|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
RED CELLS
From the Division of Integrated Life Science, Graduate
School of Biostudies, Kyoto University, Kyoto, Japan.
We have previously reported that expression of the
erythropoietin (Epo) gene in mouse embryonal cells was not induced by
hypoxia, although hypoxia induced other hypoxia-inducible genes. This
study identifies retinoic acid (RA) as an inducer for Epo production in
the embryonal carcinoma cell lines P19 and F9. RA induced Epo production through the transcriptional activation of the Epo gene in an
oxygen-independent manner. With the use of reporter assays in P19
cells, it is shown that a direct repeat of the nuclear hormone
receptor-binding motif separated by a 2-bp spacer (DR-2) in the
hypoxia-response enhancer was responsible for the transcriptional activation by RA. Electrophoretic mobility shift assays show that nuclear extracts from P19 cells contained RA receptor complexes that
bound to DR-2. In human hepatoma Hep3B cells, an orphan receptor, hepatocyte nuclear factor-4, strongly augmented hypoxic induction of
the Epo gene in cooperation with hypoxia-inducible factor-1 (HIF-1) by
binding to DR-2, whereas in P19 cells, the interaction of RA receptors
with DR-2 was sufficient for RA-induced transcriptional activation of
the Epo gene without the requirement of the HIF-1 site. These results
suggest that DR-2 regulates expression of the Epo gene by acting as the
binding site for different transcription factors in different types of cells.
(Blood. 2000;96:3265-3271) Erythropoietin (Epo) is the major physiologic
stimulator of red blood cell formation in mammals.1-4 The
main Epo production sites are the kidney in adults and the liver in
fetuses. In addition, at least 3 other sites (the
brain,5-10 uterus,11 and
oviduct12) have been shown to produce Epo, although the
levels are low compared with those in the kidney and liver. Brain Epo
acts on neurons,13-16 preventing their death from ischemic
insult.10,17,18 Uterine Epo is implicated in estrous
cycle-dependent angiogenesis,11 and the oviductal
function of Epo is not known.
Hypoxia is a signal that can stimulate Epo production
intensely.4 A number of genes have been shown to be
induced by hypoxia19; these include Epo,20,21
some glycolytic enzymes such as lactate dehydrogenase A
(LDHA),22,23 glucose transporter 1,24
vascular endothelial growth factor,25 nitric oxide (NO)
synthase,26 heme oxygenase 1,27
transferrin,28 and its receptor.29 Hypoxic induction of these proteins is mostly due to transcriptional
activation. The Epo gene possesses a 50-bp hypoxia-response enhancer
(3' enhancer) at 120 bp downstream of the polyA
signal.30-33 This 3' enhancer consists of 3 segments.34,35 The highly conserved sequence (5'RCGTG3')
near the 5' end of the 3' enhancer is a binding site for
hypoxia-inducible factor 1 (HIF-1), which is a transcriptional factor
essential for activation of the hypoxia-inducible
genes.35-38 Although the middle segment is not well
conserved in the mouse (5'CATGG3') and human (5'CACAG3') genes,
mutation of this region abolishes the responsiveness to
hypoxia.34-36 Thus far, the specific protein that binds to
this region has not been demonstrated. The third segment at the 3' end
of the 3' enhancer is a direct repeat (DR) of a hexanucleotide
consensus nuclear receptor-binding half-site (5'TGACCTCTTGACCC3')
separated by a 2-bp spacer (DR-2).34,35,39,40 Binding of
hepatocyte nuclear factor-4 (HNF-4), a member of the nuclear hormone
receptor superfamily, to this element dramatically increases the
hypoxic inducibility of the Epo gene in Hep3B cells.41
In addition to hypoxia, various substances have been shown to stimulate
Epo production. Insulin and insulin-like growth factors stimulate Epo
production by astrocytes.42 Nuclear receptor ligands such
as thyroid hormone and 17 There are 2 families of RA receptors, retinoic acid receptors (RARs)
and retinoid X receptors (RXRs).46,47 Ligand-induced homodimers or heterodimers of RAR and RXR control gene transcription by
binding to retinoic acid response elements (RAREs), DRs of nuclear
hormone receptor Cell culture and Epo production
Preparation of Luc reporter plasmids under the control of mouse
Epo promoter and 3' enhancer
Transient assay of reporter gene Plasmids were transfected into P19 cells or Hep3B cells as described previously.45 After transfection, the medium was replaced with fresh growth medium containing all-trans RA. The plate was incubated for another 20 hours in 21% or 2% oxygen. Assays of Luc and -galactosidase were performed as described
previously.45 Expression of the Luc gene was represented
as the ratio of Luc to -galactosidase.
Preparation of -galactosidase reporter plasmid (p4En0.2Z), in which the
-galactosidase gene was under the control of the human Epo promoter and the 3' enhancer (Figure 3B, bottom), was constructed as described previously.49 Briefly, 4 tandemly repeated
ApaI-PvuII fragments of human Epo 3' enhancer,
an ApaI-Eco52I fragment of human Epo promoter,
and -galactosidase gene from pCH110 were ligated and subcloned into
the SacI and PstI sites of pUC18.
Preparation of permanent clones harboring p4En0.2Z P19 cells were cotransfected with p4En0.2Z and pKSV10neo. Drug-resistant clones were screened in the presence of 400 µg/mL of G418. P19/Z cells were established with 2 rounds of cloning by limiting dilution. Hep3B/Z cells (F6D2 in the previous report) were established as described previously.49Staining of Protein extractions Nuclear extracts were prepared according to the method described by Andrews and Faller.50 Briefly, P19 cells (approximately 1 × 107/well) were scraped into 1.5 mL of cold PBS. The cells were pelleted and resuspended in 400 µL of cold buffer A (10 mmol/L HEPES-KOH, pH 7.9, 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.5 mmol/L dithiothreitol [DTT], and 0.2 mmol/L phenylmethylsulfonyl fluoride [PMSF]). The cells were allowed to swell on ice for 10 minutes and then were vortexed for 10 seconds. The samples were centrifuged and the supernatant was discarded. The pellet was resuspended in 200 µL of cold buffer C (20 mmol/L HEPES-KOH, pH 7.9, 25% glycerol, 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5 mmol/L DTT, and 0.2 mmol/L PMSF) and was incubated on ice for 20 minutes. Cellular debris was removed by centrifugation for 2 minutes at 4°C. The supernatant was used as a nuclear extract. For preparation of whole-cell extracts, pelleted cells were resuspended in whole-cell extract buffer (50 mmol/L Tris-HCl, pH 8.0, 450 mmol/L NaCl, 1% Triton X-100, and 0.2 mmol/L PMSF) and centrifuged. The supernatant was used as a whole-cell extract.Electrophoretic mobility shift assay Oligonucleotides containing the DR-2 element were used as probes and competitors. The sequence for wild-type DR-2 was 5'CCGGCTGACCTCTTGACCCCTCTGGGCTTG3' (DR-2 WT, where DR-2 is underlined) and that for mutant DR-2 was 5'CCGGCTGCAATCTTACCTCCTCTGGGCTTG3' (DR-2 MT, where mutations are underlined). These single-strand oligonucleotides were annealed with the complementary oligonucleotides, and the resulting double-strand fragments were end-labeled by filling in 5' overhangs with -[32P]dCTP (3000 Ci/mmol) using
Klenow fragment. DNA-protein binding reactions were carried out for 10 minutes at room temperature in a total volume of 10 µL containing 4 µg nuclear extract, 2.5 µg poly(dI-dC), and 1 × 105
cpm of radiolabeled probe in binding buffer (20 mmol/L HEPES-KOH, pH
7.6, 4% type-400 Ficoll, 40 mmol/L NaCl, 1 mmol/L MgCl2,
and 0.5 mmol/L DTT). The products were analyzed by electrophoresis in
4% nondenaturing polyacrylamide gels. Electrophoresis was performed at
80 V in 0.25 × TBE (1 × TBE is 89 mmol/L Tris, 89 mmol/L boric acid, and 2.5 mmol/L EDTA) buffer at 4°C, and the dried gels were autoradiographed. For competition experiments, we added a 100-fold molar excess of an unlabeled probe to the binding reaction before addition of a labeled probe. In supershift analysis, 4 µg of antibody was incubated with a nuclear extract in PBS for 1 hour at 4°C before
the binding reaction was done. Antibodies to RAR (sc-551X) and
RXR (sc-831X) were obtained from Santa Cruz Biotechnology (Santa
Cruz, CA). In the experiments to examine the binding of HIF-1 with
HIF-1 probes, electrophoretic mobility shift assay (EMSA) was performed
in the same way except that nuclear extracts were prepared from P19
cells cultured for 5 hours in 2% or 21% oxygen. The oligonucleotide
sequence for the wild-type HIF-1 site was
5'gatcGCCCTACGTGCTGCCTCGCATG3' (HIF-1 WT, where the HIF-1 site is underlined) and that for the mutant HIF-1 site was
5'gatcGCCCTAAAAGCTGCCTCGCATG3' (HIF-1 MT, where mutations
are underlined).
Immunoblot analysis Protein extracts (15 µg) were subjected to electrophoresis through 6% sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred to PVDF membrane (Pall Corporation, NY). The membrane was blocked with Block Ace (Dainippon Pharmaceutical Co, Ltd, Osaka, Japan) and incubated with an anti-HIF-1 antibody (Novus Biologicals, Littleton, CO) at a 1:750 dilution in PBS-T (PBS and 0.5%
Tween-20) containing 10% Block Ace. Horseradish peroxidase-conjugated anti-mouse IgG (Amersham Pharmacia Biotech, Piscataway, NJ) was used
as a secondary antibody at a 1:3000 dilution, and Super Signal Chemiluminescent Substrate (Pierce, Rockford, IL) was used for detection.
Stimulation of Epo production in the EC cells by RA EC cell lines (P19 and F9) cultured under normoxia produce more Epo than Hep3B cells, which is the hepatoma cell line that produces Epo by responding to hypoxia.45 The production in these EC cell lines, however, is not induced by hypoxia.45 To find an inducer of the expression of the Epo gene in EC cells, we examined the effects of a number of nuclear receptor ligands on Epo production in these cells. Epo production was induced up to 4-fold in P19 cells only when cultured with all-trans RA or 9-cis RA (Figure 1A). Both RAs also induced Epo production in F9 cells, and the stimulation degree was similar to that of P19 cells (data not shown). In contrast, only a slight stimulation of Epo production (approximately 1.1- to 1.3-fold) by RAs was observed in Hep3B cells (data not shown). No other ligands tested (10 6 to 108 mol/L) stimulated Epo
production either in P19 cells (Figure 1A) or in F9 cells or Hep3B
cells (data not shown). Aggregate culture of P19 cells has been used as
a model system for studying early mammalian development; the P19 cells
differentiate into neurons and astrocytes in addition to relatively
small numbers of fibroblast-like cells.51 As shown in
Figure 1B, all-trans RA stimulated Epo production in P19
cells cultured as a monolayer and as aggregates in a dose-dependent
manner, but the degree of stimulation was significantly higher in
aggregates than in monolayer cells.
Correlation between Epo production and Epo mRNA, and the effect of oxygen To determine whether the RA-induced stimulation of Epo production operates at the level of its mRNA, we extracted the total RNA from P19 cells cultured with different concentrations of all-trans RA under normoxia (21% oxygen) or hypoxia (2% oxygen) and measured Epo mRNA in the total RNA by using real-time polymerase chain reaction (PCR). Both the production of Epo and the level of its mRNA were increased by RA in a dose-dependent manner, and the RA-induced increase in Epo production closely paralleled that in mRNA (compare Figure 2A and 2B). Moreover, the RA-induced increase in Epo mRNA was inhibited by actinomycin D (data not shown). These results suggest that the RA-induced production of Epo is caused by transcriptional activation of the Epo gene. In contrast, the oxygen concentration altered neither the induction of Epo production nor the level of Epo mRNA in the presence of RA, indicating that the hypoxia inducibility of the Epo gene in P19 cells is not restored by RA treatment.
DR-2 in the 3' enhancer is responsible for the Epo gene to respond to RA RAREs consist of the direct repetition of 2 core motifs or closely related degenerate motifs with a variable length of nucleotide spaces. A survey of the regions conserved between the mouse and human Epo genes showed that 2 potential RAREs (DR-4 and DR-10) exist in the promoter region (a 32-bp segment located 82 bp upstream of the transcription start site; the upper sequence in Figure 3A). The other potential site found is DR-2 (HNF-4 binding site) in the 3' enhancer (the lower sequence in Figure 3A). To test which site is responsible for the Epo induction by RA, we constructed the plasmids harboring the Luc reporter gene interposed between the mouse 120-bp promoter (mP) and the mouse Epo 3' enhancer (mE) with the wild-type sequences or its mutated sequences (Figure 3B, top). The mutated position either in potential RAREs in the promoter region (m1, m2, and m3) or in the 3' enhancer is shown in Figure 3A as a circle or a triangle (Table 1). These plasmids were transfected into P19 cells as a monolayer culture with pactgal to normalize transfection efficiency. After the
transfected cells were incubated under normoxia with or without
all-trans RA, the activities of Luc and -galactosidase in
cell lysates were assayed. As shown in Figure
4, P19 cells transfected with the plasmid
containing the wild-type 3' enhancer yielded 2.5-fold RA induction,
whereas no RA induction was seen in the cells transfected with the
plasmid containing the DR-2-deleted 3' enhancer (Figure 4A). Deletion of the half-site in DR-2 abolished the RA inducibility in P19 cells.
Mutations in the promoter did not change its activity (pMut) or the RA
inducibility (pMut-WT). Thus, in P19 cells, DR-2 in the 3' enhancer is
indispensable for the transcriptional activation of the Epo gene in
response to RA, whereas the potential RAREs in the promoter region are
not required. When Hep3B cells were used, however, no RA inducibility
was observed with any reporters (Figure 4B), which is in agreement with
the results reported previously.39
We also examined RA-induced stimulation of Epo in aggregate cultures.
We used human 0.2-kb promoter (hP) and human Epo 3' enhancer (hE) in
this setting and established permanent P19 cell lines (P19/Z) with the
We next performed EMSAs to investigate whether the DR-2 element
interacts with RA receptors in P19 cells. The DR-2 oligonucleotide probe bound to several proteins from the P19 nuclear extract (Figure 5). Competition experiments with a pair
of nonradiolabeled wild-type or mutant oligonucleotides showed that at
least 3 specific protein-DNA complexes were formed. Both RA receptors,
RAR and RXR, have 3 subtypes (
Two segments, HIF-1 site and CATGG segment, in the 3' enhancer are not required for the Epo gene to respond to RA As described earlier, 3 segments the HIF-1 site, the CATGG
segment, and the DR-2 elementin the 3' enhancer are required for the
full hypoxic induction of Epo gene transcription.34-36
This raises the possibility that in addition to the DR-2 element, the former 2 segments might also be important for the Epo gene to respond
to RA. First, we examined whether P19 cells possess intact HIF-1
under hypoxic conditions by Western blot analysis. Whole-cell and
nuclear extracts were prepared from P19 cells cultured in different
oxygen concentrations. Hypoxia (2% and 5%) significantly increased
HIF-1 protein in both the whole cell and the nucleus (Figure
6A). Moreover, we confirmed that nuclear
components derived from P19 cells cultured under hypoxia bound to the
HIF-1 oligonucleotide probe but not to the mutant probe (data not
shown). Second, we investigated the effects of mutations in the HIF-1
and CATGG segments on RA inducibility of the reporter gene. Each
reporter plasmid containing the mutation in each site was constructed
(Figure 3A, bottom) and transfected into P19 cells. Transfected cells
were incubated with or without all-trans RA and also under
normoxia or hypoxia to determine the effect of oxygen on RA
inducibility. As shown in Figure 6B, neither the mutation in the HIF-1
binding site (pWT-mut HIF) nor the mutation in the CATGG segment
(pWT-mut CATGG) affected the RA inducibility (3-fold), which was
similar to that with the wild-type 3' enhancer. The RA inducibility of the reporter gene expression was not influenced by oxygen
concentration, which is consistent with the result that RA-induced
accumulation of Epo mRNA is oxygen independent (Figure 2B). Thus, the 2 segments, HIF-1 and CATGG segment, in the 3' enhancer do not work
cooperatively with the DR-2 element for the RA induction of Epo gene
expression in P19 cells.
The 3' enhancer responsible for the hypoxia-induced transcriptional activation of the Epo gene consists of 3 critical segments: the HIF-1 binding site, a middle segment with a function yet to be identified, and DR-2.34-36 Interaction of DR-2 with HNF-4 provides a marked hypoxia inducibility of Epo gene expression.41 One of the coactivators of gene transcription, p300/CBP,54-56 has been shown to interact with HIF-1 and HNF-4.57-59 Direct interaction between HIF-1 and HNF-4 may also be important for the hypoxic stimulation.60 These interactions are thought to form a complex on the 3' enhancer for manifesting the full hypoxic inducibility, using p300/CBP as a scaffold.57-61 We previously showed that mouse ES and EC cells produced Epo, but their production did not respond to oxygen concentrations in cultures.45 The current study has extended this finding to understand the regulation of Epo production in embryonic cells. RA stimulated Epo production by P19 and F9 cells. The stimulation of Epo production correlated well with the accumulation of Epo mRNA, and actinomycin D inhibited the stimulatory effect of RA. EMSA demonstrated that nuclear extracts from P19 cells contained RAR and RXR that bound to DR-2. Thus, the RA-induced stimulation of Epo production in P19 cells is probably caused by transcriptional activation through binding of RA receptors to the DR-2 element in the 3' enhancer. The requirement of p300/CBP for the transcriptional activation of target genes by RA has been amply documented.54 Reporter assays in P19 cells suggest that the HIF-1 binding site and CATGG segment in the 3' enhancer are not required for RA inducibility. Formation of a complex between ligand-activated RA receptors and p300 on DR-2 may be sufficient for the Epo gene to respond to RA. Although transcription of the Epo gene in P19 cells is not inducible by hypoxia, the LDHA gene, the hypoxic response of which requires HIF-1,22,23 is inducible in P19 cells,45 excluding the possibility that P19 cells lack HIF-1. This was confirmed by the current Western blot analysis (Figure 6A). RA receptors expressed abundantly in P19 cells may compete with HNF-4 in the interaction with DR-2, abolishing the hypoxia inducibility of the Epo gene. This is unlikely, however, because the forced expression of functional HNF-4 conferred little hypoxic response on the Epo gene in P19 cells.45 Although the possibility that the HIF-1 region in the Epo gene is not open for HIF-1 to be accessible in P19 cells has not been completely excluded, it is noted that the HIF-1 site included in the reporter plasmids (pWT-WT in Figure 6B and P19/Z in Figure 4C) cannot exert its function in the hypoxic P19 cells. We speculate that the HIF-1/HNF-4/p300 complex on the 3' enhancer and the RA receptors/p300 complex require different factors that link these complexes with the basal transcriptional machinery. P19 cells may be defective in a factor for the former complex. Although further studies are clearly needed to understand the physiologic significance of RA-induced transcriptional activation of the Epo gene, RA may play a role in maintenance of the Epo level appropriate to the day-to-day production of red blood cells under normal, steady-state conditions, because RA increased the serum Epo level in vitamin A-depleted rats.44 Epo production in mouse yolk sacs is stimulated by RA,62 which may indicate that RA is also involved in the regulation of Epo production in an early stage of animal development. It thus appears that DR-2 is critical for the Epo gene to select the signals to respond in a tissue-specific or developmental stage-specific manner.
Submitted March 27, 2000; accepted June 30, 2000.
Supported by grants-in-aid from the Ministry of Education, Science, Sports, and Culture of Japan; and from Hokuto Foundation for Bioscience to T.K.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ryuzo Sasaki, Division of Integrated Life Science, Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan; e-mail: rsasaki{at}kais.kyoto-u.ac.jp.
1. Jacobson LO, Goldwasser E, Fried W, Plzak L. Role of the kidney in erythropoiesis. Nature. 1957;179:633-634[Medline] [Order article via Infotrieve].
2.
Krantz SB.
Erythropoietin.
Blood.
1991;77:419-434
3.
Jelkmann W.
Erythropoietin: structure, control of production, and function.
Physiol Rev.
1992;72:449-489
4.
Ebert BL, Bunn HF.
Regulation of the erythropoietin gene.
Blood.
1999;94:1864-1877
5.
Tan CC, Eckardt KU, Firth JD, Ratcliffe PJ.
Feedback modulation of renal and hepatic erythropoietin mRNA in response to graded anemia and hypoxia.
Am J Physiol.
1992;263:F474-F481
6.
Masuda S, Okano M, Yamagishi K, Nagao M, Ueda M, Sasaki R.
A novel site of erythropoietin production: oxygen-dependent production in cultured rat astrocytes.
J Biol Chem.
1994;269:19488-19493
7.
Digicaylioglu M, Bichet S, Marti HH, et al.
Localization of specific erythropoietin binding sites in defined areas of the mouse brain.
Proc Natl Acad Sci U S A.
1995;92:3717-3720 8. Marti HH, Wenger RH, Rivas LA, et al. Erythropoietin gene expression in human, monkey and murine brain. Eur J Neurosci. 1996;8:666-676[Medline] [Order article via Infotrieve]. 9. Marti HH, Gassmann M, Wenger RH, et al. Detection of erythropoietin in human liquor, intrinsic erythropoietin production in the brain. Kidney Int. 1997;51:416-418[Medline] [Order article via Infotrieve]. 10. Bernaudin M, Marti HH, Roussel S, et al. A potential role for erythropoietin in focal permanent cerebral ischemia in mice. J Cereb Blood Flow Metab. 1999;19:643-651[Medline] [Order article via Infotrieve].
11.
Yasuda Y, Masuda S, Chikuma M, Inoue K, Nagao M, Sasaki R.
Estrogen-dependent production of erythropoietin in uterus and its implication in uterine angiogenesis.
J Biol Chem.
1998;273:25381-25387
12.
Masuda S, Kobayashi T, Chikuma M, Nagao M, Sasaki R.
Oviduct produces erythropoietin in an estrogen and oxygen-dependent manner.
Am J Physiol Endocrinol Metab.
2000;278:E1038-E1044
13.
Masuda S, Nagao M, Takahata K, et al.
Functional erythropoietin receptor of the cells with neural characteristics: comparison with receptor properties of erythroid cells.
J Biol Chem.
1993;268:11208-11216 14. Morishita E, Masuda S, Nagao M, Yasuda Y, Sasaki R. Erythropoietin receptor is expressed in rat hippocampal and cerebral cortical neurons, and erythropoietin prevents in vitro glutamate-induced neuronal death. Neuroscience. 1997;76:105-116[Medline] [Order article via Infotrieve].
15.
Assandri R, Egger M, Gassman M, et al.
Erythropoietin modulates intracellular calcium in a human neuroblastoma cell line.
J Physiol (Lond).
1999;516:343-352 16. Koshimura K, Murakami Y, Sohmiya M, Tanaka J, Kato Y. Effects of erythropoietin on neural activity. J Neurochem. 1999;72:2565-2572[Medline] [Order article via Infotrieve].
17.
Sakanaka M, Wen TC, Matsuda S, et al.
In vivo evidence that erythropoietin protects neurons from ischemic damage.
Proc Natl Acad Sci U S A.
1998;95:4635-4640 18. Sadamoto Y, Igase K, Sakanaka M, et al. Erythropoietin prevents place navigation disability and cortical infarction in rats with permanent occlusion of the middle cerebral artery. Biochem Biophys Res Commun. 1998;253:26-32[Medline] [Order article via Infotrieve].
19.
Bunn HF, Poyton RO.
Oxygen sensing and molecular adaptation to hypoxia.
Physiol Rev.
1996;76:839-885
20.
Goldberg MA, Glass GA, Cunningham JM, Bunn HF.
The regulated expression of erythropoietin by two human hepatoma cell lines.
Proc Natl Acad Sci U S A.
1987;84:7972-7976
21.
Goldberg MA, Dunning SP, Bunn HF.
Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein.
Science.
1988;242:1412-1415
22.
Firth JD, Ebert BL, Ratcliffe PJ.
Hypoxic regulation of lactate dehydrogenase A.
J Biol Chem.
1995;270:21021-21027
23.
Semenza GL, Jiang BH, Leung SW, et al.
Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1.
J Biol Chem.
1996;271:32529-32537
24.
Ebert BL, Firth JD, Ratcliffe PJ.
Hypoxia and mitochondrial inhibitors regulate expression of glucose transporter-1 via distinct cis-acting sequences.
J Biol Chem.
1995;270:29083-29089 25. Forsythe JA, Jiang BH, Iyer NV, et al. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol. 1996;16:4604-4613[Abstract].
26.
Melillo G, Musso T, Sica A, Taylor LS, Cox GW, Varesio L.
A hypoxia-responsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter.
J Exp Med.
1995;182:1683-1693
27.
Lee PJ, Jiang BH, Chin BY, et al.
Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to hypoxia.
J Biol Chem.
1997;272:5375-5381
28.
Rolfs A, Kvietikova I, Gassmann M, Wenger RH.
Oxygen-regulated transferrin expression is mediated by hypoxia-inducible factor-1.
J Biol Chem.
1997;272:20055-20062
29.
Tacchini L, Bianchi L, Bernelli-Zazzera A, Cairo G.
Transferrin receptor induction by hypoxia: HIF-1-mediated transcriptional activation and cell-specific post-transcriptional regulation.
J Biol Chem.
1999;274:24142-24146
30.
Semenza GL, Nejfelt MK, Chi SM, Antonarakis SE.
Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene.
Proc Natl Acad Sci U S A.
1991;88:5680-5684
31.
Beck I, Ramirez S, Weinmann R, Caro J.
Enhancer element at the 3'-flanking region controls transcriptional response to hypoxia in the human erythropoietin gene.
J Biol Chem.
1991;266:15563-15566
32.
Pugh CW, Tan CC, Jones RW, Ratcliffe PJ.
Functional analysis of an oxygen-regulated transcriptional enhancer lying 3' to the mouse erythropoietin gene.
Proc Natl Acad Sci U S A.
1991;88:10553-10557
33.
Madan A, Curtin PT.
A 24-base-pair sequence 3' to the human erythropoietin gene contains a hypoxia-responsive transcriptional enhancer.
Proc Natl Acad Sci U S A.
1993;90:3928-3932 34. Pugh CW, Ebert BL, Ebrahim O, Ratcliffe PJ. Characterization of functional domains within the mouse erythropoietin 3' enhancer conveying oxygen-regulated responses in different cell lines. Biochim Biophys Acta. 1994;1217:297-306[Medline] [Order article via Infotrieve].
35.
Semenza GL, Wang GL.
A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation.
Mol Cell Biol.
1992;12:5447-5454
36.
Beck I, Weinmann R, Caro J.
Characterization of hypoxia responsive enhancer in the human erythropoietin gene shows presence of hypoxia-inducible 120-Kd nuclear DNA-binding protein in erythropoietin-producing and nonproducing cells.
Blood.
1993;82:704-711
37.
Wang GL, Semenza GL.
Characterization of hypoxia inducible factor 1 and regulation of DNA binding activity by hypoxia.
J Biol Chem.
1993;268:21513-21518 38. Wenger RH, Gassmann M. Oxygen(es) and the hypoxia-inducible factor-1. Biol Chem. 1997;378:609-616.
39.
Blanchard K, Acquaviva AM, Galson DL, Bunn HF.
Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.
Mol Cell Biol.
1992;12:5373-5385 40. Hu B, Wright E, Campbell L, Blanchard KL. In vivo analysis of DNA-protein interactions on the human erythropoietin enhancer. Mol Cell Biol. 1997;17:851-856[Abstract]. 41. Galson DL, Tsuchiya T, Tendler DS, et al. The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1. Mol Cell Biol. 1995;15:2135-2144[Abstract]. 42. Masuda S, Chikuma M, Sasaki R. Insulin-like growth factors and insulin stimulate erythropoietin production in primary cultured astrocytes. Brain Res. 1997;746:63-70[Medline] [Order article via Infotrieve]. 43. Fandrey J, Pagel H, Frede S, Wolff M, Jelkmann W. Thyroid hormones enhance hypoxia-induced erythropoietin in vitro. Exp Hematol. 1994;22:272-277[Medline] [Order article via Infotrieve]. 44. Okano M, Masuda S, Narita H, et al. Retinoic acid up-regulates erythropoietin production in hepatoma cells and in vitamin A-depleted rats. FEBS Lett. 1994;349:229-233[Medline] [Order article via Infotrieve].
45.
Kambe T, Tada J, Chikuma M, et al.
Embryonal carcinoma P19 cells produce erythropoietin constitutively but express lactate dehydrogenase in an oxygen-dependent manner.
Blood.
1998;91:1185-1195 46. Chambon P. A decade of molecular biology of retinoic acid receptors. FASEB J. 1996;10:940-954[Abstract]. 47. Leid M, Kastner P, Chambon P. Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem Sci. 1992;17:427-433[Medline] [Order article via Infotrieve].
48.
Jansa P, Forejt J.
A novel type of retinoic acid response element in the second intron of the mouse H2Kb gene is activated by the RAR/RXR heterodimer.
Nucleic Acids Res.
1996;24:694-701
49.
Shirai Y, Inagaki M, Yamaguchi M, et al.
Effect of hypoxia duration on the oxygen-dependent production of a recombinant protein,
50.
Andrews NC, Faller DV.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res.
1991;19:2499 51. Rudnicki MA, McBurney MW. Cell culture methods and induction of differentiation of embryonal carcinoma cell lines. In: Pobertson EJ, ed. Teratocarcinoma and Embryonic Stem Cells: A Practical Approach. Oxford: IRL Press; 1987:19-49. 52. Jonk LJC, de Jonge MEJ, Kruyt FAE, Mummery CL, van der Saag PT, Kruijer W. Aggregation and cell cycle dependent retinoic acid receptor mRNA expression in P19 embryonal carcinoma cells. Mech Dev. 1992;36:165-172[Medline] [Order article via Infotrieve]. 53. Bain G, Gottlieb DI. Expression of retinoid X receptors in P19 embryonal carcinoma cells and embryonic stem cells. Biochem Biophys Res Commun. 1994;200:1252-1256[Medline] [Order article via Infotrieve]. 54. Janknecht R, Hunter T. Transcription: a growing coactivator network. Nature. 1996;383:22-23[Medline] [Order article via Infotrieve]. 55. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature. 1993;365:855-859[Medline] [Order article via Infotrieve].
56.
Eckner R, Ewen ME, Newsome D, et al.
Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor.
Genes Dev.
1994;8:869-884
57.
Arany Z, Huang LE, Eckner R, et al.
An essential role for p300/CBP in the cellular response to hypoxia.
Proc Natl Acad Sci U S A.
1996;93:12969-12973
58.
Ebert BL, Bunn HF.
Regulation of transcription by hypoxia requires a multiprotein complex that includes hypoxia-inducible factor 1, an adjacent transcription factor, and p300/CREB binding protein.
Mol Cell Biol.
1998;18:4089-4096
59.
Dell H, Hadzopoulou-Cladaras M.
CREB-binding protein is a transcriptional coactivator for hepatocyte nuclear factor-4 and enhances apolipoprotein gene expression.
J Biol Chem.
1999;274:9013-9021 60. Zhang W, Tsuchiya T, Yasukochi Y. Transcriptional change in interaction between HIF-1 and HNF-4 in response to hypoxia. J Hum Genet. 1999;44:293-299[Medline] [Order article via Infotrieve]. 61. Huang LE, Ho V, Arany Z, et al. Erythropoietin gene regulation depends on heme-dependent oxygen sensing and assembly of interacting transcription factors. Kidney Int. 1997;51:548-552[Medline] [Order article via Infotrieve]. 62. Yasuda Y, Okano M, Nagao M, et al. Erythropoietin in mouse avascular yolk sacs is increased by retinoic acid. Dev Dyn. 1996;207:184-194[Medline] [Order article via Infotrieve].
© 2000 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. B Zimmermann, R. Biebinger, F. Rohner, A. Dib, C. Zeder, R. F Hurrell, and N. Chaouki Vitamin A supplementation in children with poor vitamin A and iron status increases erythropoietin and hemoglobin concentrations without changing total body iron. Am. J. Clinical Nutrition, September 1, 2006; 84(3): 580 - 586. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ishihara, T. Yamazaki, Y. Ishida, T. Suzuki, K. Oda, M. Nagao, Y. Yamaguchi-Iwai, and T. Kambe Zinc Transport Complexes Contribute to the Homeostatic Maintenance of Secretory Pathway Function in Vertebrate Cells J. Biol. Chem., June 30, 2006; 281(26): 17743 - 17750. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Glozak, Y. Li, R. Reuille, K. H. Kim, M.-N. Vo, and M. B. Rogers Trapping and Characterization of Novel Retinoid Response Elements Mol. Endocrinol., January 1, 2003; 17(1): 27 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Botella, T. Sanchez-Elsner, F. Sanz-Rodriguez, S. Kojima, J. Shimada, M. Guerrero-Esteo, M. P. Cooreman, V. Ratziu, C. Langa, C. P. H. Vary, et al. Transcriptional activation of endoglin and transforming growth factor-beta signaling components by cooperative interaction between Sp1 and KLF6: their potential role in the response to vascular injury Blood, December 1, 2002; 100(12): 4001 - 4010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Mukundan, T. C. Resta, and N. L. Kanagy 17beta -Estradiol decreases hypoxic induction of erythropoietin gene expression Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2002; 283(2): R496 - R504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Akiyama, T. Tanaka, T. Maeno, H. Kanai, Y. Kimura, S. Kishi, and M. Kurabayashi Induction of VEGF Gene Expression by Retinoic Acid through Sp1-Binding Sites in Retinoblastoma Y79 Cells Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1367 - 1374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ghatpande, A. Ghatpande, J. Sher, M. H. Zile, and T. Evans Retinoid signaling regulates primitive (yolk sac) hematopoiesis Blood, April 1, 2002; 99(7): 2379 - 2386. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2000 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
) and aggregate cultures (
). Each value is the mean ± SD
of triplicate experiments.
, 
). (B) Schematic
representation of the reporter gene constructs used. The upper
construct shows the Luc reporter plasmids consisting of the mouse Epo
promoter (mP) and 3' enhancer (mE), and the lower construct shows the
).
