
prognosis has been improved by more intensive treatment (reviewed in
Hunger6). The approximate incidence of these FTs in
pediatric and adult BCP-ALL, respectively, are as follows:
MLL-AF4, 5% and 5%; BCR-ABL, 3% and
30%; TEL-AML1, 25% and below 5%; and E2A-PBX1,
5% and 5%. Although FTs provide invaluable prognostic markers at
diagnosis, their current utility as markers of residual disease at the
early stages of remission, when therapeutic decisions are taken, is
less clear, at least for qualitative reverse transcriptase-polymerase
chain reaction (RT-PCR) analysis.
BCP-ALLs also demonstrate clonal rearrangements of the IGH
and TCR genes in the majority of cases (reviewed in Langerak
et al7). IGH rearrangements are reported in more
than 90% of cases by Southern blotting and 70% to 90% by
PCR.8 Complete
VH-DH-JH rearrangement is preceded
by partial DH-JH rearrangement, which is
detected by Southern hybridization with a JH probe or by
specific DH-JH PCR.9 Illegitimate
TCRG V-J rearrangements have been described in 40% to 70%
of BCP-ALLs,7,10 and TCRD rearrangement in
approximately 50%. The commonest rearrangements correspond to partial
V IG and TCR rearrangements provide
invaluable markers for patient follow-up, insofar as the vast majority
of BCP-ALLs are informative for at least one clonal rearrangement. A
variety of molecular strategies allow detection of residual clonal
populations with a sensitivity that varies from approximately 5%
(5 × 10 Since patients of different ages and genotype are increasingly treated
on different protocols, it is important to determine whether the extent
to which IGH/TCR is informative varies as a function of age and/or genotype. We demonstrate that, while
IGH rearrangements are common in all categories of adult and
pediatric BCP-ALL, TCRG and TCRD V Patient material and immunophenotyping
IGH and TCR analysis
IGH VH-DH-JH PCR was performed from 1 µg DNA in 50 µL using VH consensus primers FR1 (FR1c) and FR2 (FR2c with 2 VH5 and VH6 FR1-family-specific primers) and a mixture of 3 JH primers.8 Selected cases were also analyzed with the use of FR1-family-specific (FR1f) and FR3 consensus primers.8 We analyzed 15% of the PCR reaction by nondenaturing 8% to 12% polyacrylamide gel electrophoresis and ethidium bromide staining (EB PAGE). IGH DH-JH PCR was performed as previously described.9 TCRG analysis was performed in 2 V TCRD V 2-D 3 PCR was performed in a total volume of 50 µL
as previously described16 with an initial 94°C step for 2 minutes followed by 35 cycles at 62°C for 20 seconds and 94°C for
20 seconds. The final extension step was at 72°C for 5 minutes. PCR
products were analyzed on 8% nondenaturating PAGE.
Detection of FTs and MLL rearrangements RNA was extracted from leukemic cells by a rapid lysis technique (RNAble) (EuroBio, Les Ulis, France), and complementary DNA (cDNA) and RT-PCR reactions were performed as previously described17 with the use of 2 µg RNA, random hexamers (Pharmacia, Orsay, France), and MMLV reverse transcriptase (Life Technologies, Cergy-Pontoise, France). Porphobilinogen deaminase (PBGD) transcripts were amplified in parallel from the same cDNA to control for RNA quality.17 In keeping with LALA94 and FRALLE93 guidelines, all infants and children were analyzed prospectively for the BCR-ABL (e1-a2 and b2/b3-a2), MLL-AF4, TEL-AML1, and E2A-PBX1 FTs and adults for all of the above other than TEL-AML1, with the use of the following primers: BCR-ABL b2/b3-a2 (CMLA: GGAGCTGCAGATGCTGACCAAC; ALLF: GGTCATTTTCACTGGGTCCAGC; annealing 60°C); BCR-ABL e1-a2 (BCR1 ExtS TGAGAACCTCACCTCCAG; ABLExtAS: CTCCACTGGCCACAAAAT; annealing 51°C); TEL-AML1 (B12: CGTGGATTTCAAACAGTCCA; AM3: GCTCGCTCATCTTGCCTGG; annealing 55°C); E2A-PBX1 (E2AExtS: GGCCTGCAGAGTAAGATAG; PBXExtAS: CACGCCTTCCGCTAACAG; annealing 51°C); MLL-AF4 (HRX5Ext: GAGGATCCTGCCCCAAAGAAAAG; AF4Ext: TGAGCTGAAGGTCGTCTTCGAGC; annealing 60°C). Certain E2A-PBX1-positive cases were also analyzed for wild-type E2A (E2A/1399U19 GCCTCATGCACAACCACG and E2A/2234L20 GAGTGACACGGTGGCTGAGA; annealing 60°C) and PBX1 (PBX1/243U25 GCAGGACATTGGAGACATTTTACAG and PBX1/732L19 GCTGAACTTGCGGTGGATG; annealing 57°C) and PBX1-E2A transcripts (PBX1/243U25 and E2A/2234L20 primers; annealing 57°C) with the use of 6% formamide and 2 U Taq in a final volume of 50 µL. The latter were hybridized with an internal 33P-labeled PBX1 (PBX1294U18 TTTGGATGAGGCGCAGGC) probe.Infants were also screened for MLL rearrangements by Southern blotting of BamHI and HindIII digested DNA, with the use of the B859 cDNA probe.18 Recombination activating gene transcripts Detection of recombination activating gene 1 (RAG1) and RAG2 transcripts by RT-PCR were performed in 50 µL with 0.4 µg cDNA, 2.5 mmol/L MgCl2, 0.2 mmol/L dNTP, 0.4 µmol/L each primer and 2 U Taq polymerase. Primers used were as follows: RAG1 (ACACACTTTGCCTTCTCTTTGGTATT [Ex1]; TCTCACCCGGAACAGCTTAAA [Ex2]); RAG2 (TTCCCCAAGTGCTGACAATTAA [Ex1a]; TTTGGGCCAGCCTTTTTG [Ex2]). Samples were amplified for 35 cycles (30 seconds at 93°C, 1 minute at 60°C, and 1 minute at 72°C, with a final elongation cycle of 10 minutes at 72°C) and analyzed on 2% agarose gels. RAG1 PCR products were 209 base pairs (bp) and RAG2 products were 219 bp. The REH cell line was used as a positive control.Statistical analysis Comparison of the incidence of IGH/TCR rearrangements in different subgroups was analyzed by the 2-sided 2
test, and comparison of the mean ages of TCR-rearranged or
germline cases was analyzed by the 2-sided Mann-Whitney
U test.
Diagnostic assessment of IgH/TCR configuration and fusion transcripts In order to determine whether the incidence of IG and TCR rearrangements varies with patient subgroup, we undertook systematic, prospective assessment of IGH and TCRG clonality and detection of up to 5 FTs, the latter in accordance with the national French LALA94 adult (coordinator J. Gabert, Institut Paoli-Calmette, Marseilles, France) and FRALLE93 (coordinator A. Baruchel, Hôpital St Louis, Paris, France) pediatric protocols. Diagnostic samples from 163 B-cell lineage ALLs were analyzed for IGH and TCRG by PCR and EB PAGE analysis. Detection of BCR-ABL (e1-a2 and b2/b3-a2), E2A-PBX1, and MLL-AF4 FTs was undertaken in 140 of 163 patients with sufficient RNA. Detection of TEL-AML1 was performed systematically only for patients younger than 15 years, since we have found this FT in fewer than 1% of adult cases.4BCR-ABL was detected in 25 cases, (20e1-a2, 2b2-a2,
3b3-a2) TEL-AML1 in 18, E2A-PBX1 in 13, and
MLL-AF4 in 14. The incidence of each of these as a function
of age is shown in Table 1. Although this
corresponds to published incidences for BCR-ABL and
TEL-AML1, the proportion of patients with
E2A-PBX1 and MLL-AF4 is not representative, because 2 nonprotocol MLL-AF4 cases were referred for
molecular characterization and 8 additional E2A-PBX1 cases
were added to increase this category (see below). The presence of
reciprocal PBX1-E2A transcripts was looked for in 8 E2A-PBX1 ALLs, 3 unbalanced and 5 balanced cases,
but no specific bands that hybridized to an internal PBX1 probe were
seen, despite hybridization to a PBX1 wild-type RT-PCR control. All
cases demonstrated wild-type E2A and low-level PBX1 transcripts, and
E2A-PBX1 positivity was confirmed in parallel on the same cDNA samples
(data not shown).
IGH VH -DH-JH IGH was assessed with the use of FR1c and FR2 primers and considered to be positive if either or both demonstrated a clonal band. If both were negative, cases were reanalyzed with FR1f and FR3 consensus primers8 and were classified as positive if either demonstrated a clonal band. Occasional cases were considered to be oligoclonal on the basis of the presence of at least 3 discreet bands. In the majority, at least one PCR system was considered to be clonal. These cases were classified as IgH-positive. It should be emphasized that minor clonal PCR products were seen in several cases, particularly following fluorescent analysis (data not shown). Although these are likely to represent minor clones, their presence was not particularly taken into consideration for these consensus PCR strategies. Overall, 145 of 163 (89%) patients demonstrated IGH positivity, including 125 of 158 (79%) by FR1c-JH, 121 of 157 (77%) by FR2-JH, 18 of 37 (49%) by FR1f-JH, and 26 of 52 (50%) by FR3-JH.The incidence of IGH rearrangements as a function of age and
genotype is shown in Tables 1 and 2 and Figure
1. Rearrangements were frequent in all
categories, being highest in BCR-ABL and E2A-PBX1
and lowest in MLL-AF4 ALL and FT-negative adults, although this was not significant (P = .3). IGH
VH-DH-JH rearrangements therefore
occur in approximately 90% of BCP ALLs, with an incidence that varies
little with age or genotype.
TCRG Cases were considered to be TCRG-positive if either multiplex reaction (V fI/10-J or V 9/11-J , Figure
2) demonstrated at least one discrete
band. Overall, rearrangements were observed in 98 of 163 (60%) cases.
The incidence varied with age (Table 1, Figure 1) and was significantly
less frequent in infants younger than 2 years (9%) compared with all
other groups (P = .0011). Mean age for the 11 infants (5 boys, 6 girls) was 13.5 months (range, 3-21) and 9 were older than 12 months. The group included 2 boys aged 3 and 5 months with
MLL-AF4, a 14-month-old girl with TEL-AML1, a
21-month-old boy with E2A-PBX1, a 16-month-old girl with an
unidentified MLL rearrangement, and 8 MLL
germline cases. The only TCRG rearrangement was seen in the
uncharacterized MLL rearrangement. TCRG
rearrangements were seen in 16 of 20 (80%) children aged from 2 to 3 years, 13 of 23 (56%) from 3 to 4 years, 10 of 16 (63%) from 6 to 8 years, and 10 of 15 (67%) from 9 to 14 years. The absence of
TCRG rearrangements was therefore relatively specific to
children aged predominantly from 1 to 2 years.
With regard to genotype (Table 2), TCRG rearrangements were frequent in BCR-ABL and TEL-AML1, were less so in MLL-AF4, and were not seen in E2A-PBX1 cases. The incidence in FT-negative ALLs varied with age, as above (Table 1). These data demonstrate that illegitimate TCRG rearrangements are absent in E2A-PBX1 ALLs, infrequent in MLL-AF4, and rare in infants from 1 to 2 years old, and that in the last-named, this is not due to MLL rearrangement. TCRD V 2-D 3 PCR was assessed in all
subjects with known FTs, aged younger than 2 years and/or
IGH VH-DH-JH-negative,
with available DNA. Overall, clonal rearrangements were detected in 32%. The incidence correlated more closely with age than genotype, since rearrangements were present in a progressively lower proportion with increasing age (Table 1, Figure 1). Mean age of
V 2-D 3-positive subjects was 15 years compared with 33 years for
negative subjects (P = .0004). In contrast, the mean age
of patients with TCRG-rearranged cases was 23 years compared
with 18 years for those with negative cases (P = .13).
TCRG rearrangements were seen in 13 of 24 (54%) TCR
V 2-D 3-rearranged and 30 of 50 (60%) V 2-D 3-unrearranged cases. V 2-D 3 rearrangements were present in all genotype
categories (Table 2, Figure 3), with no
significant differences. It is noteworthy that TCRD
rearrangements occurred in a proportion of E2A-PBX1 cases,
when they were seen in the 2 youngest subjects.
IGH and TCRG rearrangements according to immunophenotype It was possible that the lower incidence of TCRG rearrangement in MLL-AF4 and E2A-PBX1 ALL resulted from relative immaturity and maturity of the recombinase complex, respectively. MLL-AF4 ALLs classically present with a CD34+, CD19+, CD10 ,
CD15+ profile.19 BCR-ABL and
TEL-AML1 are usually CD34+, CD19+,
and CD10+, and frequently express the CD13 and/or CD33
myeloid markers.20,21 E2A-PBX1 ALLs demonstrate
a more mature phenotype, insofar as they often express cIgµ heavy
chains and are CD34 but CD10+ and
CD22+.22 Although surface CD20 (sCD20)
appears before sCD22 during B-lymphoid development,23,24
the latter has been considered to represent an earlier marker of
differentiation arrest.25
Immunophenotypic data for selected groups are shown in Table 2. All cases expressed CD19. MLL-AF4 cases were indeed relatively immature, as assessed by the absence of CD20 and cIgµ expression. It is, however, noteworthy that CD34 expression was less frequent than in TEL-AML1 and BCR-ABL cases, and sCD22 was seen in 50% of cases. CD15 was expressed in 7 of 9 (78%) MLL-AF4 but was not tested in the other categories. TEL-AML1 and BCR-ABL cases demonstrated a similar immunophenotypic profile, apart from more frequent cIgµ and CD20 expression in the latter. E2A-PBX1 cases showed relative maturity, with rare CD34 positivity, universal CD22 expression, and frequent cIgµ positivity. CD20 expression was not, however, more frequent than in TEL-AML1 and BCR-ABL cases. The incidence of TCRG rearrangements in cIgµ-expressing, E2A-PBX1-negative patients was 7 of 14 (50%), compared with 0 of 10 in cIgµ+, E2A-PBX1-positive cases. The latter showed less frequent CD34 (1 of 10 vs 8 of 14, respectively) and CD20 (4 of 10 vs 9 of 14) expression but similar CD22 (10 of 10 vs 13 of 14) expression when compared with E2A-PBX1-negative cIgµ+ ALLs, thus not clearly demonstrating a distinct stage of maturation arrest. These data suggest that a relatively late stage of maturation arrest is unlikely to explain the complete absence in E2A-PBX1 cases. Identification of an immunophenotypic category equivalent to MLL-AF4 cases was more difficult, insofar as CD10 negativity was the most characteristic abnormality in this group but was identified in only 3 MLL-AF4-negative (MLL germline) cases. We therefore compared the incidence of TCRG rearrangement among MLL-AF4 cases using CD34 positivity as an indicator of relative immaturity, or CD22 positivity as an indicator of relative maturity. No differences were observed (data not shown), suggesting that the lower incidence of TCRG rearrangement in MLL-AF4 cases is not due purely to arrest at a particularly early stage of B-lymphoid development. The absence of TCRG rearrangements in the 6 FT-negative infants was not due to a particular immunophenotypic stage of maturation arrest (Table 2). RAG1 and RAG2 expression To determine whether the absence of TCRG rearrangement was secondary to loss of recombinase activity, RAG1 and RAG2 expression was assessed by RT-PCR in selected patients. Analysis of 2 patients with essential thrombocythemia showed RAG1 and RAG2 transcripts in bone marrow but not in peripheral blood, consistent with their detection in B-lymphoid precursors (data not shown). We analyzed 17 blood and 24 bone marrows from 2 mature B-cell leukemias and 39 B-lineage ALLs (Figure 2). All cases other than the 4 surface Ig+ (sIg+) ALLs (1 of which was E2A-PBX1-positive) and both mature B-cell leukemias were RAG1/2-positive, although 1 cIgµ+ E2A-PBX1 bone marrow was only RAG2-positive. Positive cases included 10 cIgµ E2A-PBX1, 9 MLL-AF4, and 6 infant cases (Figure 3). Failure to rearrange TCRG is not therefore due to absence of RAG activity.TCRG V and J utilization was assessed by
multifluorescent run-off (FluRO) analysis15 for 62 patients
demonstrating a clonal TCRG rearrangement by EB PAGE. Three
TCRG-negative patients all demonstrated only residual
polyclonal rearrangements on FluRO analysis (data not shown). Data from
45 T-ALLs15 are shown for comparative purposes (Figure 2).
As expected,10 BCP-ALLs demonstrated a higher proportion
of monoallelic rearrangements and a lower mean number of rearranged
alleles per patient than T-ALLs. V 9 rearrangements were commoner in
B-lineage ALL (P = .006) and V fI-J 1/2 less so
(P = .03), but no other major differences were noted.
The types of rearrangement differed in the subgroups (Figure 2).
E2A-PBX1 and infant cases are obviously absent.
TEL-AML1 cases demonstrated only J Subtyping of V IGH VH-DH-JH-negative patients by PCRs Fifteen patients (9%), including 3 MLL-AF4 and 2 TEL-AML1, were negative for all 4 IGH according to PCRs. To determine whether these patients had undergone JH rearrangement, Southern hybridization with a JH6 probe and/or PCR detection of partial DH-JH rearrangements were performed in 14 cases. Results of both analyses will be presented in greater detail elsewhere (unpublished data, F.D. et al, 1999). Nine of 13 (69%) evaluable patients had undergone partial DH-JH rearrangements, which were oligoclonal in 4. All 3 MLL-AF4 belonged to this category, in keeping with an early stage of maturation arrest. Four ALLs, including both TEL-AML1 cases, had undergone JH deletion.From a practical point of view, 7 of 163 (4%) patients demonstrated
neither IGH VH-DH-JH nor
TCRG clonal rearrangements by PCR. One was
MLL-AF4-positive; 2 were TCRD
V
In this manuscript, we demonstrate that, whereas IGH
V-D-J rearrangement varies little with BCP-ALL subtype, this is not the case for "illegitimate" TCR rearrangements. We confirm
that the incidence of the TCRD V Several explanations for the variable incidence of TCRG rearrangements are possible. RAG activity Differential expression of RAG1 and 2 could not explain the aforementioned differences, since the only RAG-negative ALLs were those expressing sIg, as previously described.27 This was, in any case, an unlikely explanation, since it would imply coordinate occurrence of illegitimate TCRG and TCRD rearrangement, which is not the case.Maturity The low incidence of TCRG rearrangement in MLL-AF4, infant cases, and E2A-PBX1 cases may reflect oncogenic transformation of a particularly immature or mature lymphoid precursor. MLL-AF4 cases were, as expected, immunophenotypically immature. Interestingly, CD34 negativity was more common in MLL-AF4 ALL than in all categories other than E2A-PBX1, including the potentially immature IGH VH-DH-JH-unrearranged group. The recent demonstration28 that the earliest hematopoietic progenitors are CD34 suggests that CD34
MLL-AF4 cases may be more immature than their
CD34+ MLL-AF4 counterparts. In keeping with
this, CD33 expression, which is found on immature hematopoietic
progenitors demonstrating multilineage potential,29 was
seen in 3 of 5 CD34 MLL-AF4 cases but in 0 of
8 CD34+ cases. Complete IGH
VH-DH-JH rearrangement was,
however, seen in 4 of 5 CD34 cases.
The arguments for relative maturity as an explanation for the total absence of TCRG rearrangement in E2A-PBX1 ALL are weaker. TCRG rearrangements were seen in 50% of cIgµ-expressing E2A-PBX1-negative patients. It is not therefore the presence of cIgµ that renders the TCRG locus inaccessible. Although we cannot exclude the possibility that E2A-PBX1 cases are more mature than their E2A-PBX1-negative cIgµ-expressing counterparts, comparison of CD34, CD20, and CD22 expression was not in favor of this, and the relatively subtle differences observed would be expected to lead to a diminution, rather than a complete absence, of TCRG rearrangement. Similarly, the virtual absence of TCRG rearrangement in infants cannot be explained on the basis of maturity, since they are immunophenotypically similar to TEL-AML1 and BCR-ABL cases. Fetal vs adult-type precursors It is possible that different types of BCP-ALL undergo oncogenic transformation at distinct stages of ontogenic development with respect to TCR accessibility. Accessibility of the TCRG and TCRD loci must be independently controlled, since we show that rearrangement at these loci does not occur in the same subgroups. Physiological TCRD rearrangement precedes TCRG in human thymus,30 with D 2-D 3
occurring prior to V -D . V 2-D 3 rearrangements were not seen;
these are virtually restricted to BCP-ALLs. During lymphoid
development, early fetal and immature precursor
IGH,31-33 TCRG,34,35 and
TCRD36-38 gene rearrangements preferentially involve 3', J proximal V segments, whereas a wider range, including 5'
V segments, are found in mature lymphoid cells. Identification of J
proximal V utilization may also reflect preliminary attempts to
rearrange the locus that have not been superseded by
subsequent attempts.
Several arguments from our series of, predominantly adult (12 of 14),
MLL-AF4 ALLs favor relative genotypic immaturity: the low
level of TCRG rearrangements predominantly involving
V Applying the same model to infant BCP-ALLs would suggest that they have undergone transformation of a more immature lymphoid precursor in which the TCRG locus is not yet accessible, yet in which TCRD accessibility is much more pronounced. E2A-PBX1 cases would have to be explained as transformation at a much later ontogenic stage, after IGH rearrangement is complete and some residual TCRD accessibility remains, but after TCRG has become inaccessible. E2A The most interesting potential explanation is that E2A-PBX1 expression is directly or indirectly responsible for rendering the TCRG locus inaccessible to illegitimate recombination. Wild-type E2A plays a fundamental role in regulating lymphoid development. E2A / mice demonstrate
a total block in B-lymphoid development with absence of
DH-JH and
VH-DH-JH
rearrangement.41,42 Loss of E2A also leads to a
block in T-lymphoid development, with development of thymic
lymphomas.43 Cell lines derived from the latter undergo programmed cell death in the presence of enforced E2A
expression,44 suggesting that E2A products can
act as tumor suppressors. E2A / mice
demonstrate a switch from adult to fetal-type TCR![]() lymphocytes and
TCRG and TCRD rearrangements.45 E2A
does not appear to modulate germline transcription of TCRG
but may target the recombinase to specific recognition signal sequences
(RSSs) since consensus E2A-binding motifs were identified in the linker
sequences of almost all murine V and V
RSSs.45
Cytogenetically, the majority (approximately 75%)46 of t(1;19) are unbalanced, being associated with loss of the der(1) and potential PBX1-E2A reciprocal transcripts and duplication of the normal chromosome 1.47 Consequently, only E2A-PBX1 has been considered to be oncogenic, strengthened by the fact that PBX1-E2A transcripts have not been seen in t(1;19) cell lines or patient material,48,49 as confirmed here. Against this, however, is the observation that patients with the unbalanced form have a relatively good prognosis,47 suggesting that something on the der(1) may add oncogenic potential. This difference was, however, only seen as a trend by Pui et al.50 E2A-PBX1 leads in all cases to haploinsufficiency.
E2A+/ Infant ALLs The basis for the virtual absence of TCRG rearrangements in infants aged 1 to 2 years is unclear but is not due to MLL-AF4 rearrangement or immunophenotypic immaturity. The change from an infant TCRG profile to a pediatric one occurs abruptly at the onset of the peak of childhood ALL. It suggests that infant ALLs without MLL rearrangement represent a distinct subtype of ALL rather than the lower end of the spectrum of pediatric-type BCP-ALLs.TEL-AML1 and BCR-ABL BCP-ALLs are similar TEL-AML1 and BCR-ABL ALLs showed similar phenotypic and genotypic features. The only immunophenotypic difference observed was more frequent cIgµ expression in BCR-ABL cases, suggesting relative maturity. In contrast, TEL-AML1 cases essentially demonstrated end-stage V fI-J 1/2 rearrangements,
whereas immature V 9 and J P1/2 rearrangements were relatively
common in BCR-ABL cases. These data suggest that, despite
the striking differences in demographic and prognostic features,
BCR-ABL and TEL-AML1 ALLs are arrested at a
similar stage of development with pronounced phenotypic and genotypic
lineage infidelity or promiscuity. The recent demonstration that loss
of PAX5 expression uncovers multilineage potential in pro-B-lymphoid cells, including myeloid and T-lymphoid development under appropriate condition,52,53 suggests that assessment of PAX5 status may be interesting in these
BCP-ALLs.
Practical significance From a practical point of view, the variable incidences of TCRG and TCRD rearrangements observed in BCP-ALLs of different ages and genotypes suggest that the relative representation of the different subgroups identified here should be taken into account when these rearrangements are used as universal markers for molecular follow-up. As an example, use of TCRG will lead to underrepresentation of E2A-PBX1, MLL-AF4, and infant cases, and use of TCRD V 2-D 3 to underrepresentation of older children. The use of
certain V -J combinations will exacerbate this. Obviously this
tendency will be minimized by the use of several IG/TCR
targets per patient, as is widely recommended in order to reduce the
risk of false negative results. Based on this series, only 3 of 160 (fewer than 2%) patients failed to demonstrate at least 1 PCR-amplifiable IGH, TCRG, or TCRD
rearrangement. It is likely that the wide applicability of these
markers, along with recent encouraging data with regard to their
predictive value in childhood ALL,12,13 will lead to their
increasing use in the management of BCP-ALL. Our data suggest that
results using these markers should be interpreted in the light of
accurate genotyping at diagnosis.
The authors thank Judith Landmann-Parker (Hôpital Trousseau, Paris), Marie-Helene Estienne (Tours), Laure Croisille (Hôpital Kremlin-Bicêtre, Paris), C. Bayle (Institut Gustave-Roussy, Villejuif), Xavier Troussard (Caen), Alain Bourguignat (Centre René-Huguenin, Saint-Cloud), André Barruchel and Marie-Françoise Auclerc (Hôpital St. Louis), and Françoise Picard (Hôpital Cochin, Paris) for providing BCP-ALL samples and clinical data.
Submitted January 19, 2000; accepted May 18, 2000.
Supported by the Fondation de France/Fondation Contre la Leucémie, the Fondation pour la Recherche Médicale, the Ligue Nationale contre le Cancer (Comité de Paris), the Association pour la Recherche sur le Cancer, and the Direction de Recherche Clinique de L'Assistance Publique-Hôpitaux de Paris (PHRC 97-106).
C.B. and E.D. contributed equally to this manuscript.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Elizabeth A. Macintyre, Laboratoire d'Hématologie, Tour Pasteur, Hôpital Necker, 149-161, rue de Sèvres, 75743 Paris cedex 15, France; e-mail: elizabeth.macintyre{at}nck.ap-hop-paris.fr.
1. Pui CH, Kane JR, Crist WM. Biology and treatment of infant leukemias. Leukemia. 1995;9:762-769[Medline] [Order article via Infotrieve]. 2. Johansson B, Moorman AV, Secker-Walker LM. Derivative chromosomes of 11q23-translocations in hematologic malignancies: European 11q23 Workshop participants. Leukemia. 1998;12:828-833[Medline] [Order article via Infotrieve].
3.
Faderl S, Kantarjian HM, Talpaz M, Estrov Z.
Clinical significance of cytogenetic abnormalities in adult acute lymphoblastic leukemia.
Blood.
1998;91:3995-4019 4. Raynaud S, Mauvieux L, Cayuela JM, et al. TEL/AML1 fusion gene is a rare event in adult acute lymphoblastic leukemia. Leukemia. 1996;10:1529-1530[Medline] [Order article via Infotrieve]. 5. Zuna J, Hrusak O, Kalinova M, Muzikova K, Stary J, Trka J. TEL/AML1 positivity in childhood ALL: average or better prognosis? Czech Paediatric Haematology Working Group. Leukemia. 1999;13:22-24[Medline] [Order article via Infotrieve].
6.
Hunger SP.
Chromosomal translocations involving the E2A gene in acute lymphoblastic leukemia: clinical features and molecular pathogenesis.
Blood.
1996;87:1211-1224 7. Langerak AW, Wolvers-Tettero ILM, van Dongen JJM. Immunoglobulin and T-cell receptor gene analysis in the diagnosis of lymphoid malignancies. Rev Clin Exp Hematol. 1997;3:3-27. 8. Aubin J, Davi F, Nguyen-Salomon F, et al. Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies for the detection of clonality in B cell malignancies. Leukemia. 1995;9:471-479[Medline] [Order article via Infotrieve]. 9. Davi F, Faili A, Gritti C, et al. Early onset of immunoglobulin heavy chain gene rearrangements in normal human bone marrow CD34+ cells. Blood. 1997;90:4014-4021 |