| |
|
|
|
|
|
|
|||
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From CHU Bretonneau, Tours; Centre Hospitalier
Lyon-Sud, Pierre-Benite; Hôpital Necker, Hôpital St Louis,
and Hôpital Saint-Antoine, Paris; Institut Bergonie, Bordeaux;
CHU La Milètrie, Poitiers; Hôpital J. Minjoz, Besancon;
Hôpital Henri Mondor, Creteil; CHU Angers, Angers; Centre
Léon Berard, Lyon; Centre Henri Becquerel, Rouen; CHU Hôtel
Dieu, Nantes; Hôpital Antoine Beclère, Clamart;
Hôpital de Larchet, Nice; CHU Nancy-Brabois,
Vandoeuvre-les-Nancy; Produits Roche Neuilly-sur-Seine; Centre Jean
Bernard, Le Mans, France.
The clinical activity of rituximab, a chimeric monoclonal antibody
which binds to the CD20 antigen, was evaluated as a single first-line
therapy for patients with follicular non-Hodgkin lymphoma (NHL). Fifty
patients with follicular CD20+ NHL and a low tumor burden
were analyzed for clinical and molecular responses. They received 4 weekly infusions of rituximab at a dose of 375 mg/m2. The
response rate a month after treatment (day 50) was 36 of 49 (73%),
with 10 patients in complete remission, 3 patients in complete
remission/unconfirmed, and 23 patients in partial remission. Ten
patients had stable disease, and the disease progressed in 3 patients. One of 13 (8%) patients in complete remission, 9 of 23 (39%) patients in partial remission, and 5 of 10 (50%) patients with
stable disease exhibited disease progression during the first year.
Within the study population, 32 patients were initially informative for
polymerase chain reaction (PCR) data on bcl-2-JH rearrangement. On day 50, 17 of 30 patients (57%) were negative for
bcl-2-JH rearrangement in peripheral blood, and 9 of 29 (31%) were negative in bone marrow; a significant association was
observed between molecular and clinical responses
(P < .0001). At month 12, 16 of 26 patients (62%) were
PCR negative in peripheral blood. These results indicate that early
molecular responses can be sustained for up to 12 months and that this
response is highly correlated with progression-free survival. Rituximab
has a high clinical activity and a low toxicity and induces a high
complete molecular response rate in patients with follicular lymphoma
and a low tumor burden.
(Blood. 2001;97:101-106) The optimal treatment of advanced-stage follicular
non-Hodgkin lymphoma (NHL) is yet to be determined. In patients with a low tumor burden and without adverse prognostic factors, retrospective analysis1 and prospective studies2,3 have shown
that postponing treatment until progression has no negative influence
on survival. Nevertheless, almost all patients will experience disease
progression and ultimately die of their disease. Thus, new treatment
approaches for this subgroup of patients are needed and must meet
several requirements Recent studies have been devoted to antibody-mediated therapy.
Treatments with unmodified monoclonal antibodies (mAbs) have included
patient-specific mAbs,4,5 anti-CD20,6
anti-CD19 and CD22 Abs coupled with immunotoxins,7-9 and
anti-CD20 mAbs radiolabeled with iodohippurate sodium I131
or yttrium Y90 in low doses10,11 and in high
doses with stem cell support.12,13 The chimeric
human-mouse anti-CD20 mAb rituximab is a human IgG1 Several trials16-18 have shown that rituximab as
single therapy has a significant clinical activity in pretreated
patients with follicular lymphoma.16-18 Recently, results
of a large phase II trial were reported.19 One hundred
sixty-six patients with relapsed low-grade or follicular lymphoma were
given 4 weekly doses of 375 mg/m2 rituximab as outpatients;
48% of patients responded, and the median time to progression was 13 months among responders. Adverse events were mostly moderate and were
limited to infusion-related events, especially during the first
infusion. Overall, severe reactions to rituximab are rare and are
observed mainly in patients with bulky tumors,20 leukemic
involvement,21 or both.
However, the clinical activity of rituximab alone as a first-line
therapy in patients with low-grade NHL has been evaluated only in a
limited number of patients with various histologic subtypes of
low-grade NHL.22,23 This report summarizes results of a multi-institutional trial of a 4-dose course of rituximab in previously untreated patients with follicular lymphoma with a low tumor burden. The objectives of the study were: (1) to assess clinical activity; (2)
to monitor molecular responses in blood and bone marrow and to
correlate clinical and molecular responses; and (3) to assess toxicity
in patients without bulky tumor.
Patients
Patients were required to have a low tumor burden according to the GELF
criteria3 Therapy
Clinical monitoring To assess all sites of disease involvement, baseline evaluation included clinical documentation, radiography of the chest, computed tomography (CT) of the chest, abdomen, and pelvis, and unilateral bone marrow biopsy. Laboratory testing included routine hematology, serum chemistries, serum immunoglobulin levels, lactate dehydrogenase, and 2-microglobulin assays in blood and urinalysis. Monitoring included hematology and serum chemistry evaluations before
each treatment and full tumor restaging 28 days after the end of
treatment, 1 month after that, every 3 months for 1 year, and then
every 6 months for 2 years.
Molecular analysis of bcl-2-JH gene rearrangement All samples were centralized in a single laboratory, and DNA was extracted using standard procedures and the usual precautions to avoid cross-contamination. For each assay at diagnosis, 1 µg DNA was amplified using MBR- (TATGGTGGTTTGACCTTTAG) or mcr- (CGTGCTGGTACCACTCCTG') specific oligonucleotides, together with JH consensus (ACCTGAGGAGACGGTGACCAGGGT) oligonucleotide and AmpliTaq Gold polymerase (Perkin Elmer). Each reaction included 10 minutes at 95°C, then 50 cycles each comprising 3 steps at 94°C for 30", 56°C (MBR) or 58°C (mcr) for 30", and 72°C for 30" followed by 9' at 72°C. Amplified products were
visualized on agar gel stained with ethidium bromide; under these
conditions, the sensitivity of detection did not exceed
10 3 For follow-up samples, nested polymerase chain
reaction (PCR) analysis was performed using MBR
(CAGCCTTGAAACATTGATGG) or mcr (CGTGCTGGTACCACTCCTG) with
JH- (ACCTGAGGAGACGGTGACC) specific primers for
the first round (30 cycles for MBR, 25 cycles for mcr), then a
reamplification of 4% of the reaction product with internal
MBR (CTATGGTGGTTTGACCTTTAGAG) or mcr (GGACCTTCCTTGGTGTGTTG) and
JH (ACCAGGGTCCCTTGGCCCCAG) oligonucleotides (30 cycles
each) under the same conditions as above, except that each PCR step lasted 1 minute. The sensitivity of this assay was routinely greater than or equal to 10 4. All samples at the time of
diagnosis and during follow-up were tested twice, and all negative
results were controlled with another PCR assay using tumor necrosis
factor gene primers25 to ensure DNA integrity.
Endpoints The primary efficacy endpoint was the objective response rate that is, the proportion of patients achieving either complete remission (CR) or partial response (PR) according to the criteria recently reported by Cheson et al.26 Complete response
required the resolution of all symptoms and the disappearance of all
detectable clinical and radiologic lesions (greatest transverse
diameter, less than 1.5 cm), including bone marrow cleansing, for at
least 28 days. Complete remission/unconfirmed (CRu) was defined by
either a residual lymph node mass larger than 1.5 cm at the greatest transverse diameter, with the sum of the products of perpendicular diameters regressing by more than 75%, or an indeterminate bone marrow
result (increased number or size of aggregates without atypical
cytologic or architectural features). PR required a decrease greater
than or equal to 50% of the sum of the products of perpendicular diameters of the 6 largest dominant nodes or nodal masses without any
evidence of disease progression for at least 28 days. Progressive disease was defined as any occurrence of a new lesion during or at the
end of therapy or a 50% increase in the size of any previously identified lesion. Stable disease was defined as no change of the
target lesions or a change not corresponding to PR or progressive disease. An independent panel of radiologists reviewed all CT scans of
all the included patients.
Clinical response was evaluated on days 50 and 78, and maximal response at either of these stagings (if confirmed on day 180 and if the maximal response was observed on day 78) was taken into account for this report. Comparison of clinical response by individual prognostic variables was performed using logistic regression. All patients were evaluated for progression at 12 months according to the Cheson et al26 criteria. Patients in CR or CRu with bone marrow (BM) cleansing on day 50 and BM showing again some involvement at 12 months were considered to have progressive disease. Patients in PR with negative BM biopsy findings on day 50 and minimal or moderate involvement at 12 months were not considered in progression because the latter could be related to technical aspects (sample size). An independent panel of lymphoma specialists reviewed all responses. Comparison of clinical responses at 12 months with the day 50 results of PCR analysis was performed using the Fisher exact test. The secondary endpoints were PCR outcome and progression-free survival. Progression-free survival was calculated according to the method of Kaplan and Meier27 and was measured from the start of treatment until progression/relapse or death. Comparison of the survival functions by results of PCR analysis on day 50 was performed using the log-rank test.
Patient characteristics Fifty patients were enrolled in 16 centers from October 1997 to August 1998. One patient was excluded after histologic review. Thus, 49 patients were evaluable for response and 50 for tolerance.There were 26 men and 24 women. The median age was 52 years (range, 32 to 75 years). Twenty-two patients had grade I, 24 had grade II, and 3 had grade III follicular NHL. Four patients had Ann Arbor stage II, 11 had Ann Arbor stage III, and 35 had Ann Arbor stage IV disease.
Sixty-six percent of patients had bone marrow involvement, and 82% of
the patients had at least 2 measurable sites (Table
1).
Clinical response rate The response rate (RR) was 73% (36 of 49) with 10 patients (20%) in CR, 3 patients (6%) in CRu, and 23 patients (47%) in PR. Ten patients (20%) had stable disease, whereas 3 patients (6%) experienced disease progression during treatment. Lung carcinoma was diagnosed in one patient 10 months after treatment, but it appeared to have existed at the time of NHL diagnosis. The lung radiologic abnormality was considered lymphoma involvement. Hodgkin disease developed in another patient 11 months after treatment.Sex, stage, bone marrow involvement, number of extranodal sites, and detectable bcl-2 gene rearrangement by PCR in peripheral blood at diagnosis were analyzed to define individual prognostic variables for clinical response. No factor was found of prognostic value. Of the 36 patients who were responders on day 78, 10 patients
progressed during the first year of follow-up (1 CR and 9 PR); 5 of the
10 patients with stable disease were also progressing at 12 months
(Figures 1,
2). Two progressions to
Hodgkin lymphoma and diffuse large-cell lymphoma were observed. Of
note, we observed that 7 of 23 patients in PR on day 78 were in CR or
CRu at 12 months and that 3 of 10 patients with stable disease on
day 78 were in PR at 12 months. Thus, if we consider the response rate at any staging during the first year of follow-up after rituximab treatment, 20 of 49 patients (41%) reached CR/CRu, and 19 of 49 patients (39%) reached PR, for an overall response rate of 39 of 49 patients (80%).
Results of the PCR analysis of bcl-2-JH rearrangement Of the 49 patients with follicular lymphoma included in the study, 48 were evaluated using PCR analysis before treatment. The bcl-2-JH rearrangement was detected in peripheral blood in 32 of 48 patients tested, in 29 of 45 of those patients tested in bone marrow, and in 11 of 17 patients tested in lymph node. All patients who were positive in peripheral blood were also positive in lymph node or bone marrow, and this 32-patient (67%) total was therefore considered informative for further follow-up, 28 with a rearrangement in the MBR region and 4 in the mcr region.On day 50, after the start of rituximab treatment, 30 patients were
evaluated in peripheral blood and 17 of them (57%) were negative for
bcl-2-JH rearrangement (Table
2). Among the latter, 9 were also PCR
negative in bone marrow, whereas 7 remained PCR positive in bone marrow
(one patient did not have bone marrow evaluation). Therefore, 9 of 30 (30%) of the evaluable patients had a clearance of the molecular
markers in both blood and bone marrow. When molecular response was
compared with clinical response assessed on days 50 and 78, a
significant association (P < .0001) was observed between
molecular and clinical responses: 10 of the 17 patients who were PCR
negative in peripheral blood were in CR/CRu, whereas none of the 13 patients PCR positive in peripheral blood had CR (Table 2).
The data from follow-up samples obtained at 6 months in peripheral
blood and at 12 months in peripheral blood and bone marrow showed that
the overall proportions of patients who were PCR negative in peripheral
blood were comparable at the 3 time points
Adverse events All patients received the 4 weekly infusions at full dose. The most common adverse events thought to be related to rituximab infusion are listed in Table 4. The most frequent events were grade 1-2 fever, headache, asthenia, pain, rash, laryngitis, rhinitis, paresthesia, hypotension, and nausea. Two cases of grade 3-4 hypotension and hypertension resolved after management according to the protocol procedures. No hematologic toxicity was observed, and only one minor infection developed.
We report a trial evaluating the clinical efficacy and safety of single-agent rituximab therapy as first-line therapy of follicular NHL with low tumor burden. In addition, patients were evaluated for molecular response in blood and bone marrow. Previous experience with 4 weekly courses of rituximab as single first-line therapy has been reported in refractory or relapsing low-grade lymphoma.16-19 A pivotal multicenter trial19 was performed in 166 patients with recurrent or refractory low-grade, mostly follicular, B-cell lymphoma. The overall response rate was 48% (6% CR, 42% PR), confirming the phase I-II data. The efficacy of rituximab had also been shown in an 8-week infusion program28 and as retreatment.29 We have treated 49 patients with follicular NHL and a low tumor burden;
the response rate was 73% The possibility of clearing the residual disease evaluated by PCR technique appears particularly interesting. On day 50, of 30 patients initially positive for bcl-2-JH rearrangement in peripheral blood, 17 were negative after treatment and 9 were also negative in bone marrow. Two other patients had a delayed response in peripheral blood. Serial PCR analysis after treatment showed that PCR response persisted over time. At 12 months, 12 of 26 patients remained PCR negative in blood and bone marrow. Conversely, a few patients (3 of 17) who became PCR negative in blood after treatment did not reach clinical response. These results appear comparable to those reported in patients with progressive or relapsed disease. McLaughlin et al19 and, more recently, Gupta et al30 indicated reversion to negative status in blood and bone marrow of relapsed patients after rituximab therapy. A clear association was observed between PCR negativity and clinical response. The significance of molecular remission in follicular lymphoma remains unclear. Recently, Lopez-Guillermo et al31 tested, during and after treatment, the peripheral blood and, when possible, the bone marrow of 194 patients exhibiting either MBR or mcr bcl-2 rearrangement at diagnosis. Patients who achieved molecular response during the first year of treatment had a significantly longer failure-free survival than those who did not (4-year progression-free survival, 76% versus 38%). Similar prognostic value of bcl-2 negativity has been reported after autologous bone marrow transplantation. Gribben et al32 have indicated that after autologous bone marrow transplantation, patients with negative blood bcl-2 PCR findings have significantly lower relapse rates and better progression-free survival rates than patients who remain bcl-2 positive. On the other hand, some patients with localized follicular NHL remain PCR positive during several years without clinical relapse.33 In our group of patients, PCR negativity also appeared to be associated with a good prognosis because only one patient with PCR negativity has had a relapse during the first year (whereas 8 of 13 patients who were PCR positive after treatment have had relapses). Nevertheless, the clinical significance of molecular remission after rituximab therapy remains unknown. It may reflect either a true molecular response in all disease sites or a predominant effect of rituximab on blood and bone marrow involvements. Of note, we observed that most patients remained PCR negative after the usual delay of the reappearance of normal B-lymphocytes in blood and bone marrow that occurs 6 to 9 months after treatment with rituximab.19 Importantly, these results were obtained without the toxicity of conventional chemotherapy. The adverse events consisted of grade 1 or 2 symptoms such as fever, headache, nausea, hypotension, rhinitis, angioedema, rash, pain, or pruritus. Only 2 cases of grade 3 toxicity, manifested as hypotension or hypertension, were observed during the first infusion. As described in previous trials, the number and the severity of adverse events decreased with subsequent infusions. The small number of adverse events could be explained by the low tumor burden of the patients included in our study.20 We did not observe any appearance of severe infusion-related symptom complex recently described.21 Two other studies of rituximab used as first-line treatment of low-grade NHL have been reported recently. Hainsworth et al22 reported a 52% response rate among 25 patients with follicular lymphoma. Gutheil et al23 observed 8 responses among 14 patients with follicular lymphoma. Molecular results were not reported in any of these studies. In conclusion, these results demonstrate that rituximab has high clinical activity in previously untreated patients with follicular NHL. Response duration has yet to be determined. In addition, rituximab as a single agent induces a molecular response rate that has not been reported with any other cytotoxic agent. These responses have to be confirmed with larger phase III trials in which rituximab will be compared with other therapeutic approaches. Many additional issues about this agent remain to be explored: combination with chemotherapy,34 with growth factors such as G-CSF35 or GM-CSF which could increase ADCC, or with an immunotherapy such as interferon alfa.36 Whether repeated treatments with rituximab of responders after recovery of CD20+ cells may delay clinical relapse remains to be investigated. This is being tested in another trial.22
We thank Carole Charlot and Marie-Claude Chamard for expert technical assistance. We also thank J. N. Munck, F. Morschauser, B. Grosbois, and A. Delmer for clinical reviews; Y. Menu and A. Scherrer for radiologic reviews; and J. M. Goehrs (Medical Department, Produits Roche).
Submitted May 8, 2000; accepted September 12, 2000.
Supported by Produits Roche, Neuilly-sur-Seine, France.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ph. Solal-Celigny, Centre Jean Bernard, 9 rue Beauverger, 72000 Le Mans, France; e-mail: coutard{at}cybercable.tm.fr.
1.
Horning SJ.
Treatment approaches to the low-grade lymphomas.
Blood.
1994;83:881-884 2. Young RC, Longo DL, Glastein E, Ihde DC, Jaffe ES, De Vita VT. The treatment of indolent lymphomas: watchful waiting versus aggressive combined modality treatment. Semin Hematol. 1988;25:11-18[Medline] [Order article via Infotrieve].
3.
Brice P, Bastion Y, Lepage E, et al.
Comparison in low-tumor burden follicular lymphomas between an initial no-treatment policy, prednimustine or interferon alpha: a randomized study from the Groupe d'Etude des Lymphomes Folliculaires.
J Clin Oncol.
1997;15:1110-1117
4.
Brown SL, Miller RA, Horning SJ, et al.
Treatment of B-cell lymphomas with anti-idiotype antibodies alone or in combination with alpha interferon.
Blood.
1989;73:651-661
5.
Maloney DG, Brown S, Czerwinski D, et al.
Monoclonal anti-idiotype antibody therapy of B-cell-lymphoma: the addition of a short course of chemotherapy does not interfere with the anti-tumor effect nor prevent the emergence of idiotype-negative variant cells.
Blood.
1992;80:1502-1510
6.
Press OW, Applebaum F, Ledbetter JA, et al.
Monoclonal antibody 1F5 (anti-CD20) serotherapy of human B cell lymphomas.
Blood.
1987;69:584-591
7.
Amlot PL, Stone MJ, Cunningham D, et al.
A phase I study an anti-CD22-deglycosylated ricin A chain immunotoxin in the treatment of B cell lymphomas resistant to conventional therapy.
Blood.
1993;82:2624-2633 8. Conry RM, Khazaeli MB, Saleh MN, et al. Phase I trial of an anti-CD19-deglycosylated ricin A chain immunotoxin in non-Hodgkin's lymphoma: effect of an intensive schedule of administration. J Immunother Emphasis Tumor Immunol. 1995;18:231-241[Medline] [Order article via Infotrieve].
9.
Stone MJ, Sausville EA, Fay JW, et al.
A phase I study of bolus versus continuous infusion of the anti-CD19 immunotoxin, IgG-HD37-dgA, in patients with B cell lymphoma.
Blood.
1996;88:1188-1197
10.
Kaminski MS, Zasadny KR, Francis IR, et al.
Iodine-131 anti-B1 radioimmunotherapy for B cell lymphoma.
J Clin Oncol.
1996;14:1974-1981 11. Kow SJ, Goris ML, Trisler K, et al. Yttrium-90 labeled anti-CD20 monoclonal antibody therapy of recurrent B-cell lymphoma. Clin Cancer Res. 1998;2:457-470[Abstract]. 12. Press OW, Eary JF, Appelbaum FR, et al. Phase II trial of 131I-B1 (anti-CD20) antibody therapy with autologous stem cell transplantation for relapsed B cell lymphomas. Lancet. 1995;346:336-340[CrossRef][Medline] [Order article via Infotrieve]. 13. Liu SY, Eary JF, Petersdorf SH, et al. Follow-up of relapsed B-cell lymphoma patients treated with iodine-131-labeled anti-CD20 antibody and autologous stem cell rescue. J Clin Oncol. 1998;16:3270-3277[Abstract].
14.
Reff ME, Carner K, Chambers KS, et al.
Depletion of B-cells in vivo by a chimeric mouse human monoclonal antibody to CD20.
Blood.
1994;83:435-445
15.
Shan D, Ledbetter JA, Press OW.
Apoptosis of malignant human B cells by ligation of CD20 with monoclonal antibodies.
Blood.
1998;91:1644-1652 16. Maloney DG, Grillo-Lopez AJ, Bodkin DJ, et al. IDEC-C2B8: results of a phase I multiple-dose trial in patients with relapsed non-Hodgkin's lymphoma. J Clin Oncol. 1997;15:3266-3274[Abstract].
17.
Maloney DG, Grillo-Lopez AJ, White CA, et al.
IDEC-C2B8 (rituximab) anti-CD20 monoclonal antibody therapy in patients with relapsed low-grade non-Hodgkin's lymphoma.
Blood.
1997;90:2188-2195
18.
Tobinai K, Kobayashi Y, Narabayashi M, et al.
Feasibility and pharmacokinetic study of a chimeric anti-CD20 monoclonal antibody (IDEC-CDB8, rituximab) in relapsed B cell lymphoma: the IDEC-C2B8 Study Group.
Ann Oncol.
1998;9:527-534 19. McLaughlin P, Grillo-Lopez AJ, Link BK, et al. Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol. 1998;16:2825-2833[Abstract].
20.
Davis TA, White CA, Grillo-Lopez AJ, et al.
Single-agent monoclonal antibody efficacy in bulky non-Hodgkin's lymphoma: results of a phase II trial of rituximab.
J Clin Oncol.
1999;17:1851-1857
21.
Byrd JC, Waselenko JK, Maneatis TJ, et al.
Rituximab therapy in hematologic malignancy patients with circulating blood tumor cells: association with increased infusion-related side effects and rapid blood tumor clearance.
J Clin Oncol.
1999;17:791-795
22.
Hainsworth JD, Burris HA III, Morissey LH, et al.
Rituximab monoclonal antibody as initial systemic therapy for patients with low-grade non-Hodgkin lymphoma.
Blood.
2000;95:3052-3056 23. Gutheil JC, Funicane D, Rodriguez R, Saleh F, Stahler S, Royston I. Phase II study of rituximab (Rituxan) in patients with previously untreated low-grade or follicular non-Hodgkin's lymphoma [abstract]. Proc Am Soc Clin Oncol. 2000;19:22a.
24.
Harris NL, Jaffe S, Stein H, et al.
A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group.
Blood.
1994;84:1361-1392
25.
Warzocha K, Ribeiro P, Bienvenu J, et al.
Genetic polymorphisms in the tumor necrosis factor region and non-Hodgkin's lymphoma outcome.
Blood.
1998;91:3574-3581
26.
Cheson BD, Horning SJ, Coiffier B, et al.
Report of an international workshop to standardize response criteria for non-Hodgkin's lymphoma.
J Clin Oncol.
1999;17:1244-1253 27. Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc. 1958;53:457-481[CrossRef]. 28. Piro L, White CA, Grillo-Lopez AJ, et al. Rituxan (rituximab, IDEC-C2B8): interim analysis of a phase II study of once weekly times 8 dosing in patients with relapsed low-grade or follicular non-Hodgkin's lymphoma [abstract]. Blood. 1997;90:510a. 29. Davis T, Levy R, White CA, et al. Retreatments with Rituxan (rituximab, IDEC-C2B8) have significant efficacy, do not cause harm, and are a viable minimally toxic alternative in relapsed or refractory non-Hodgkin's lymphoma (NHL) [abstract]. Blood. 1997;90:509a. 30. Gupta RK, Summers KE, Lister JA. PCR analysis for the t(14;18) translocations in patients with recurrent follicular lymphoma following immunotherapy with rituximab (IDEC-C2B8) [abstract]. Blood. 1998;92:239a.
31.
Lopez-Guillermo A, Cabanillas F, McLaughlin P, et al.
The clinical significance of molecular response in indolent follicular lymphomas.
Blood.
1998;91:2955-2960
32.
Gribben JG, Neuberg D, Barber M, et al.
Detection of residual lymphoma cells by polymerase chain reaction in peripheral blood is significantly less predictive for relapse than detection in bone marrow.
Blood.
1994;83:3800-3807
33.
Finke J, Slavina J, Lange W, Dölken G.
Persistence of circulating t(14;18) cells in long-term remission after radiation therapy for localized stage follicular lymphomas.
J Clin Oncol.
1993;11:1668-1673
34.
Czuczman MS, Grillo-Lopez AJ, White CA, et al.
Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclonal antibody and CHOP chemotherapy.
J Clin Oncol.
1999;17:268-276 35. Van der Kolk IE, Gerritsen W, Baars J, Jonkhoff AR, Van Oers MHJ. Phase I/II clinical trial to evaluate the safety and efficacy of a combination of a chimeric anti-CD20 monoclonal antibody (rituximab) and G-CSF given weekly to patients with relapsed B cell lymphoma [abstract]. Blood. 1997;90:512a. 36. Davis T, Maloney D, White CA, et al. Combination immunotherapy of low-grade or follicular non-Hodgkin's lymphoma with rituximab and alpha interferon: interim analysis [abstract]. Proc Am Soc Clin Oncol. 1998;17:11a.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
T. Gaufin, M. Pattison, R. Gautam, C. Stoulig, J. Dufour, J. MacFarland, D. Mandell, C. Tatum, M. H. Marx, R. M. Ribeiro, et al. Effect of B-Cell Depletion on Viral Replication and Clinical Outcome of Simian Immunodeficiency Virus Infection in a Natural Host J. Virol., October 15, 2009; 83(20): 10347 - 10357. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dayde, D. Ternant, M. Ohresser, S. Lerondel, S. Pesnel, H. Watier, A. Le Pape, P. Bardos, G. Paintaud, and G. Cartron Tumor burden influences exposure and response to rituximab: pharmacokinetic-pharmacodynamic modeling using a syngeneic bioluminescent murine model expressing human CD20 Blood, April 16, 2009; 113(16): 3765 - 3772. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dalle, S. Dupire, S. Brunet-Manquat, L. Reslan, A. Plesa, and C. Dumontet In vivo Model of Follicular Lymphoma Resistant to Rituximab Clin. Cancer Res., February 1, 2009; 15(3): 851 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gyan, C. Foussard, P. Bertrand, P. Michenet, S. Le Gouill, C. Berthou, H. Maisonneuve, V. Delwail, R. Gressin, P. Quittet, et al. High-dose therapy followed by autologous purged stem cell transplantation and doxorubicin-based chemotherapy in patients with advanced follicular lymphoma: a randomized multicenter study by the GOELAMS with final results after a median follow-up of 9 years Blood, January 29, 2009; 113(5): 995 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salles, N. Mounier, S. de Guibert, F. Morschhauser, C. Doyen, J.-F. Rossi, C. Haioun, P. Brice, B. Mahe, R. Bouabdallah, et al. Rituximab combined with chemotherapy and interferon in follicular lymphoma patients: results of the GELA-GOELAMS FL2000 study Blood, December 15, 2008; 112(13): 4824 - 4831. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Racila, B. K. Link, W.-K. Weng, T. E. Witzig, S. Ansell, M. J. Maurer, J. Huang, C. Dahle, A. Halwani, R. Levy, et al. A Polymorphism in the Complement Component C1qA Correlates with Prolonged Response Following Rituximab Therapy of Follicular Lymphoma Clin. Cancer Res., October 15, 2008; 14(20): 6697 - 6703. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cartron, M. Ohresser, G. Salles, P. Solal-Celigny, P. Colombat, and H. Watier Neutrophil role in in vivo anti-lymphoma activity of rituximab: FCGR3B-NA1/NA2 polymorphism does not influence response and survival after rituximab treatment Ann. Onc., August 1, 2008; 19(8): 1485 - 1487. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Rabkin, C. Hirt, S. Janz, and G. Dolken t(14;18) Translocations and Risk of Follicular Lymphoma J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 48 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Taylor, D. Hershman, N. Shah, N. Suciu-Foca, D. P. Petrylak, R. Taub, L. Vahdat, B. Cheng, M. Pegram, K. L. Knutson, et al. Augmented HER-2 Specific Immunity during Treatment with Trastuzumab and Chemotherapy Clin. Cancer Res., September 1, 2007; 13(17): 5133 - 5143. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Witzig, D. J. Inwards, T. M. Habermann, A. Dogan, P. J. Kurtin, J. B. Gross Jr, A. Ananthamurthy, K. M. Ristow, and J. A. Garrity Treatment of Benign Orbital Pseudolymphomas With the Monoclonal Anti-CD20 Antibody Rituximab Mayo Clin. Proc., June 1, 2007; 82(6): 692 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Gribben How I treat indolent lymphoma Blood, June 1, 2007; 109(11): 4617 - 4626. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Salles Clinical Features, Prognosis and Treatment of Follicular Lymphoma Hematology, January 1, 2007; 2007(1): 216 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Venugopal and S. A. Gregory Lymphoproliferative disorders ASH Self-Assessment Program, January 1, 2007; 2007(1): 265 - 297. [Full Text] [PDF] |
||||
![]() |
K. D. Khan, C. Emmanouilides, D. M. Benson Jr., D. Hurst, P. Garcia, G. Michelson, S. Milan, A. K. Ferketich, L. Piro, J. P. Leonard, et al. A Phase 2 Study of Rituximab in Combination with Recombinant Interleukin-2 for Rituximab-Refractory Indolent Non-Hodgkin's Lymphoma Clin. Cancer Res., December 1, 2006; 12(23): 7046 - 7053. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Colombat, N. Brousse, F. Morschhauser, P. Franchi-Rezgui, P. Soubeyran, V. Delwail, E. Deconinck, C. Haioun, C. Foussard, C. Sebban, et al. Single Treatment with Rituximab Monotherapy for Low-Tumor Burden Follicular Lymphoma (FL): Survival Analyses with Extended Follow-Up (F/Up) of 7 Years. Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 486 - 486. [Abstract] [PDF] |
||||
![]() |
Q. Liu, L. Fayad, F. Cabanillas, F. B. Hagemeister, G. D. Ayers, M. Hess, J. Romaguera, M. A. Rodriguez, A. M. Tsimberidou, S. Verstovsek, et al. Improvement of Overall and Failure-Free Survival in Stage IV Follicular Lymphoma: 25 Years of Treatment Experience at The University of Texas M.D. Anderson Cancer Center J. Clin. Oncol., April 1, 2006; 24(10): 1582 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Dao, M. Gomez-Nunez, C. Antczak, B. Kappel, J. Singh Jaggi, T. Korontsvit, V. Zakhaleva, and D. A. Scheinberg Natural Killer Cells License Dendritic Cell Cross-Presentation of B Lymphoma Cell-Associated Antigens Clin. Cancer Res., December 15, 2005; 11(24): 8763 - 8772. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hiddemann, M. Kneba, M. Dreyling, N. Schmitz, E. Lengfelder, R. Schmits, M. Reiser, B. Metzner, H. Harder, S. Hegewisch-Becker, et al. Frontline therapy with rituximab added to the combination of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) significantly improves the outcome for patients with advanced-stage follicular lymphoma compared with therapy with CHOP alone: results of a prospective randomized study of the German Low-Grade Lymphoma Study Group Blood, December 1, 2005; 106(12): 3725 - 3732. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hiddemann, C. Buske, M. Dreyling, O. Weigert, G. Lenz, R. Forstpointner, C. Nickenig, and M. Unterhalt Treatment Strategies in Follicular Lymphomas: Current Status and Future Perspectives J. Clin. Oncol., September 10, 2005; 23(26): 6394 - 6399. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Deconinck, C. Foussard, N. Milpied, P. Bertrand, P. Michenet, P. Cornillet-LeFebvre, M. Escoffre-Barbe, H. Maisonneuve, V. Delwail, R. Gressin, et al. High-dose therapy followed by autologous purged stem-cell transplantation and doxorubicin-based chemotherapy in patients with advanced follicular lymphoma: a randomized multicenter study by GOELAMS Blood, May 15, 2005; 105(10): 3817 - 3823. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Khouri, R. M. Saliba, C. Hosing, G.-J. Okoroji, S. Acholonu, P. Anderlini, D. Couriel, M. De Lima, M. L. Donato, L. Fayad, et al. Concurrent Administration of High-Dose Rituximab Before and After Autologous Stem-Cell Transplantation for Relapsed Aggressive B-Cell Non-Hodgkin's Lymphomas J. Clin. Oncol., April 1, 2005; 23(10): 2240 - 2247. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Hainsworth, S. Litchy, L. H. Morrissey, M. B. Andrews, M. Grimaldi, M. McCarty, and F. A. Greco Rituximab Plus Short-Duration Chemotherapy As First-Line Treatment for Follicular Non-Hodgkin's Lymphoma: A Phase II Trial of the Minnie Pearl Cancer Research Network J. Clin. Oncol., March 1, 2005; 23(7): 1500 - 1506. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Hainsworth, S. Litchy, D. W. Shaffer, V. L. Lackey, M. Grimaldi, and F. A. Greco Maximizing Therapeutic Benefit of Rituximab: Maintenance Therapy Versus Re-Treatment at Progression in Patients With Indolent Non-Hodgkin's Lymphoma--A Randomized Phase II Trial of the Minnie Pearl Cancer Research Network J. Clin. Oncol., February 20, 2005; 23(6): 1088 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Witzig, A. M. Vukov, T. M. Habermann, S. Geyer, P. J. Kurtin, W. R. Friedenberg, W. L. White, H. I. Chalchal, P. J. Flynn, T. R. Fitch, et al. Rituximab Therapy for Patients With Newly Diagnosed, Advanced-Stage, Follicular Grade I Non-Hodgkin's Lymphoma: A Phase II Trial in the North Central Cancer Treatment Group J. Clin. Oncol., February 20, 2005; 23(6): 1103 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Marcus, K. Imrie, A. Belch, D. Cunningham, E. Flores, J. Catalano, P. Solal-Celigny, F. Offner, J. Walewski, J. Raposo, et al. CVP chemotherapy plus rituximab compared with CVP as first-line treatment for advanced follicular lymphoma Blood, February 15, 2005; 105(4): 1417 - 1423. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kaminski, M. Tuck, J. Estes, A. Kolstad, C. W. Ross, K. Zasadny, D. Regan, P. Kison, S. Fisher, S. Kroll, et al. 131I-Tositumomab Therapy as Initial Treatment for Follicular Lymphoma N. Engl. J. Med., February 3, 2005; 352(5): 441 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.S. Czuczman, A. Koryzna, A. Mohr, C. Stewart, K. Donohue, L. Blumenson, Z.P. Bernstein, P. McCarthy, A. Alam, F. Hernandez-Ilizaliturri, et al. Rituximab in Combination With Fludarabine Chemotherapy in Low-Grade or Follicular Lymphoma J. Clin. Oncol., February 1, 2005; 23(4): 694 - 704. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hagemeister, F. Cabanillas, M. Coleman, S. A. Gregory, and P. L. Zinzani The Role of Mitoxantrone in the Treatment of Indolent Lymphomas Oncologist, February 1, 2005; 10(2): 150 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Dave, G. Wright, B. Tan, A. Rosenwald, R. D. Gascoyne, W. C. Chan, R. I. Fisher, R. M. Braziel, L. M. Rimsza, T. M. Grogan, et al. Prediction of Survival in Follicular Lymphoma Based on Molecular Features of Tumor-Infiltrating Immune Cells N. Engl. J. Med., November 18, 2004; 351(21): 2159 - 2169. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Stel, B.-J. Kroesen, S. Jacobs, H. Groen, L. F. M. H. de Leij, H. C. Kluin-Nelemans, and S. Withoff The Role of B Cell-Mediated T Cell Costimulation in the Efficacy of the T Cell Retargeting Bispecific Antibody BIS20x3 J. Immunol., November 15, 2004; 173(10): 6009 - 6016. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Forstpointner, M. Dreyling, R. Repp, S. Hermann, A. Hanel, B. Metzner, C. Pott, F. Hartmann, F. Rothmann, R. Rohrberg, et al. The addition of rituximab to a combination of fludarabine, cyclophosphamide, mitoxantrone (FCM) significantly increases the response rate and prolongs survival as compared with FCM alone in patients with relapsed and refractory follicular and mantle cell lymphomas: results of a prospective randomized study of the German Low-Grade Lymphoma Study Group Blood, November 15, 2004; 104(10): 3064 - 3071. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Brugger, J. Hirsch, F. Grunebach, R. Repp, P. Brossart, W. Vogel, H.-G. Kopp, M. G. Manz, M. Bitzer, G. Schlimok, et al. Rituximab consolidation after high-dose chemotherapy and autologous blood stem cell transplantation in follicular and mantle cell lymphoma: a prospective, multicenter phase II study Ann. Onc., November 1, 2004; 15(11): 1691 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Cheson What Is New in Lymphoma? CA Cancer J Clin, September 1, 2004; 54(5): 260 - 272. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Olszewski and M. L. Grossbard Empowering Targeted Therapy: Lessons from Rituximab Sci. Signal., July 13, 2004; 2004(241): pe30 - pe30. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dall'Ozzo, S. Tartas, G. Paintaud, G. Cartron, P. Colombat, P. Bardos, H. Watier, and G. Thibault Rituximab-Dependent Cytotoxicity by Natural Killer Cells: Influence of FCGR3A Polymorphism on the Concentration-Effect Relationship Cancer Res., July 1, 2004; 64(13): 4664 - 4669. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Zinzani, A. Pulsoni, A. Perrotti, S. Soverini, F. Zaja, A. De Renzo, S. Storti, V. M. Lauta, L. Guardigni, P. Gentilini, et al. Fludarabine Plus Mitoxantrone With and Without Rituximab Versus CHOP With and Without Rituximab As Front-Line Treatment for Patients With Follicular Lymphoma J. Clin. Oncol., July 1, 2004; 22(13): 2654 - 2661. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bendandi, S. A. Pileri, and P. L. Zinzani Challenging paradigms in lymphoma treatment Ann. Onc., May 1, 2004; 15(5): 703 - 711. [Full Text] [PDF] |
||||
![]() |
W. L. Gluck, D. Hurst, A. Yuen, A. M. Levine, M. A. Dayton, J. P. Gockerman, J. Lucas, K. Denis-Mize, B. Tong, D. Navis, et al. Phase I Studies of Interleukin (IL)-2 and Rituximab in B-Cell Non-Hodgkin's Lymphoma: IL-2 Mediated Natural Killer Cell Expansion Correlations with Clinical Response Clin. Cancer Res., April 1, 2004; 10(7): 2253 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Kennedy, P. V. Beum, M. D. Solga, D. J. DiLillo, M. A. Lindorfer, C. E. Hess, J. J. Densmore, M. E. Williams, and R. P. Taylor Rituximab Infusion Promotes Rapid Complement Depletion and Acute CD20 Loss in Chronic Lymphocytic Leukemia J. Immunol., March 1, 2004; 172(5): 3280 - 3288. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-K. Weng and R. Levy Two Immunoglobulin G Fragment C Receptor Polymorphisms Independently Predict Response to Rituximab in Patients With Follicular Lymphoma J. Clin. Oncol., November 1, 2003; 21(21): 3940 - 3947. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Westhoff, F. Jochimsen, A. Schmittel, M. Stoffler-Meilicke, J. H. Schafer, W. Zidek, W. H. Gerlich, and E. Thiel Fatal hepatitis B virus reactivation by an escape mutant following rituximab therapy Blood, September 1, 2003; 102(5): 1930 - 1930. [Full Text] [PDF] |
||||
![]() |
E. Fernandez-Ruiz, M. Cabrerizo, M. Ortega, C. Blas, P. Llamas, M. Santos-Roncero, S. Nieto, A. Acevedo, G. Perez, C. Nicolas, et al. High Molecular Response Rate and Clinical Correlation in Patients with Follicular Lymphoma Treated with Cyclophosphamide-Vincristine-Prednisone plus Interferon {alpha} 2b Clin. Cancer Res., July 1, 2003; 9(7): 2497 - 2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Hainsworth, S. Litchy, J. H. Barton, G. A. Houston, R. C. Hermann, J. E. Bradof, and F. A. Greco Single-Agent Rituximab as First-Line and Maintenance Treatment for Patients With Chronic Lymphocytic Leukemia or Small Lymphocytic Lymphoma: A Phase II Trial of the Minnie Pearl Cancer Research Network J. Clin. Oncol., May 1, 2003; 21(9): 1746 - 1751. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Boye, T. Elter, and A. Engert An overview of the current clinical use of the anti-CD20 monoclonal antibody rituximab Ann. Onc., April 1, 2003; 14(4): 520 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Manches, G. Lui, L. Chaperot, R. Gressin, J.-P. Molens, M.-C. Jacob, J.-J. Sotto, D. Leroux, J.-C. Bensa, and J. Plumas In vitro mechanisms of action of rituximab on primary non-Hodgkin lymphomas Blood, February 1, 2003; 101(3): 949 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Kennedy, M. D. Solga, T. A. Schuman, A. W. Chi, M. A. Lindorfer, W. M. Sutherland, P. L. Foley, and R. P. Taylor An anti-C3b(i) mAb enhances complement activation, C3b(i) deposition, and killing of CD20+ cells by rituximab Blood, February 1, 2003; 101(3): 1071 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Tsimberidou, P. McLaughlin, A. Younes, M. A. Rodriguez, F. B. Hagemeister, A. Sarris, J. Romaguera, M. Hess, T. L. Smith, Y. Yang, et al. Fludarabine, mitoxantrone, dexamethasone (FND) compared with an alternating triple therapy (ATT) regimen in patients with stage IV indolent lymphoma Blood, December 15, 2002; 100(13): 4351 - 4357. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A Krieger, J. M Merin, and I. Rabinowitz Necrotizing fasciitis following rituximab therapy Journal of Oncology Pharmacy Practice, December 1, 2002; 8(4): 127 - 129. [Abstract] [PDF] |
||||
![]() |
B. Sanchez-Vega, F. Vega, L. J. Medeiros, M. S. Lee, and R. Luthra Quantification of bcl-2/JH Fusion Sequences and a Control Gene by Multiplex Real-Time PCR Coupled with Automated Amplicon Sizing by Capillary Electrophoresis J. Mol. Diagn., November 1, 2002; 4(4): 223 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Hainsworth, S. Litchy, H. A. Burris III, D. C. Scullin Jr, S. W. Corso, D. A. Yardley, L. Morrissey, and F. A. Greco Rituximab as First-Line and Maintenance Therapy for Patients With Indolent Non-Hodgkin's Lymphoma J. Clin. Oncol., October 15, 2002; 20(20): 4261 - 4267. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. O. Dillman Radiolabeled Anti-CD20 Monoclonal Antibodies for the Treatment of B-Cell Lymphoma J. Clin. Oncol., August 15, 2002; 20(16): 3545 - 3557. [Full Text] [PDF] |
||||
![]() |
I. Espinoza-Delgado Cancer Vaccines Oncologist, August 1, 2002; 7(90003): 20 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Biagi and J. F. Seymour Insights into the molecular pathogenesis of follicular lymphoma arising from analysis of geographic variation Blood, May 29, 2002; 99(12): 4265 - 4275. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. McLaughlin Profiling: "Editorial on 'Survival after progression in patients with follicular lymphoma: analysis of prognostic factors' ", by S. Montoto et al. (Ann Oncol 2002; 13: 523-530) Ann. Onc., April 1, 2002; 13(4): 499 - 500. [Full Text] [PDF] |
||||
![]() |
G. Z. Rassidakis, L. J. Medeiros, S. Viviani, V. Bonfante, G.-P. Nadali, T. P. Vassilakopoulos, O. Mesina, M. Herling, M. K. Angelopoulou, R. Giardini, et al. CD20 Expression in Hodgkin and Reed-Sternberg Cells of Classical Hodgkin's Disease: Associations With Presenting Features and Clinical Outcome J. Clin. Oncol., March 1, 2002; 20(5): 1278 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cartron, L. Dacheux, G. Salles, P. Solal-Celigny, P. Bardos, P. Colombat, and H. Watier Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fcgamma RIIIa gene Blood, February 1, 2002; 99(3): 754 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rambaldi, M. Lazzari, C. Manzoni, E. Carlotti, L. Arcaini, M. Baccarani, T. Barbui, C. Bernasconi, G. Dastoli, G. Fuga, et al. Monitoring of minimal residual disease after CHOP and rituximab in previously untreated patients with follicular lymphoma Blood, February 1, 2002; 99(3): 856 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Ansell, T. E. Witzig, P. J. Kurtin, J. A. Sloan, D. F. Jelinek, K. G. Howell, S. N. Markovic, T. M. Habermann, G. G. Klee, P. J. Atherton, et al. Phase 1 study of interleukin-12 in combination with rituximab in patients with B-cell non-Hodgkin lymphoma Blood, January 1, 2002; 99(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Cheson Some Like It Hot! J. Clin. Oncol., October 1, 2001; 19(19): 3908 - 3911. [Full Text] |
||||
![]() |
O. W. Press, J. P. Leonard, B. Coiffier, R. Levy, and J. Timmerman Immunotherapy of Non-Hodgkin's Lymphomas Hematology, January 1, 2001; 2001(1): 221 - 240. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||