|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Departments of Hematology, University College
London Hospital, London, England; Heartlands Hospital, Birmingham,
England; Christie Hospital, Manchester, England; St George's Hospital,
London, England; Guy's Hospital, London, England; Queen Elizabeth
Hospital, Birmingham, England; Leeds General Infirmary, Leeds, England,
and Therapeutic Antibody Centre, University of Oxford, Oxford,
England.
A novel nonmyeloablative conditioning regimen was investigated in
44 patients with hematologic malignancies. The median patient age was
41 years. Many of the patients had high-risk features, including 19 patients with a previous failed transplant. Recipient conditioning
consisted of CAMPATH-1H, 20 mg/day on days High-dose chemoradiotherapy followed by allogeneic
stem cell transplantation (SCT) has been extensively used to treat
patients with hematologic malignancies. This procedure is often limited to patients in good medical condition because of the increased risk of
regimen-related toxicity and graft-versus-host disease (GVHD) that
occurs with increasing age and poor performance status.1,2 The curative potential of transplantation is not solely due to the
conditioning regimen but also to the well-documented
graft-versus-leukemia (GVL) effect.3 The most convincing
evidence for this GVL effect is that donor leukocyte infusions (DLIs)
can reinduce remissions in patients who have relapsed following
allogeneic SCT.4,5 Patients with chronic myeloid leukemia
are most likely to respond, but responses have also been documented in
patients with acute leukemia, chronic lymphocytic leukemia, myeloma,
and lymphoma.6,7
In an effort to reduce the transplant-related mortality (TRM)
associated with allogeneic SCT, low-intensity fludarabine-based regimens have been developed.8-11 These have been designed
to be immunosuppressive rather than myeloablative to facilitate donor engraftment and thereby limit systemic toxicity. There appears to be a
spectrum of hematopoietic toxicity associated with these nonmyeloablative regimens We have therefore developed a novel nonmyeloablative regimen for
allogeneic SCT. Our regimen was designed to suppress the recipient
immune system enough to allow allogeneic engraftment without excessive
regimen toxicity or GVHD. The use of fludarabine as an
immunosuppressant as part of the conditioning regimen was similar to
previously published studies of nonmyeloablative SCT.8-11 The combination of fludarabine with 180 mg/m2 of
melphalan was originally described by the M. D. Anderson
group.14 Our regimen used a different dose of melphalan,
140 mg/m2; however, the addition of in vivo CAMPATH-1H to
the conditioning regimen was new and appears to have been crucial in
limiting graft-versus-host reactions.
Eligibility criteria
Patient characteristics
Monoclonal antibody CAMPATH-1H is a humanized immunoglobulin (Ig) G1 monoclonal antibody against the CD52 antigen.15 It was prepared from the culture supernatant of Chinese hamster ovary cell transfectants cultured in a hollow fiber fermentor. It was purified by affinity chromatography on protein A-sepharose (Amersham Pharmacia Biotech, Little Chalfont, England) and size exclusion chromatography on Superdex 200 (Amersham Pharmacia Biotech) and formulated in phosphate-buffered saline. The half-life of CAMPATH-1H in humans is dependent on the amount of target CD52 antigen in the patient. Based on work in progress, there is persistence on CAMPATH-1H in vivo past day 0 sufficient to cause T-cell lysis by antibody-dependent cell-mediated cytotoxicity.Conditioning regimen Treatment consisted of the humanized monoclonal antibody CAMPATH-1H, 20 mg/day intravenous infusion over 8 hours on days 8 to
4; fludarabine, 30 mg/m2 intravenous infusion over 30 minutes on days 7 to 3; and melphalan, 140 mg/m2
intravenous infusion over 30 minutes on day 2. Thirty-six recipients received unmanipulated peripheral blood stem cells (PBSCs) from their
siblings, and 8 received unmanipulated marrow from matched unrelated donors.
Stem cell and bone marrow collection Sibling donors received granulocyte colony-stimulating factor (G-CSF) at 10 µg/kg subcutaneously once daily on days4 to 0. Leukaphereses were performed on days 0 and +1 using conventional techniques for PBSC collection. Unrelated donors had bone marrow collected on day 0 under general anesthesia using conventional techniques. In 2 sibling donors, we failed to collect more than 2 × 106/kg CD34+ cells from G-CSF-mobilized
peripheral blood, and therefore bone marrow was also harvested. The
total number of CD34+ cells collected from peripheral blood
and the number of mononuclear cells collected from the bone marrow are
shown in Table 1. Unmanipulated mobilized peripheral blood or bone
marrow was infused through central venous catheters on days 0 and +1
and on day 0, respectively.
Supportive care Patients were managed in reverse isolation in conventional or laminar airflow rooms. All patients received prophylaxis with cotrimoxazole or pentamidine against Pneumocystis carinii infection. Acyclovir and fluconazole or itraconazole prophylaxis were routinely used. Blood products were irradiated to 25 Gy. Red cell and platelet transfusions were given to maintain hemoglobin levels above 9 g/dL and platelet count above 10 to 15 × 109/L. The cytomegalovirus (CMV)-seronegative patients received only CMV-negative blood products; seropositive patients received CMV-unscreened blood products. Febrile neutropenic patients received broad-spectrum intravenous antibiotics according to each hospital's policy for the management of neutropenic sepsis. G-CSF at 5 µg/kg per day was administered subcutaneously at the discretion of the transplant physician to speed hematologic recovery in 38 patients until the patient's absolute neutrophil count was at least 1000/µL for 3 consecutive days (Table 2).
GVHD prophylaxis and grading GVHD prophylaxis consisted of cyclosporine A (CsA), 3 mg/kg starting on day1, and methotrexate (MTX) at a dose of 10 mg/m2 on days +1, +3, and +6 for 6 sibling recipients, and
it consisted of CsA alone for the other 38 patients. Intravenous CsA
was switched to an oral dose as soon as the patients would tolerate
medications by mouth and was continued for a median of 4 months (range,
1 to 8 months). Patients who survived 100 days or longer were evaluable for chronic GVHD. Acute and chronic GVHD were graded according to the
consensus criteria.16
Follow-up Patients had regular follow-up at 3 monthly intervals post-transplantation to assess disease response and remission status. These evaluations varied depending on the underlying diagnosis but included bone marrow aspirates or biopsies, cytogenetics, computed tomography scans, paraprotein levels, and skeletal surveys.Chimerism analysis DNA was prepared from pretransplantation recipient blood and donor blood. Following transplantation, either buffy coat or granulocyte T-cell and B-cell preparations were obtained from peripheral blood as previously described.17 We used 4 different primer sets each flanking highly polymorphic short tandem repeat units on different human chromosomes. With primers VWA31 (Perkin-Elmer) and THO1 (Perkin-Elmer), polymerase chain reaction (PCR) volumes were 50 µL containing Genamp PCR buffer II (Perkin-Elmer), 1.5-mmol/L MgCl, 0.2 mmol/L of each deoxyribonucleoside triphosphate (dNTP), 1 mmol/L of each primer, 0.5 U of AmpliTaq DNA polymerase (Perkin-Elmer, Foster City, CA), and 5 µL of DNA. Cycling conditions were 95°C for 45 seconds, 54°C for 30 seconds, and 72°C for 1 minute for 30 cycles. With primers ACPP (forward: ACTGTGCCTAGCCTATACTT, backward: AGTGAGCCAAGAGTGCACTA) and HUMSTRX1 (forward: CTCCTTGTGGCCTTCCTTAAATGG, backward: CTTCTCCAGCACCCAAGGAAGTCA), PCR volumes were 50 µL containing VNTR buffer (45-mmol/L Tris-HCl, 11-mmol/L NH4SO4, 6.7-mmol/L 2-mercaptoethanol, 4.5-µmol/L ethylenediaminetetraacetic acid, 110-µg/mL bovine serum albumin), 5 mmol/L of each dNTP, 1 mmol/L of each primer, 0.5 U of AmpliTaq polymerase (Perkin-Elmer), and 5 µL of DNA. Cycling conditions were 95°C for 30 seconds, 58°C for 30 seconds, and 95°C for 30 seconds for 30 cycles. The forward primer of each pair was labeled with either JOE or FAM fluorescent dyes. One microliter of PCR product was denatured in 12 µL of formamide and electrophoresed through Performance Optimized Polymer 4 (Perkin-Elmer) on an ABI 110 automated sequencer (Perkin-Elmer) in the presence of Rox 500 size standard (Perkin-Elmer). Genescan software 2.1 (Perkin-Elmer) was used to analyze the data. Primers that gave rise to recipient/donor-specific peaks were identified and used for post-transplantation determination of chimeric status in the various cell populations.Study endpoints The primary study endpoint was the successful durable hemopoietic engraftment and TRM. There were secondary endpoints, including regimen-related toxicity, incidence and severity of GVHD, and progression-free survival.Statistical methods Actuarial curves were estimated according to the Kaplan-Meier method. Surviving patients were censored on the last day of follow-up. The significance of differences between the curves was estimated by the log-rank test. Cox multivariate regression analysis was performed to calculate the independent effects of various risk factors influencing nonrelapse mortality, overall survival, and disease-free survival. The proportional hazards assumption was tested using a time-dependent covariant approach.
Toxicities All patients were assessable for toxicity. The conditioning regimen was generally well tolerated in patients who only received CsA as GVHD prophylaxis. The use of MTX in addition to CsA was associated with severe mucositis and delayed engraftment (Table 2). The original intention was to give MTX to all patients, but its use was abandoned because of toxicity. There were no cases of veno-occlusive disease. Four patients died of regimen-related toxicity. One patient died on day +21 of gram-negative septicemia while still aplastic. The second patient died on day +24 of idiopathic pneumonitis after engrafting on day +14. The third patient died of MRSA pneumonia on day +153. The fourth patient with myeloma, whose creatinine clearance prior to transplantation was 23 mL/min, died of renal failure on day +148.Engraftment One patient was not evaluable for engraftment because of early death on day +21. Of the 43 patients eligible for assessment of engraftment, 42 had sustained engraftment as defined by neutrophil counts above 0.5 × 109/L and an untransfused platelet count of above 20 × 109/L for at least 3 consecutive days. Details of the neutrophil and platelet reconstitution are shown in Table 2. The median time to recover an absolute neutrophil count of 0.5 × 109/L was 13 days (range, 8-23 days) and of 1.0 × 109/L was 17 days (range, 8-47 days). The median time to achieve platelets above 20 × 109/L was 13 days (range, 3-96 days) and above 50 × 109/L was 17 days (range, 8-118 days). Patient No. 7 developed graft rejection. After initial engraftment on day +11, the patient became cytopenic on day +20 and reconstituted recipient hemopoiesis on day +31 without autologous stem cell support.Chimerism Thirty-one patients had chimerism studies performed using microsatellite PCR or fluorescent in situ hybridization for X and Y chromosomes on peripheral blood. Detailed results are shown in Table 3. Patient No. 7, who rejected his graft, had only recipient myeloid and lymphoid cells present. Of the other 30 patients, 18 had only donor cells present. Of the 12 patients with mixed chimerism, 5 had detailed lineage-specific studies performed using microsatellite PCR. Three of these patients were full-donor chimeras in the myeloid and B-cell lineages but were mixed T-cell chimeras. Two patients were mixed chimeras in all lineages tested (Figure 1). Six of the 8 unrelated recipients had chimerism studies performed, and all 6 were found to have only donor cells present following transplantation (Table 3). Two patients (Nos. 1 and 11) who were mixed chimeras post-transplantation became full-donor chimeras following DLI therapy.
Graft-versus-host disease No grade III-IV acute GVHD was observed post-transplantation. Three patients developed grade I skin, 1 patient grade II gastrointestinal, and 1 patient grade II skin and gastrointestinal (Table 2) acute GVHD. Only 1 patient has developed chronic GVHD, limited to skin and liver involvement. Two patients developed GVHD following DLI to treat relapse of disease. One of these patients had steroid-resistant grade IV acute GVHD, and the other had limited chronic GVHD.Disease response and relapses Current disease status is shown in detail in Table 2. The conditioning regimen induced remissions in 2 of 2 patients with refractory AML and 2 of 2 evaluable patients with myelodysplasia. Of the 6 patients with Hodgkin disease in partial remission or with refractory disease at transplantation, 2 achieved a complete remission (CR) following transplantation, and 4 are progression-free. Seven patients with NHL in partial remission or with refractory disease prior to transplantation were evaluable for disease response (Table 2). Two of these patients achieved a CR, and 3 remain progression-free; however, 2 patients with transformed low-grade NHL had early post-transplantation disease progression (Table 2). None of the 6 patients with myeloma achieved a CR following the transplantation procedure alone, although patient No. 11 achieved a CR following post-transplantation DLI.Seven patients relapsed or progressed following transplantation (Table 2). Patient No. 1, with mantle cell lymphoma, relapsed 9 months post-transplantation and was treated with DLI. He died 11 months post-transplantation with steroid-resistant grade IV GVHD. Patient No. 12, with relapsed AML, progressed 3 months post-transplantation and was treated with DLI but died 3 months later of disease progression. Patient No. 13, with refractory AML, relapsed 6 months post-transplantation, was treated with DLI, and achieved transient remission but relapsed and died 14 months post-transplantation. Patient No. 14, with Hodgkin disease, relapsed 15 months post-transplantation and was treated with DLI and has not yet responded to this therapy. Patient No. 25, with refractory transformed low-grade NHL, progressed shortly after engraftment and, despite DLI, died a month later. Another patient with transformed low-grade NHL, patient No. 35, progressed 3 months post-transplantation. Patient No. 43 had progression of myeloma following transplantation. Survival analyses The median follow-up of the patients is only 9 months. The Kaplan-Meier estimated probabilities of nonrelapse mortality, progression-free survival, and overall survival for all 44 patients are shown in Figure 2. The estimated probability of nonrelapse mortality at 12 months was 11% (95% confidence interval [CI], 4%-26%). The estimated probability of progression-free survival at 12 months was 71% (95% CI, 53.6%-84.2%). The estimated probability of overall survival at 12 months was 73.2% (95% CI, 44.3%-88.7%).
TRM remains a major obstacle to successful allogeneic SCT. The introduction of nonmyeloablative purine analogue conditioning regimens has facilitated allogeneic engraftment while limiting regimen-related mortality.8-11,13 Despite this, GVHD remains a significant cause of mortality and morbidity following nonmyeloablative conditioning. Previously published results reported using other nonmyeloablative conditioning regimens have shown a 38% to 60% incidence of grade II-IV acute GVHD.8-11,13 This was the primary cause of death in some patients. In our study, the incidence of GVHD was exceptionally low. No patients
had grade III-IV acute GVHD, and only 2 patients (5%) developed grade
II acute GVHD. The incidence of chronic GVHD was also low, with only 1 patient developing limited skin GVHD. While the incidence of
chronic GVHD cannot yet be fully assessed in some of the patients
because of relatively short follow-up, given the fact that only 1 patient has experienced this complication and that all but 3 of the
patients are off all immunosuppression, we anticipate a very low rate
of chronic GVHD. Because the use of post-transplantation CsA was
similar to other nonmyeloablative regimens, the differences in the
incidence and severity of GVHD may in part reflect the in vivo use of
the humanized monoclonal antibody CAMPATH-1H as part of the
conditioning regimen.18 This was administered to the
patients on days While our nonmyeloablative conditioning regimen facilitated engraftment in all but one of the evaluable patients, many of the patients were mixed chimeras. Some patients were mixed chimeras in all lineages tested, while others were only mixed chimeras in the T-cell lineage. It has been demonstrated that patients who are mixed chimeras may experience less GVHD than full-donor chimeras.19,20 On the other hand, mixed chimerism may diminish the potential benefit of the GVL effect seen in the allograft setting.21,22 While mixed chimeras can be converted to full-donor chimeras following DLI,5 this was not attempted as part of this pilot study. The primary end points of this study were to explore the incidence of durable engraftment and acute and chronic GVHD. DLIs were only given for overt relapse of disease and were not given prophylactically or pre-emptively because we wished to assess the impact of the conditioning regimen on disease control and relapse. In the present study, we were generally not able to show the benefit of DLI in the setting of post-transplantation relapse. DLIs were either ineffective or led to toxicity from GVHD in all but one of the patients treated. This is not surprising, because the response rate in relapsed AML is low and there are few data to show that DLIs are effective in inducing remissions in patients with aggressive lymphomas.23,24 Only a single patient with multiple myeloma has achieved CR following DLI therapy. The use of this conditioning regimen has been relatively safe in a group of patients that had many high-risk features: patients who had prior high-dose therapy, patients with renal or cardiac impairment, or patients with high-risk diagnoses for allogeneic SCT such as Hodgkin disease or multiple myeloma. Indeed, allogeneic transplantation using myeloablative conditioning following failed autologous transplantation has been associated with a treatment mortality ranging between 50% and 80%.25,26 Undoubtedly, such a high mortality rate may offset a potential for cure, and therefore conventional transplants have generally been avoided in such patients. In our study, 19 patients received a second transplant, and only 3 patients (17%) died of transplantation-related complications, demonstrating that this nonmyeloablative approach could be attempted if a second transplant has to be considered. While a conditioning regimen containing fludarabine and melphalan appears to have been active in tumor control, particularly in patients with Hodgkin disease and NHL, the follow-up period is still very limited and all patients remain at risk of relapse. In such a high-risk group of patients, any conditioning regimen is likely to be associated with a significant relapse risk, and therefore the survival curves shown in Figure 2 should be interpreted with caution. This is particularly so in some hematologic malignancies, such as acute leukemia, where the GVL effect of DLI for the treatment of relapse is of limited efficacy.23 However, the antitumor responses seen with the conditioning regimen might allow the use of DLI to be delayed until 6 to 12 months post-transplantation, when this intervention might be associated with less GVHD.5,27,28 In summary, our results show that our nonmyeloablative regimen facililitates allogeneic engraftment, with a low incidence of GVHD and TRM. The long-term antitumor activity of this regimen remains unknown; however, if used in combination with the prophylactic or pre-emptive use of DLI, prolonged remissions might be obtained in some types of hematologic malignancies.
We thank the staff members of the Therapeutic Antibody Centre, University of Oxford, for their contributions to the production of CAMPATH-1H antibody.
Submitted January 13, 2000; accepted June 8, 2000.
Supported by the United Kingdom Medical Research Council, Leukosite Inc, and the E.P. Abraham's Trust.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Stephen Mackinnon, Department of Hematology, University College Hospital, 98 Chenies Mews, London WC1E 6H, England; e-mail: s.mackinnon{at}ucl.ac.uk.
1.
Ringden O, Horowitz MM, Gale RP, et al.
Outcome after allogeneic bone marrow transplant for leukemia in older adults.
JAMA.
1993;270:57-60
2.
Klingemann HG, Storb R, Fefer A, et al.
Bone marrow transplantation in patients aged 45 years and older.
Blood.
1986;67:770-776 3. Weiden PL, Flournoy N, Thomas ED, et al. Antileukemic effect of graft-versus-host disease in recipients of allogeneic marrow grafts. N Engl J Med. 1979;300:1068-1073[Abstract].
4.
Kolb HJ, Mittermuller J, Clemm CH, et al.
Donor leukocyte transfusions for treatment of recurrent chronic myelogenous leukemia in marrow transplant patients.
Blood.
1990;76:2462-2465
5.
Mackinnon S, Papadopoulos EP, Carabasi MH, et al.
Adoptive immunotherapy evaluating escalating doses of donor leukocytes for relapse of chronic myeloid leukemia following bone marrow transplantation: separation of graft-versus-leukemia responses from graft-versus-host disease.
Blood.
1995;86:1261-1268 6. Bertz H, Burger JA, Kunzmann R, Mertelsmann R, Finke J. Adoptive immunotherapy for relapsed multiple myeloma after allogeneic bone marrow transplantation (BMT): evidence for a graft-versus-myeloma effect. Leukemia. 1997;11:281-283[Medline] [Order article via Infotrieve]. 7. Mandigers CM, Meijerink JP, Raemaekers JM, Schattenberg AV, Mensink EJ. Graft-versus-lymphoma effect of donor leucocyte infusion shown by real-time quantitative PCR analysis of t(14;18) [letter]. Lancet. 1998;352:1522-1523[Medline] [Order article via Infotrieve]. 8. Khouri IF, Keating M, Korbling M, et al. Transplant-lite: induction of graft-versus-malignancy using fludarabine-based nonablative chemotherapy and allogeneic blood progenitor-cell transplantation as treatment for lymphoid malignancies. J Clin Oncol. 1998;16:2817-2824[Abstract].
9.
Giralt S, Estey E, Albitar M, et al.
Engraftment of allogeneic hematopoietic progenitor cells with purine analog-containing chemotherapy: harnessing graft-versus-leukemia without myeloablative therapy.
Blood.
1997;89:4531-4536
10.
Slavin S, Nagler A, Naparstek E, et al.
Nonmyeloablative stem cell transplantation and cell therapy as an alternative to conventional bone marrow transplantation with lethal cytoreduction for the treatment of malignant and nonmalignant hematologic diseases.
Blood.
1998;91:756-763
11.
Childs R, Clave E, Contentin N, et al.
Engraftment kinetics after nonmyeloablative allogeneic peripheral blood stem cell transplantation: full donor T-cell chimerism precedes alloimmune responses.
Blood.
1999;94:3234-3241 12. Storb R, Yu C, Sandmaier BM, et al. Mixed hematopoietic chimerism after marrow allografts. Transplantation in the ambulatory care setting. Ann N Y Acad Sci. 1999;872:372-537[Medline] [Order article via Infotrieve]. 13. Giralt S, Weber D, Aleman A, et al. Non myeloablative conditioning with fludarabine/melphalan (FM) for patients with multiple myeloma (MM) [abstract]. Blood. 1999;94(suppl 1):347. 14. Giralt S, Cohen A, Mehra R, et al. Preliminary results of fludarabine/melphalan or 2CDA/melphalan as preparative regimens for allogeneic progenitor cell transplantation in poor candidates for conventional myeloablative conditioning [abstract]. Blood. 1997;90(suppl 1):417. 15. Riechmann L, Clark M, Waldmann H, Winter G. Reshaping human antibodies for therapy. Nature. 1988;332:323-327[Medline] [Order article via Infotrieve]. 16. Przepiorka D, Weisdorf D, Martin P, et al. 1994 Consensus Conference on Acute GVHD Grading. Bone Marrow Transplant. 1995;15:825-828[Medline] [Order article via Infotrieve].
17.
Mackinnon S, Barnett L, Bourhis JH, Black P, Heller G, O'Reilly RJ.
Myeloid and lymphoid chimerism following T-cell depleted bone marrow transplantation: evaluation of conditioning regimens using the polymerase chain reaction to amplify human minisatellite regions of genomic DNA.
Blood.
1992;80:3235-3241 18. Hale G, Waldmann H. Recent results using CAMPATH-1 antibodies to control GVHD and graft rejection. Bone Marrow Transplant. 1996;17:305-308[Medline] [Order article via Infotrieve].
19.
Hill RS, Petersen FB, Storb R, et al.
Mixed hematologic chimerism after allogeneic marrow transplantation for severe aplastic anemia is associated with a higher risk of graft rejection and a lessened incidence of acute graft-versus-host disease.
Blood.
1986;67:811-816 20. Frassoni F, Strada P, Sessarego M, et al. Mixed chimerism after allogeneic marrow transplantation for leukaemia: correlation with dose of total body irradiation and graft-versus-host disease. Bone Marrow Transplant. 1990;5:235-240[Medline] [Order article via Infotrieve]. 21. Min GL, Hibbin J, Arthur C, Apperley J, Jeffreys A, Goldman J. Use of minisatellite DNA probes for recognition and characterization of relapse after allogenic bone marrow transplantation. Br J Haematol. 1988;68:195-201[Medline] [Order article via Infotrieve].
22.
Mackinnon S, Barnett L, Heller G, O'Reilly RJ.
Minimal residual disease is more common in patients who have mixed T-cell chimerism after bone marrow transpantation for chronic myelogenous leukemia.
Blood.
1994;83:3409-3416 23. Kolb HJ. Donor leukocyte transfusions for treatment of leukemic relapse after bone marrow transplantation. EBMT Immunology and Chronic Leukemia Working Parties. Vox Sang. 1998;74(suppl 2):321-329. 24. Sykes M, Preffer F, McAfee S, et al. Mixed lymphohaemopoietic chimerism and graft-versus-lymphoma effects after non-myeloablative therapy and HLA-mismatched bone marrow transplantation. Lancet. 1999;353:1755-1759[Medline] [Order article via Infotrieve]. 25. Tsai T, Goodman S, Saez R, et al. Allogeneic bone marrow transplantation in patients who relapse after autologous transplantation. Bone Marrow Transplant. 1997;20:859-863[Medline] [Order article via Infotrieve]. 26. Ringden O, Labopin M, Frassoni F, et al. Allogeneic bone marrow transplant or second autograft in patients with acute leukemia who relapse after an autograft. Acute Leukaemia Working Party of the European Group for Blood and Marrow Transplantation (EBMT). Bone Marrow Transplant. 1999;24:389-396[Medline] [Order article via Infotrieve].
27.
Slavin S, Naparstek E, Nagler A, et al.
Allogeneic cell therapy with donor peripheral blood cells and recombinant human interleukin-2 to treat leukemia relapse after allogeneic bone marrow transplantation.
Blood.
1996;87:2195-2204
28.
Kernan NA, Collins NH, Juliano L, Cartagena T, Dupont B, O'Reilly RJ.
Clonable T lymphocytes in T-cell depleted bone marrow transplants correlate with development of graft-versus-host disease.
Blood.
1986;68:770-773
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  K. J. Thomson, E. C. Morris, A. Bloor, G. Cook, D. Milligan, A. Parker, F. Clark, L. Yung, D. C. Linch, R. Chakraverty, et al. Favorable Long-Term Survival After Reduced-Intensity Allogeneic Transplantation for Multiple-Relapse Aggressive Non-Hodgkin's Lymphoma J. Clin. Oncol., January 20, 2009; 27(3): 426 - 432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Ciceri, C. Bonini, S. Marktel, E. Zappone, P. Servida, M. Bernardi, A. Pescarollo, A. Bondanza, J. Peccatori, S. Rossini, et al. Antitumor effects of HSV-TK engineered donor lymphocytes after allogeneic stem-cell transplantation Blood, June 1, 2007; 109(11): 4698 - 4707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Rizzieri, L. P. Koh, G. D. Long, C. Gasparetto, K. M. Sullivan, M. Horwitz, J. Chute, C. Smith, J. Z. Gong, A. Lagoo, et al. Partially Matched, Nonmyeloablative Allogeneic Transplantation: Clinical Outcomes and Immune Reconstitution J. Clin. Oncol., February 20, 2007; 25(6): 690 - 697. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Meyer, C. M. Britten, D. Wehler, K. Bender, G. Hess, A. Konur, U. F. Hartwig, T. C. Wehler, A. J. Ullmann, C. Gentilini, et al. Prophylactic transfer of CD8-depleted donor lymphocytes after T-cell-depleted reduced-intensity transplantation Blood, January 1, 2007; 109(1): 374 - 382. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Zenz, M. Ritgen, P. Dreger, A. Krober, T. F. Barth, R. Schlenk, S. Bottcher, M. J. Hallek, M. Kneba, D. Bunjes, et al. Autologous graft-versus-host disease-like syndrome after an alemtuzumab-containing conditioning regimen and autologous stem cell transplantation for chronic lymphocytic leukemia Blood, September 15, 2006; 108(6): 2127 - 2130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Delgado, K. Thomson, N. Russell, J. Ewing, W. Stewart, G. Cook, S. Devereux, R. Lovell, R. Chopra, D. I. Marks, et al. Results of alemtuzumab-based reduced-intensity allogeneic transplantation for chronic lymphocytic leukemia: a British Society of Blood and Marrow Transplantation Study Blood, February 15, 2006; 107(4): 1724 - 1730. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Chalandon, S. Degermann, J. Villard, L. Arlettaz, L. Kaiser, S. Vischer, S. Walter, M. H. M. Heemskerk, R. A. W. van Lier, C. Helg, et al. Pretransplantation CMV-specific T cells protect recipients of T-cell-depleted grafts against CMV-related complications Blood, January 1, 2006; 107(1): 389 - 396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tauro, C. Craddock, K. Peggs, G. Begum, P. Mahendra, G. Cook, J. Marsh, D. Milligan, A. Goldstone, A. Hunter, et al. Allogeneic Stem-Cell Transplantation Using a Reduced-Intensity Conditioning Regimen Has the Capacity to Produce Durable Remissions and Long-Term Disease-Free Survival in Patients With High-Risk Acute Myeloid Leukemia and Myelodysplasia J. Clin. Oncol., December 20, 2005; 23(36): 9387 - 9393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Feigin Prospects for the Future of Child Health Through Research JAMA, September 21, 2005; 294(11): 1373 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Corradini, F. Zallio, J. Mariotti, L. Farina, M. Bregni, P. Valagussa, F. Ciceri, A. Bacigalupo, A. Dodero, M. Lucesole, et al. Effect of Age and Previous Autologous Transplantation on Nonrelapse Mortality and Survival in Patients Treated With Reduced-Intensity Conditioning and Allografting for Advanced Hematologic Malignancies J. Clin. Oncol., September 20, 2005; 23(27): 6690 - 6698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. van Besien, A. Artz, S. Smith, D. Cao, S. Rich, L. Godley, D. Jones, P. Del Cerro, D. Bennett, B. Casey, et al. Fludarabine, Melphalan, and Alemtuzumab Conditioning in Adults With Standard-Risk Advanced Acute Myeloid Leukemia and Myelodysplastic Syndrome J. Clin. Oncol., August 20, 2005; 23(24): 5728 - 5738. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Crawley, M. Lalancette, R. Szydlo, M. Gilleece, K. Peggs, S. Mackinnon, G. Juliusson, L. Ahlberg, A. Nagler, A. Shimoni, et al. Outcomes for reduced-intensity allogeneic transplantation for multiple myeloma: an analysis of prognostic factors from the Chronic Leukaemia Working Party of the EBMT Blood, June 1, 2005; 105(11): 4532 - 4539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Rao, P. J. Amrolia, A. Jones, C. M. Cale, P. Naik, D. King, G. E. Davies, H. B. Gaspar, and P. A. Veys Improved survival after unrelated donor bone marrow transplantation in children with primary immunodeficiency using a reduced-intensity conditioning regimen Blood, January 15, 2005; 105(2): 879 - 885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Morris, K. Thomson, C. Craddock, P. Mahendra, D. Milligan, G. Cook, G. M. Smith, A. Parker, S. Schey, R. Chopra, et al. Outcomes after alemtuzumab-containing reduced-intensity allogeneic transplantation regimen for relapsed and refractory non-Hodgkin lymphoma Blood, December 15, 2004; 104(13): 3865 - 3871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kami, A. Makimoto, Y. Heike, and Y. Takaue Reduced-intensity Hematopoietic Stem Cell Transplantation (RIST) for Solid Malignancies Jpn. J. Clin. Oncol., December 1, 2004; 34(12): 707 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Carroll, D. BuchBarker, R. Schwartz, M. E. Agha, C. Tompkins, K. Baileys, K. O'Connell, A. D. Donnenberg, and A. M. Yeager Infection Is the Major Cause of Mortality after Nonmyeloablative Unrelated Bone Marrow Transplantation with Alemtuzumab, Fludarabine and Melphalan. Blood (ASH Annual Meeting Abstracts), November 16, 2004; 104(11): 5165 - 5165. [Abstract]
|
|
|
|
 |
|
 T. Iwasaki Recent Advances in the Treatment of Graft-Versus-Host Disease Clin. Med. Res., November 1, 2004; 2(4): 243 - 252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Baron, J. E. Baker, R. Storb, T. A. Gooley, B. M. Sandmaier, M. B. Maris, D. G. Maloney, S. Heimfeld, D. Oparin, E. Zellmer, et al. Kinetics of engraftment in patients with hematologic malignancies given allogeneic hematopoietic cell transplantation after nonmyeloablative conditioning Blood, October 15, 2004; 104(8): 2254 - 2262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Diaconescu, C. R. Flowers, B. Storer, M. L. Sorror, M. B. Maris, D. G. Maloney, B. M. Sandmaier, and R. Storb Morbidity and mortality with nonmyeloablative compared with myeloablative conditioning before hematopoietic cell transplantation from HLA-matched related donors Blood, September 1, 2004; 104(5): 1550 - 1558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Corradini, A. Dodero, F. Zallio, D. Caracciolo, M. Casini, M. Bregni, F. Narni, F. Patriarca, M. Boccadoro, F. Benedetti, et al. Graft-Versus-Lymphoma Effect in Relapsed Peripheral T-Cell Non-Hodgkin's Lymphomas After Reduced-Intensity Conditioning Followed by Allogeneic Transplantation of Hematopoietic Cells J. Clin. Oncol., June 1, 2004; 22(11): 2172 - 2176. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Y. Mapara and M. Sykes Tolerance and Cancer: Mechanisms of Tumor Evasion and Strategies for Breaking Tolerance J. Clin. Oncol., March 15, 2004; 22(6): 1136 - 1151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Peggs, K. Thomson, D. P. Hart, J. Geary, E. C. Morris, K. Yong, A. H. Goldstone, D. C. Linch, and S. Mackinnon Dose-escalated donor lymphocyte infusions following reduced intensity transplantation: toxicity, chimerism, and disease responses Blood, February 15, 2004; 103(4): 1548 - 1556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Carvallo, N. Geller, R. Kurlander, R. Srinivasan, O. Mena, T. Igarashi, L. M. Griffith, W. M. Linehan, and R. W. Childs Prior chemotherapy and allograft CD34+ dose impact donor engraftment following nonmyeloablative allogeneic stem cell transplantation in patients with solid tumors Blood, February 15, 2004; 103(4): 1560 - 1563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Thomson, S. Ings, M. Watts, S. Mackinnon, and K. S. Peggs CD34+ cell dose and the occurrence of GVHD in the presence of in vivo T-cell depletion Blood, January 15, 2004; 103(2): 743 - 743. [Full Text] [PDF]
|
|
|
|
|
|
R. D. Faulkner, C. Craddock, J. L. Byrne, P. Mahendra, A. P. Haynes, H. G. Prentice, M. Potter, A. Pagliuca, A. Ho, S. Devereux, et al. BEAM-alemtuzumab reduced-intensity allogeneic stem cell transplantation for lymphoproliferative diseases: GVHD, toxicity, and survival in 65 patients Blood, January 15, 2004; 103(2): 428 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Casper, W. Knauf, T. Kiefer, D. Wolff, B. Steiner, U. Hammer, R. Wegener, H.-D. Kleine, S. Wilhelm, A. Knopp, et al. Treosulfan and fludarabine: a new toxicity-reduced conditioning regimen for allogeneic hematopoietic stem cell transplantation Blood, January 15, 2004; 103(2): 725 - 731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Hogan, M. Maris, B. Storer, B. M. Sandmaier, D. G. Maloney, H. G. Schoch, A. E. Woolfrey, H. M. Shulman, R. Storb, and G. B. McDonald Hepatic injury after nonmyeloablative conditioning followed by allogeneic hematopoietic cell transplantation: a study of 193 patients Blood, January 1, 2004; 103(1): 78 - 84. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.C. Taussig, A.J. Davies, J.D. Cavenagh, H. Oakervee, D. Syndercombe-Court, S. Kelsey, J.A.L. Amess, A.Z.S. Rohatiner, T.A. Lister, and M.J. Barnett Durable Remissions of Myelodysplastic Syndrome and Acute Myeloid Leukemia After Reduced-Intensity Allografting J. Clin. Oncol., August 15, 2003; 21(16): 3060 - 3065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mohty, J.-O. Bay, C. Faucher, B. Choufi, K. Bilger, O. Tournilhac, N. Vey, A.-M. Stoppa, D. Coso, C. Chabannon, et al. Graft-versus-host disease following allogeneic transplantation from HLA-identical sibling with antithymocyte globulin-based reduced-intensity preparative regimen Blood, July 15, 2003; 102(2): 470 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Morris, P. Rebello, K. J. Thomson, K. S. Peggs, C. Kyriakou, A. H. Goldstone, S. Mackinnon, and G. Hale Pharmacokinetics of alemtuzumab used for in vivo and in vitro T-cell depletion in allogeneic transplantations: relevance for early adoptive immunotherapy and infectious complications Blood, July 1, 2003; 102(1): 404 - 406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G. Wulf, K.-L. Luo, M. A. Goodell, and M. K. Brenner Anti-CD45-mediated cytoreduction to facilitate allogeneic stem cell transplantation Blood, March 15, 2003; 101(6): 2434 - 2439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Ratzinger, J. L. Reagan, G. Heller, K. J. Busam, and J. W. Young Differential CD52 expression by distinct myeloid dendritic cell subsets: implications for alemtuzumab activity at the level of antigen presentation in allogeneic graft-host interactions in transplantation Blood, February 15, 2003; 101(4): 1422 - 1429. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Finke, C. Schmoor, H. Lang, K. Potthoff, and H. Bertz Matched and Mismatched Allogeneic Stem-Cell Transplantation From Unrelated Donors Using Combined Graft-Versus-Host Disease Prophylaxis Including Rabbit Anti-T Lymphocyte Globulin J. Clin. Oncol., February 1, 2003; 21(3): 506 - 513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Y. L. Ho, M. Kenyon, I. El-Hemaidi, S. Devereux, A. Pagliuca, and G. J. Mufti Reduced-intensity allogeneic hematopoietic stem cell transplantation with alemtuzumab conditioning regimens: survival does not plateau until after day 200 Blood, January 15, 2003; 101(2): 779 - 780. [Full Text] [PDF]
|
|
|
|
|
|
R. Or, M. Y. Shapira, I. Resnick, A. Amar, A. Ackerstein, S. Samuel, M. Aker, E. Naparstek, A. Nagler, and S. Slavin Nonmyeloablative allogeneic stem cell transplantation for the treatment of chronic myeloid leukemia in first chronic phase Blood, January 15, 2003; 101(2): 441 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Mufti, A. F. List, S. D. Gore, and A. Y.L. Ho Myelodysplastic Syndrome Hematology, January 1, 2003; 2003(1): 176 - 199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. I. Marks, R. Lush, J. Cavenagh, D. W. Milligan, S. Schey, A. Parker, F. J. Clark, L. Hunt, J. Yin, S. Fuller, et al. The toxicity and efficacy of donor lymphocyte infusions given after reduced-intensity conditioning allogeneic stem cell transplantation Blood, October 16, 2002; 100(9): 3108 - 3114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Perez-Simon, P. D. Kottaridis, R. Martino, C. Craddock, D. Caballero, R. Chopra, J. Garcia-Conde, D. W. Milligan, S. Schey, A. Urbano-Ispizua, et al. Nonmyeloablative transplantation with or without alemtuzumab: comparison between 2 prospective studies in patients with lymphoproliferative disorders Blood, October 16, 2002; 100(9): 3121 - 3127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Branson, R. Chopra, P. D. Kottaridis, G. McQuaker, A. Parker, S. Schey, R. K. Chakraverty, C. Craddock, D. W. Milligan, R. Pettengell, et al. Role of Nonmyeloablative Allogeneic Stem-Cell Transplantation After Failure of Autologous Transplantation in Patients With Lymphoproliferative Malignancies J. Clin. Oncol., October 1, 2002; 20(19): 4022 - 4031. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Martino, M. D. Caballero, J. A. Perez Simon, C. Canals, C. Solano, A. Urbano-Ispizua, J. Bargay, A. Leon, J. Sarra, G. F. Sanz, et al. Evidence for a graft-versus-leukemia effect after allogeneic peripheral blood stem cell transplantation with reduced-intensity conditioning in acute myelogenous leukemia and myelodysplastic syndromes Blood, August 28, 2002; 100(6): 2243 - 2245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. S. Buggins, G. J. Mufti, J. Salisbury, J. Codd, N. Westwood, M. Arno, K. Fishlock, A. Pagliuca, and S. Devereux Peripheral blood but not tissue dendritic cells express CD52 and are depleted by treatment with alemtuzumab Blood, August 13, 2002; 100(5): 1715 - 1720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chakrabarti, V. Mautner, H. Osman, K. E. Collingham, C. D. Fegan, P. E. Klapper, P. A. H. Moss, and D. W. Milligan Adenovirus infections following allogeneic stem cell transplantation: incidence and outcome in relation to graft manipulation, immunosuppression, and immune recovery Blood, August 13, 2002; 100(5): 1619 - 1627. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. R. Drobyski, R. Komorowski, B. Logan, and M. Gendelman Role of the Passive Apoptotic Pathway in Graft-Versus-Host Disease J. Immunol., August 1, 2002; 169(3): 1626 - 1633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hunault-Berger, N. Ifrah, and P. Solal-Celigny Intensive therapies in follicular non-Hodgkin lymphomas Blood, July 30, 2002; 100(4): 1141 - 1152. [Full Text] [PDF]
|
|
|
|
|
|
M. E. H. M. Van Hoef ; and S. Mackinnon Nonmyeloablative transplantation challenged by experimentation Blood, July 30, 2002; 100(4): 1508 - 1509. [Full Text] [PDF]
|
|
|
|
|
|
S. Chakrabarti, S. Mackinnon, R. Chopra, P. D. Kottaridis, K. Peggs, P. O'Gorman, R. Chakraverty, T. Marshall, H. Osman, P. Mahendra, et al. High incidence of cytomegalovirus infection after nonmyeloablative stem cell transplantation: potential role of Campath-1H in delaying immune reconstitution Blood, May 29, 2002; 99(12): 4357 - 4363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Peggs, E. C. Morris, P. D. Kottaridis, J. Geary, A. H. Goldstone, D. C. Linch, S. Mackinnon, C. D. Bolan, S. F. Leitman, L. M. Griffith, et al. Outcome of major ABO-incompatible nonmyeloablative hematopoietic stem cell transplantation may be influenced by conditioning regimen Blood, May 29, 2002; 99(12): 4642 - 4644. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Saito, Y. Kanda, M. Kami, K. Kato, N. Shoji, S. Kanai, T. Ohnishi, Y. Kawano, K. Nakai, T. Ogasawara, et al. Therapeutic Potential of a Reduced-Intensity Preparative Regimen for Allogeneic Transplantation with Cladribine, Busulfan, and Antithymocyte Globulin against Advanced/Refractory Acute Leukemia/Lymphoma Clin. Cancer Res., April 1, 2002; 8(4): 1014 - 1020. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Klangsinsirikul, G. I. Carter, J. L. Byrne, G. Hale, and N. H. Russell Campath-1G causes rapid depletion of circulating host dendritic cells (DCs) before allogeneic transplantation but does not delay donor DC reconstitution Blood, April 1, 2002; 99(7): 2586 - 2591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Chakraverty, K. Peggs, R. Chopra, D. W. Milligan, P. D. Kottaridis, S. Verfuerth, J. Geary, D. Thuraisundaram, K. Branson, S. Chakrabarti, et al. Limiting transplantation-related mortality following unrelated donor stem cell transplantation by using a nonmyeloablative conditioning regimen Blood, February 1, 2002; 99(3): 1071 - 1078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Maloney, B. M. Sandmaier, S. Mackinnon, and J. A. Shizuru Non-Myeloablative Transplantation Hematology, January 1, 2002; 2002(1): 392 - 421. [Abstract] [Full Text]
|
|
|
|
|
|
P. Corradini, C. Tarella, A. Olivieri, A. M. Gianni, C. Voena, F. Zallio, M. Ladetto, M. Falda, M. Lucesole, A. Dodero, et al. Reduced-intensity conditioning followed by allografting of hematopoietic cells can produce clinical and molecular remissions in patients with poor-risk hematologic malignancies Blood, January 1, 2002; 99(1): 75 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Dearden, E. Matutes, B. Cazin, G. E. Tjonnfjord, A. Parreira, B. Nomdedeu, P. Leoni, F. J. Clark, D. Radia, S. M. B. Rassam, et al. High remission rate in T-cell prolymphocytic leukemia with CAMPATH-1H Blood, September 15, 2001; 98(6): 1721 - 1726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bornhauser, C. Thiede, U. Platzbecker, A. Jenke, A. Helwig, R. Plettig, J. Freiberg-Richter, C. Rollig, G. Geissler, K. Lutterbeck, et al. Dose-reduced Conditioning and Allogeneic Hematopoietic Stem Cell Transplantation from Unrelated Donors in 42 Patients Clin. Cancer Res., August 1, 2001; 7(8): 2254 - 2262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. F. Storb, R. Champlin, S. R. Riddell, M. Murata, S. Bryant, and E. H. Warren Non-Myeloablative Transplants for Malignant Disease Hematology, January 1, 2001; 2001(1): 375 - 391. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
from minimally cytopenic regimens that use
low-dose total body irradiation alone
