|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
GENE THERAPY
From the Department of Haematology, Imperial College
School of Medicine, Hammersmith Hospital, London, United Kingdom;
and the Laboratoire de Thérapeutique Immuno-Moléculaire,
Etablissement Français du Sang-Bourgogne/ Franche-Comté,
Besançon, France.
The herpes simplex virus thymidine kinase gene type 1 (HSV-Tk) ganciclovir (GCV) system is a novel therapeutic
strategy for the modulation of graft-versus-host disease (GVHD), a
major complication of allogeneic stem cell transplantation (allo-SCT).
Retroviral-mediated gene transfer of the HSV-Tk gene into
donor T lymphocytes before allo-SCT may allow their in vivo selective
depletion after treatment with GCV. The expression of the
HSV-Tk gene was analyzed in vitro in CEM cells, a human
lymphoblastoid cell line, transduced with 2 different vectors, each
containing the HSV-Tk gene and a selectable marker gene.
GCV-resistant clones were identified within the clones expressing the
marker gene. Characterization of the molecular events leading to this
resistance revealed a 227-bp deletion in the HSV-Tk gene
due to the presence of cryptic splice donor and acceptor sites within
the HSV-Tk gene sequence. Furthermore, it was confirmed
that this deletion was present in human primary T cells transduced with
either vector and in 12 patients who received transduced donor T cells,
together with a T-cell-depleted allo-SCT. In vivo circulating
transduced T cells containing the truncated HSV-Tk gene
were identified in all patients immediately after infusion and up to
800 days after transplantation. In patients who received GCV as
treatment for GVHD, a progressive increase in the proportion of
transduced donor T cells carrying the deleted HSV-Tk
gene was observed. These results suggest that the limitations within
the HSV-Tk/GCV system can be improved by developing
optimized retroviral vectors to ensure maximal killing of
HSV-Tk-transduced cells.
(Blood. 2001;97:122-129) Allogeneic hematopoietic stem cell transplantation
(allo-SCT) is widely used as a curative approach to many hematologic
malignancies.1,2 However, the success of allo-SCT is
limited by a number of factors, including the clinical entity of
graft-versus-host disease (GVHD), which is mediated by immunocompetent
donor-derived T lymphocytes.3 Strategies for the
prevention of GVHD include the use of immunosuppression after
transplantation, T-cell depletion of the graft, or both. The first is
only partially successful in the prevention of GVHD and contributes to
a delay in immune reconstitution, resulting in considerable morbidity
and mortality.4 The latter is associated with an increase
in the incidence of both graft rejection and leukemic
relapse.5 In some cases recurrence may be successfully treated by further infusions of donor lymphocytes,6 but
these may also result in severe and potentially fatal GVHD.
Donor T cells genetically modified by the insertion of a suicide gene
may permit modulation of this alloreactivity after
transplantation.7 The herpes simplex virus thymidine
kinase gene type 1 (HSV-Tk) is one of the most widely used
systems in suicide gene therapy. The HSV-Tk gene renders the
cells susceptible to killing by ganciclovir (GCV), a nucleoside
analogue used in the treatment of herpesvirus infections.
HSV-Tk phosphorylates GCV, converting it to a
monophosphorylated form, which is phosphorylated further by cellular
DNA kinases before it is incorporated into newly synthesized DNA. This
results in the arrest of DNA synthesis and leads to subsequent DNA
fragmentation.8,9
Donor T cells expressing HSV-Tk have been used in the
prevention and management of leukemic relapse and Epstein-Barr
virus-associated lymphoproliferative disorders after
allo-SCT.10-13 In the clinical study by Bonini et
al,12 4 patients had GVHD after the infusion of transduced
T cells. All responded to treatment with GCV. However, one patient
achieved only a partial response, and residual
HSV-Tk-transduced T lymphocytes could still be detected
after treatment with GCV. The presence of GCV resistance in the
HSV-Tk-transduced cells is a matter of concern because this
may limit the efficacy of this approach.
In this study we investigated the mechanisms of GCV resistance in a
lymphoblastoid human T-cell line (CEM) transduced with the retroviral
vector SFCMM3 containing the HSV-Tk gene.14
Subcloning of the transduced line permitted the identification of
GCV-resistant clones. The molecular mechanism underlying GCV resistance
involved the deletion of a 227-bp fragment in the HSV-Tk
gene sequence. Mapping of the truncated HSV-Tk gene revealed
cryptic splicing of the HSV-Tk RNA in the retroviral
producer cell line. This truncated form of HSV-Tk was
transferred to CEM cells and was subsequently identified in cells
transduced with another retroviral vector, G1Tk1SvNa. This latter
vector has now been used in a number of therapeutic clinical
trials.15,16 We have also detected this deletion in human
primary T cells transduced with either one of these vectors and in
patients who had received G1Tk1SvNa-transduced donor T cells after a
T-cell-depleted allo-SCT.15,38 These observations
are of particular importance for the design of vectors destined for
future clinical use.
This study was conducted in 2 independent laboratories at the
Imperial College School of Medicine (ICSM; London, United Kingdom) with
the SFCMM3 vector (coding for the HSV-Tk gene and for the low-affinity nerve growth factor receptor gene, Retroviral vectors and producer lines
Harvesting of virus supernatant
Isolation and culture of human T-cell lines and primary T
lymphocytes
Peripheral blood mononuclear cells were collected in heparinized (ICSM)
or EDTA (EFSBFC) tubes from healthy donors or patients included in the
phase I/II clinical trial11,38 with informed consent. Low-density mononuclear cells (less than 1.007 g/mL) were
isolated by centrifugation (1500g, 30 minutes, 20°C) on
Lymphoprep (Nycomed, Oslo, Norway). Peripheral blood mononuclear cells
were cultured at a density of 2 × 106 cells/mL in T-RF10
medium composed of RPMI containing 10% heat inactivated FCS, 5 µM
Transduction of CEM and primary T lymphocytes Peripheral blood mononuclear cells were stimulated with 1 µg/mL phytohemagglutinin-M (PHA) (Boehringer Mannheim, GmbH, Mannheim, Germany) and 100 U/mL rhIL-2 for 48 hours before transduction with SFCCM3. Nonadherent cells were collected by centrifugation and resuspended in T-RF10 at 2 × 106 cells/mL. Twenty-four hours before infection, CEM cells were fed with RF10 and were resuspended at a concentration of 5 × 105 cells/mL. Cell-free virus supernatants containing 4 µg/mL polybrene (Sigma) were added to the cell cultures and incubated for 16 hours at 37°C in a CO2 incubator. The infection process was repeated on 2 consecutive days. Cells were washed with fresh medium 24 hours after the last infection and further cultured for 2 to 3 days before FACS analysis.Transduction of donor T cells with the G1Tk1SvNa retroviral vector was as previously described.18 Peripheral blood mononuclear cells were cultured with OKT3 (10 ng; Jasen-Cilag, Levalleis Perret, France) and rhIL-2 (500 U/mL, Chiron, UK Ltd) for 3 days. Infection with retroviral supernatant for 24 hours was followed by G418 (800 µg/mL; Sigma) selection of transduced cells for 7 days. Dead cells were removed, and the viable transduced product was cryopreserved for future use. The transduction of CEM cells with the G1Tk1SvNa vector involved identical infection conditions to those described for the SFCMM3 vector, followed by selection in G418 (800 µg/mL) for 7 to 14 days. FACS analysis for the determination of  LNGFR expression was measured using the
CellQuest software (Becton Dickinson). For each reading at least
20 000 events were counted.
Selection of transduced cells For the SFCMM3 vector, transduced cells were selected based on the expression of theLNGFR on the cell surface using the MiniMACS
system (Miltenyi Biotec, Germany) according to the manufacturer's instructions. Briefly, cells were incubated with the murine antihuman NGFR mAb for 30 minutes at room temperature, washed with MACS buffer
(PBS supplement with 0.5% BSA and 2 mM EDTA), and incubated with a
goat antimouse IgG microbeads (MACS; Miltenyi Biotec) for 15 minutes at
4°C. After washing, the LNGFR-expressing cells were selected over
MiniMACS MS+ separation columns (MACS; Miltenyi Biotec).
Cells transduced with G1Tk1SvNa were selected by exposure to G418 (800 µg/mL) for 7 to 14 days. The transduction efficiency was evaluated by
a competitive polymerase chain reaction (PCR) assay for the
NeoR gene.19
Cloning of the transduced CEM cells Cloning of the transduced andLNGFR-selected CEM cells was
performed by plating 400 cells in 1 mL methyl cellulose (MethoCult H4330; Stem Cell Technologies, Vancouver, Canada) in 35-mm Petri dishes. Semisolid cultures were incubated for 12 days at 37°C, 5%
CO2. On day 13, individual colonies were picked, seeded in 100 µL RF10 in a 96-well plate, and subsequently expanded. These clones will be referred to as CEM-Tk clones.
Ganciclovir cytotoxic assay Then 2 × 104 cells/well were seeded into a 96-well plate in 100 µL RF-10 medium. Cells were cultured for 4 days with increasing concentrations of GCV ranging from 0.05 to 12.5 µg/mL (Cymevene; Hoffman-La Roche AG, Germany) in triplicate. On day 4, 1 µCi tritiated thymidine (methyl 3H-thymidine, TRA.120, 1.0 MBq/mL; Amersham International, United Kingdom) was added to each well 18 hours before harvesting the cells. Incorporation of 3H-thymidine into the DNA was measured in a -scintillation counter (Wallac 1410, Gaithersburg, MD). For each GCV
concentration, the GCV-induced inhibition was calculated using the
ratio (cpm culture with GCV/cpm culture without GCV) × 100.
Southern blot analysis Genomic DNA was extracted using a QIAamp blood kit (Qiagen, Germany) according to the manufacturer's recommendations. After overnight digestion of 10 µg genomic DNA with the restriction enzymes SacI or EcoRI (New England Biolabs, United Kingdom), samples were size-fractionated by electrophoresis through a 0.8% agarose gel. Genomic DNA was transferred onto a Hybond N nylon filter (Amersham, Les Ullis, France), hybridized with an -32P-dCTP random prime-labeled 1.1 kb
MluI-XhoI fragment of the HSV-Tk gene
sequence (Tk1 probe) or a 0.9 kb RsrII fragment of the
LNGFR gene (NGF probe), and exposed to radiographic film
(Biomax; Eastman Kodak, Rochester, NY) for at least 16 hours
at  80°C.
Polymerase chain reaction and sequence analysis The presence of the SFCMM3 proviral sequences was examined in genomic DNA extracted from transduced cells. Different regions of the provirus were amplified by PCR using primers (Figure 1A): fragment 1, LTR1+ 5' GGTCTCCTCTGAGTGATTGACTA 3' and HTK5-5' AACGAATTCCGGCGCCTAGAGAA 3'; fragment 2, HTK4+ 5' TTCTCTAGGCGCCGGAATTCGTT 3' and HTK2-5' ATCCAGGATAAAGACGTGCATGG3'; fragment 3, HTK1+ 5' CCATGCACGTCTTTATCCTGGAT 3' and NGF2-5' TTGCAGCACTCACCGCTGTGTGT 3'; fragment 4, NGF2+ 5' ACACACAGCGGTGAGTGCTGCAA 3' and NGF3-5' ATAGAAGGCGATGCGCTGCGAAT 3'.PCRs were performed in a 20-µL reaction mixture containing 50 ng genomic DNA, 1× Taq DNA polymerase buffer with 15 mM MgCl2 (Boehringer Mannheim, Lewes, United Kingdom), 250 µM each dATP, dCTP, dGTP, dTTP, 0.25 µM each sense and antisense primer, and 0.025 U/µL Taq polymerase (Boehringer Mannheim). The thermocycling conditions used to amplify fragments 1 and 2 were 35 cycles of denaturation at 96°C for 30 seconds, annealing at 60°C for 50 seconds, and extension at 72°C for 1 minute, followed by a final 10-minute extension at 72°C. For fragments 3 and 4, annealing was performed at 64°C with a total of 31 cycles. The PCR products (10 µL) were electrophoresed on a 1% agarose gel stained with ethidium bromide (EtBr). PCR amplification of an 880-bp genomic fragment of the human ABL gene was performed as described elsewhere on negative clones to confirm the presence of amplifiable genomic DNA.20 The presence of the HSV-Tk gene in G1Tk1SvNa-transduced cells was examined by PCR using primers (Figure 1B): pTK 5' TAGACGGTCCTCACGGGATGGGGA 3' and RTK2 5' GCCAGCATAGCCAGGTCAAG 3'. PCR assays were performed in a 50-µL reaction mixture containing 500 ng DNA, 1× Taq polymerase buffer with 15 mM
MgCl2 (Eurogentec, Seraing, Belgium), 200 µM each dNTP,
0.25 µM each primer, and 0.5 U Taq DNA polymerase
(Eurogentec). The thermocycling conditions used were 35 cycles at
94°C for 45 seconds, 60°C for 1 minute, 72°C for 1 minute, and a
final extension of 5 minutes at 72°C. PCR products (18 µL) were
electrophoresed on 2% EtBr-stained agarose gels. Genomic DNA was
transferred to a nylon membrane, hybridized with an
PCR products were cloned in duplicate into the pCR2.1 TA cloning vector (Invitrogen, Groningen, The Netherlands) or the pGEMT Easy vector from Promega (Charbonnières, France). Automated fluorescent DNA sequence analysis was carried out by the Advanced Biotechnology Centre (London, United Kingdom) and PE Biosystems (Courtaboeuf, France). Frequency of the truncation event Three hundred CEM cells that had been transduced by either G1Tk1SVNa or SFCMM3 vectors and selected by G418 or immunomagnetic procedures were mixed with 150 µL RF10 to 1 mL methyl cellulose (MethoCult H4320; Stem Cell Technologies, Vancouver, Canada). Cells were then plated in triplicate in 35-mm Petri dishes and grown for 15 days at 37°C in 5% CO2 and scored on day 15. Individual colonies were picked and expanded in 24-well plates for 3 days. Cells were then harvested for analysis by PCR for the presence of full-length or truncated HSV-Tk gene, as described above.Clinical study Escalating amounts of CD3+ gene-modified cells were infused together with T-cell-depleted bone marrow. Twelve patients with hematologic malignancies received 2 × 105 (n = 5), 6 × 105 (n = 5), or 20 × 105 (n = 2) transduced donor CD3+ cells per kilogram with bone marrow from an HLA-identical sibling. Blood samples were collected from all patients at 2-week intervals for the detection of gene-modified cells. In patients in whom GVHD developed and who were treated with GCV, peripheral blood samples were collected more frequently during and shortly after GCV administration.
Transduction efficiency of CEM and primary cells The average transduction efficiency of T lymphocytes and CEM cells based on theLNGFR expression was 20% ± 5%. After 2 rounds of
immunomagnetic selection, 95% to 98% of the transduced cells expressed LNGFR.
The transduction efficiency of primary T cells with G1Tk1SvNa before G418 selection, as measured by quantitative PCR for NeoR, was 8.3% ± 1.4% (n = 12). The GCV sensitivity of these cells after G418 selection was 87% ± 1.2% (n = 12).38
LNGFR in individual CEM-Tk clones was
determined by FACS analysis (Figure 2).
Most (13 of 15) clones were positive for LNGFR. Two clones (clones 5 and 7) showed no expression of LNGFR, as demonstrated by the
overlapping profiles with respect to the isotopic controls (Figure 2).
In addition, different levels of expression of LNGFR were observed
within the positive clones.
HSV-Tk gene expression in CEM-Tk clones The expression of the HSV-Tk transgene in the CEM-Tk clones was determined by inhibition of cell proliferation when the cells were cultured at increasing concentrations of GCV (Figure 3). The IC50 for inhibition of cell proliferation assessed by 3H-thymidine incorporation was reached at a concentration of GCV of 0.1 µg/mL for clones 3, 6, 9, 13, 14, and 15. In contrast, cell proliferation in clones 1, 2, 4, 5, 7, 8, 10, 11, and 12 was similar to that obtained in the nontransduced cells (negative control), indicating resistance to GCV.
Integrity of the inserted SFCMM3 provirus by Southern blot and PCR analyses SacI-digested genomic DNA from the CEM-Tk clones was examined for the integrity of the inserted SFCMM3 provirus by Southern blot analysis. The SacI restriction enzyme cuts only in the 5' and 3' LTRs. Thirteen of the fifteen CEM-Tk clones contained the integrated provirus on hybridization with the Tk1 probe (Figure 4A). However, the expected 4.1-kb fragment was found in only 6 clones (3, 6, 9, 13-15). In the remaining clones (1, 2, 4, 8, 10-12), a smaller band was observed. When a probe specific for theLNGFR gene was used (Figure 4B),
multiple bands were observed, probably corresponding to the endogenous
nerve growth factor receptor (NGFR) gene, and they appeared
in all instances including the nontransduced parental CEM cells. The
4.1-kb fragment was seen in all clones except clones 5 and 7. The
absence of the SFCMM3 vector after hybridization with both the Tk1 and
the NGFR probes in CEM-Tk clones 5 and 7 confirmed our previous
observations by FACS analysis and GCV cytotoxic assays.
To determine the number of insertions of the vector in each clone, genomic DNA was digested with the restriction enzyme EcoRI, which cuts once within the provirus sequence (Figure 1A). Southern blot analysis showed single independent integration events in each clone (results not shown). PCR primers were designed along the SFCMM3 vector to amplify the
entire provirus sequence (Figure 1A). PCR analysis of genomic DNA
extracted from the CEM-Tk clones amplified bands of expected sizes when
specific primers were used to amplify fragment 1 (LTR1+/
HTK5 DNA sequence analysis of the integrated provirus in CEM-Tk clones To further analyze the provirus sequences, the HSV-Tk gene (fragment 2) was amplified from genomic DNA derived from the CEM-Tk clones and cloned. Sequence analysis showed that the small bands amplified by PCR (CEM-Tk clones 1, 2, 4, 8, 10, 11, and 12; Figure 4C) resulted from a deletion of 227 bp within the HSV-Tk gene sequence. The junctional region arose from the joining of a cryptic splice donor site (CAGG/GTGA, at position 1994 of the SFCMM3 vector) and a cryptic splice acceptor site (CCAG/GCCG, at position 2221 of the SFCMM3 vector).PCR and sequence analysis of transduced primary T lymphocytes Genomic DNA extracted from human primary T lymphocytes transduced with the SFCMM3 vector was analyzed by PCR for the HSV-Tk gene. One single band corresponding to the full-length HSV-Tk gene was amplified by PCR in the transduced primary T cells (results not shown). These results might indicate that the deletion observed in the CEM-Tk clones is a feature found only in the human T-cell lines. An alternative explanation is that the frequency of the deletion of the HSV-Tk gene in transduced primary T cells is below the level of detection of this PCR assay.To address the above question, a primer was designed at the junction of the deletion in the HSV-Tk gene to specifically amplify the truncated gene found in some of the CEM-Tk clones. The CEM-Tk clones that amplified a short band for the HSV-Tk gene (fragment 2, Figure 4C) also amplified a band of the expected size (446 bp) for the truncated HSV-Tk gene (results not shown). Using the primers specifically designed to amplify the truncated
HSV-Tk gene, the PCR assay was repeated on genomic DNA
extracted from primary T lymphocytes transduced with the SFCMM3
vector. A band of the expected size for the truncated HSV-Tk
gene was amplified from lymphocytes derived from 6 different persons
(Figure 5). These results indicate that
the truncated HSV-Tk gene is also present in the transduced
primary T-lymphocyte populations. The frequency of this event in
primary cells is probably lower than in the human T-cell lines because
it was observed only when the specific primer to amplify the deletion
junction of the truncated HSV-Tk gene was used. A fainter
band of 970 bp was also amplified in all cases, including the
nontransduced cells. Sequencing of this anomalous band revealed that it
did not correspond to any sequence of the SFCMM3 retroviral
vector or to any other sequence represented in the GenBank or EMBL
databases. It may represent some cellular sequences as yet
uncharacterized.
Genomic DNA extracted from human primary T lymphocytes transduced with
the G1Tk1SvNa vector was also analyzed by PCR for the HSV-Tk
gene. In this study 2 bands were identified in selected (TK800) and
unselected (TK0) transduced cells (Figure
6A). The 560-bp fragment corresponds to
the full-length HSV-Tk gene and gave the strongest signal,
compared with the smaller band of 333 bp, corresponding to the deleted
form of the HSV-Tk gene. This may be due to competition in
the PCR assay between the full-length and truncated HSV-Tk
forms, when the target present in the larger amount is preferentially
amplified. However, when transduced cells were first selected in G418
and then cultured in the presence of GCV (TK800 + GCV), the 333-bp
band became more intense. This indicates that GCV treatment resulted in
the enrichment of a population of cells expressing the truncated
HSV-Tk gene (Figure 6B). Interestingly, sequencing of the
333-bp PCR product showed the exact same deletion of 227 bp within the
HSV-Tk sequence (donor and acceptor sites at position 1871 and 2098, respectively, in the G1Tk1SvNa vector) as in the CEM and
primary T cells transduced with the SCFMM3 vector.
Frequency of truncation event With the G1Tk1SvNa vector, PCR analysis of 153 CEM transduced colonies showed that 14 contained the truncated form of the HSV-Tk gene, whereas 139 colonies had the full-length HSV-Tk gene, giving a truncation frequency of 9.15%. Forty-five colonies transduced with the SFCMM3 vector were analyzed by PCR, and 7 were found to contain the truncated gene (frequency, 15.5%).Identification of the truncated HSV-Tk gene in clinical samples Twelve patients received transduced CD3+ cells at the time of stem cell transplantation. Acute toxicity was not observed. Quantitative PCR for NeoR revealed an early increase of the circulating transduced T cells, followed by a progressive decrease over time with persistent, detectable, long-term (more than 800 days) circulation of gene-modified cells. Acute GVHD grade II developed in 3 patients, whereas chronic GVHD (skin and salivary glands) developed in 1 patient. Treatment with GCV alone was associated with complete remission (CR) in 2 patients with acute GVHD, but the addition of steroids was necessary to achieve CR in one patient. Long-lasting CR was associated with GCV treatment in the patient with chronic GVHD. Ganciclovir treatment resulted in a significant rapid decrease in circulating transduced T cells.38In vivo circulating transduced T cells containing the truncated form of
the HSV-Tk gene were observed in all 12 patients as early as
30 minutes after infusion up to 800 days after transplantation. Although quantification of both forms of the HSV-Tk gene
were not performed, PCR followed by Southern blot analysis suggested that the proportion of in vivo transduced T cells expressing the truncated HSV-Tk gene was present in a proportion similar to
or less than that observed in vitro (less than 10%) (Figure
7A). As illustrated in a representative
sample from one patient (Figure 7), GCV administered as treatment for
GVHD resulted in a decrease of the signal generated by the full-length
HSV-Tk gene, whereas the signal associated with the
truncated form of the HSV-Tk gene progressively increased.
Importantly, GCV treatment always significantly reduced the percentage
(85%-98%) and absolute number (76%-99.5%) of circulating transduced
T cells as determined by quantitative PCR of the
NeoR gene.19 Thus, an increasing
proportion of transduced T cells containing the truncated
HSV-Tk gene was present in a reduced number of circulating
transduced cells.
The HSV-Tk gene encodes an enzyme able to convert nontoxic prodrugs such as GCV and acyclovir to cytotoxic metabolites. Gene transfer strategies using this and other suicide gene/prodrug systems have been proposed as novel therapeutic modalities for the treatment of cancer.22-24 More recently, the use of suicide gene therapy has been extended for allogeneic stem cell transplantation. Donor T lymphocytes transduced with the HSV-Tk gene can be selectively removed from circulation by the administration of GCV. This would allow modulation of GVHD while preserving a significant graft-versus-leukemia (GvL) effect and immune reconstitution.10,11,13,38 The efficacy of the HSV-Tk/GCV system has been demonstrated in a number of in vitro and in vivo models. The use of this system for the treatment of cancer may offer additional advantages derived from the so-called bystander effect.25,26 In this situation nontransduced tumor cells can be killed by phosphorylated GCV released from the HSV-Tk-transduced tumor cells through gap junctions. This is essential for complete regression of the tumor.27 We have demonstrated that in transduced primary T cells, GCV-induced growth inhibition is not mediated through a bystander effect.28 In this study, we examined the effect of GCV in a mixture of transduced and nontransduced T cells (50/50) as well as in HUT-78 cells (CD4+ T-cell lymphoma cell line). In both instances, no evidence for killing mediated by a bystander effect was found. In the context of allo-SCT the absence of a bystander-effect in HSV-Tk-transduced T lymphocytes has important implications for the successful application of suicide gene strategies because it specifically allows the depletion from circulation of those cells responsible for the GVHD. The use of the HSV-Tk gene/GCV system was first proposed by Moolten and Wells.8 Later they observed in vivo the loss of HSV-Tk expression in transduced sarcoma and lymphoma tumor cells after GCV treatment.22,29 Similar observations have been confirmed in tumor cells derived from different tissues and animal models. Barba et al30 showed that genetically modified rat glioma cells expressing the HSV-Tk gene could be killed in culture after 14 days of GCV treatment. Eventually, some of the modified tumor cells became resistant to GCV. However, because of the bystander effect, inactivation of the HSV-Tk gene did not interfere with the outcome in vivo. In contrast, tumor regression after GCV treatment was not observed in nude mice bearing HSV-Tk-transduced adenocarcinoma cells.31 In this in vivo model, the bystander effect did not compensate for the faulty expression of the HSV-Tk gene in a small subset of transduced tumor cells. The mechanisms underlying the lack of functional expression of the
HSV-Tk gene in transduced tumor cells are poorly understood. Several explanations such as changes in cell susceptibility to GCV,
transient exit of tumor cells from the cell cycle, inactivation or loss
of the HSV-Tk gene, structural changes in the
HSV-Tk mRNA, or transient methylation events have been
proposed. Di Iani et al32 reported the lack of
HSV-Tk transgene expression in clones derived from U937
cells (a human hemopoietic malignant cell line) genetically engineered
to express the HSV-Tk gene and the bacterial GCV resistance in human primary T lymphocytes transduced with a retroviral vector carrying the HSV-Tk gene has been documented by different groups. We have previously described between 80% to 90% growth inhibition after GCV treatment of transduced rhIL-2-responding and NeoR T cells.28 These results suggest that at least 10% of the transduced populations are resistant to killing by GCV. In the first clinical trial using transduced donor T cells, Bonini et al12 observed that chronic GVHD developed in one patient. After the administration of GCV, the proportion of transduced donor cells fell from 11.9% to 2.8%. Complete depletion of transduced donor-derived T cells from circulation could not be achieved after further intensive treatment with GCV. Verzeletti et al14 further characterized this GCV resistance and suggested that it resulted from cell-cycle dependence of the HSV-Tk/GCV system rather than a molecular event occurring in the HSV-Tk gene sequence. GCV inhibition of HSV-Tk-expressing T cells requires cell division and should leave noncycling cells unaffected by the action of the drug.33 In addition, recent studies have shown that viral LTR-driven expression of a transgene (HSV-Tk in the present case) is dependent on the state of activation of target T cells.34 Any of these mechanisms could account for in vivo resistance of the gene-modified T cells to GCV. Using the SFCMM 3 retroviral vector, we found that some of the clones derived from transduced and selected CEM-Tk populations were not sensitive to GCV. The Southern blots revealed a shortened integrated provirus in the cell genome (Figure 5). PCR analysis of these clones indicated that the molecular events resulting in GCV-resistance occurred in the HSV-Tk gene sequence of the provirus (fragment 2; Figure 7). Comparison of the wild-type HSV-Tk gene with the deleted gene revealed a 227-bp deletion in the DNA sequence of the HSV-Tk gene. Mapping of the junctional region showed recombination at the cryptic splice donor and acceptor sites at positions 1994 and 2221 of the SFCMM3 or positions 1871 and 2098 for the G1Tk1SvNa vector, respectively. These findings suggest that in the producer cells, part of the mRNA derived from the provirus is recognized by the splicing machinery of the GP+envAm12 or PA317 cells, and this results in spliced, vector-derived mRNA. This results in the production of virus particles containing the full-length HSV-Tk gene, together with a small proportion carrying the aberrant HSV-Tk gene. This mechanism explains the transfer of the truncated HSV-Tk gene to the target cells. Northern blot analysis performed on the CEM-Tk clones has revealed the formation of aberrant HSV-Tk transcripts in those clones carrying the truncated gene (results not shown). Because these clones are resistant to killing by GCV a nonfunctional protein may be encoded from the aberrant HSV-Tk gene sequence. Yang et al35 have found resistant colonies in HSV-Tk transduced gastrointestinal tumor cells. Characterization of the resistant colonies demonstrated that the HSV-Tk gene was either partially (a 220-bp deletion) or completely deleted from the resistant HSV-Tk transduced cells. Interestingly, to rule out the possibility of an unknown cellular mechanism participating in the GCV resistance, they infected the retrovirally transduced-GCV resistant clones with an adenoviral vector containing the HSV-Tk gene. The GCV sensitivity was restored, suggesting the continuing capability of these cells to express a functional HSV-Tk protein. The demonstration that GCV treatment increases the proportion of truncated HSV-Tk-expressing donor T cells in vivo confirms that truncation of the HSV-Tk gene results in GCV resistance in vivo and so contributes to the persistence of gene-modified T cells after GCV treatment. Sorrentino et al36 and Abonour et al37 have reported similar observations when using retroviral vectors containing the MDR-1 cDNA for the transduction of hemopoietic stem cells. Expression of truncated and full-length MDR-1 mRNAs were found in bone marrow and spleen colony-forming cells in mice and also in the peripheral blood of patients undergoing autologous transplantation with transduced cells. They also demonstrated the formation of spliced and full-length transcripts in the producer cells, leading to the presence of truncated and full-length versions of the MDR-1 gene in the transduced products. The in vitro and the clinical data suggest that the use of the HSV-Tk gene/GCV system for cancer gene therapy and allo-SCT represents a realistic improvement for the clinic.38 In particular, GCV-sensitive acute and chronic GVHD were observed both in the Bonini study12 and in our study, suggesting that the proportion of GCV-sensitive donor T cells present in vivo are sufficient for therapeutic efficacy. However, GCV-induced selection of truncated HSV-Tk expressing donor T cells might result in subsequent GCV-resistance and deleterious alloreactivity. These results strongly support the idea that new suicide genes or optimized versions of the ones in use should be developed to achieve optimal killing efficiency of the genetically engineered cells. We are in the process of modifying the HSV-Tk gene sequence to remove one or both of the cryptic splice sites. This strategy will allow the development of an improved HSV-Tk gene for future clinical use.
Submitted May 2, 2000; accepted September 5, 2000.
Supported by the European Community (Biomed grant BMH4-CT97-2760); the Kay Kendall Leukaemia Fund; the Programme Hospitalier de Recherche Clinique; l'Association pour la Recherche sur le Cancer; la Ligue National contre Cancer; l'Association Française contre la Myopathie; le Minsistère de l'Enseignement Supérieur et de la Recherche; and Genetic Therapy/Novartis.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jane F. Apperley, Department of Haematology, Imperial College School of Medicine, Hammersmith Hospital, Ducane Road, London W12 0NN, United Kingdom; e-mail: j.apperley{at}ic.ac.uk.
1.
Szydlo R, Goldman JM, Klein JP, et al.
Results of allogeneic bone marrow transplants for leukemia using donors other than HLA-identical siblings.
J Clin Oncol.
1997;15:1767-1777 2. Vigorito AC, Azevedo WM, Marques JF, et al. A randomised, prospective comparison of allogeneic bone marrow and peripheral blood progenitor cell transplantation in the treatment of haematological malignancies. Bone Marrow Transplant. 1998;22:1145-1151[CrossRef][Medline] [Order article via Infotrieve]. 3. Graft-versus-host-disease: immunology, pathophysiology and treatment. In: Burakoff SJ,Degg HJ,Ferrara J,Atkinson K, eds. Hematology. New York: Marcel Dekker; 1990. 4. Aschan J, Carlens S, Hagglund H, Klaesson S, Mattsson J, Remberger M. Improved survival after bone marrow transplantation for early leukemia using busulfan-cyclophosphamide and individualized prophylaxis against graft-versus-host disease: a long-term follow-up. Clin Transplant. 1999;13:512-519[CrossRef][Medline] [Order article via Infotrieve]. 5. Murphy WJ, Blazar BR. New strategies for preventing graft-versus-host disease. Curr Opin Immunol. 1999;11:509-515[CrossRef][Medline] [Order article via Infotrieve].
6.
Kolb HJ, Schattenberg A, Goldman JM, et al.
Graft-versus-leukemia effect of donor lymphocyte transfusions in marrow grafted patients: European Group for Blood and Marrow Transplantation Working Party Chronic Leukemia.
Blood.
1995;86:2041-2050 7. Tiberghien P. "Suicide" gene for the control of graft-versus-host disease. Curr Opin Hematol. 1998;5:478-482[Medline] [Order article via Infotrieve].
8.
Moolten FL, Wells JM.
Tumor chemosensitivity conferred by inserted herpes thymidine kinase genes: paradigm for a prospective cancer control strategy.
Cancer Res.
1986;46:5276-5281
9.
Reardon JE.
Herpes simplex virus type 1 and human DNA polymerase interactions with 2'-deoxyguanosine 5'-triphosphate analogues: kinetics of incorporation into DNA and induction of inhibition.
J Biol Chem.
1989;264:19039-19044 10. Bordignon C, Bonini C, Verzeletti S, et al. Transfer of the HSV-tk gene into donor peripheral blood lymphocytes for in vivo modulation of donor anti-tumor immunity after allogeneic bone marrow transplantation. Hum Gene Ther. 1995;6:813-819[Medline] [Order article via Infotrieve]. 11. Tiberghien P, Cahn JY, Brion A, et al. Use of donor T-lymphocytes expressing herpes-simplex thymidine kinase in allogeneic bone marrow transplantation: a phase I-II study. Hum Gene Ther. 1997;8:615-624[Medline] [Order article via Infotrieve].
12.
Bonini C, Ferrari G, Verzeletti S, et al.
HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft-versus-leukemia.
Science.
1997;276:1719-1724 13. Link-CJ J, Burt RK, Traynor AE, et al. Adoptive immunotherapy for leukemia: donor lymphocytes transduced with the herpes simplex thymidine kinase gene for remission induction. Hum Gene Ther. 1998;9:115-134[Medline] [Order article via Infotrieve]. 14. Verzeletti S, Bonini C, Marktel S, et al. Herpes simplex virus thymidine kinase gene transfer for controlled graft-versus-host disease and graft-versus-leukemia: clinical follow-up and improved new vectors. Hum Gene Ther. 1998;9:2243-2251[Medline] [Order article via Infotrieve]. 15. Tiberghien P, Cahn JY, Contassot E, Ferrand C, Reynolds CW, Herve P. Gene transfer applied to the modulation of alloreactivity. Hematol Cell Ther. 1996;38:221-224[CrossRef][Medline] [Order article via Infotrieve]. 16. Packer RJ, Raffel C, Villablanca JG, et al. Treatment of progressive or recurrent pediatric malignant supratentorial brain tumors with herpes simplex virus thymidine kinase gene vector-producer cells followed by intravenous ganciclovir administration. J Neurosurg. 2000;92:249-254[Medline] [Order article via Infotrieve]. 17. Lyons RM, Forry-Schaudies S, Otto E, et al. An improved retroviral vector encoding the herpes simplex virus thymidine kinase gene increases antitumor efficacy in vivo. Cancer Gene Ther. 1995;2:273-280[Medline] [Order article via Infotrieve]. 18. Robinet E, Certoux JM, Ferrand C, et al. A closed culture system for the ex vivo transduction and expansion of human T lymphocytes. J Hematother. 1998;7:205-215[Medline] [Order article via Infotrieve]. 19. Maddens S, Tiberghien P, Contassot E, et al. Development of a competitive PCR method for in vitro and in vivo quantification of herpes simplex virus thymidine kinase and neomycin resistance-expressing cells used in a clinical trial. J Hematother. 2000;9:225-236. 20. Melo JV, Myint H, Galton DA, Goldman JM. P190BCR-ABL chronic myeloid leukaemia: the missing link with chronic myelomonocytic leukaemia? Leukemia. 1994;8:208-211[Medline] [Order article via Infotrieve]. 21. Brodie SJ, Lewinsohn DA, Patterson BK, et al. In vivo migration and function of transferred HIV-1-specific cytotoxic T cells. Nat Med. 1999;5:34-41[CrossRef][Medline] [Order article via Infotrieve].
22.
Moolten FL, Wells JM.
Curability of tumors bearing herpes thymidine kinase genes transferred by retroviral vectors.
J Natl Cancer Inst.
1990;82:297-300 23. Culver KW, Blaese RM. Gene therapy for cancer. Trends Genet. 1994;10:174-178[CrossRef][Medline] [Order article via Infotrieve]. 24. Moolten FL. Drug sensitivity ("suicide") genes for selective cancer chemotherapy. Cancer Gene Ther. 1994;1:279-287[Medline] [Order article via Infotrieve]. 25. Ishii MH, Agbaria R, Mullen CA, et al. Mechanism of "bystander effect" killing in the herpes simplex thymidine kinase gene therapy model of cancer treatment. Gene Ther. 1997;4:244-251[CrossRef][Medline] [Order article via Infotrieve].
26.
Princen F, Robe P, Lechanteur C, et al.
A cell type-specific and gap junction-independent mechanism for the herpes simplex virus-1 thymidine kinase gene/ganciclovir-mediated bystander effect.
Clin Cancer Res.
1999;5:3639-3644
27.
Freeman SM, Abboud CN, Whartenby KA, et al.
The "bystander effect": tumor regression when a fraction of the tumor mass is genetically modified.
Cancer Res.
1993;53:5274-5283
28.
Tiberghien P, Reynolds CW, Keller J, et al.
Ganciclovir treatment of herpes simplex thymidine kinase-transduced primary T lymphocytes: an approach for specific in vivo donor T-cell depletion after bone marrow transplantation?
Blood.
1994;84:1333-1341 29. Moolten FL, Wells JM, Heyman RA, Evans RM. Lymphoma regression induced by ganciclovir in mice bearing a herpes thymidine kinase transgene. Hum Gene Ther. 1990;1:125-134[Medline] [Order article via Infotrieve]. 30. Barba D, Hardin J, Ray J, Gage FH. Thymidine kinase-mediated killing of rat brain tumors. J Neurosurg. 1993;79:729-735[Medline] [Order article via Infotrieve]. 31. Zhang L, Wikenheiser KA, Whitsett JA. Limitations of retrovirus-mediated HSV-tk gene transfer to pulmonary adenocarcinoma cells in vitro and in vivo. Hum Gene Ther. 1997;8:563-574[Medline] [Order article via Infotrieve]. 32. Di IM, Casciari C, Ciurnelli R, et al. Retroviral transfer of herpes simplex virus-thymidine kinase and beta-galactosidase genes into U937 cells with bicistronic vector. Leuk Res. 1997;21:951-959[CrossRef][Medline] [Order article via Infotrieve].
33.
St Clair MH, Lambe CU, Furman PA.
Inhibition by ganciclovir of cell growth and DNA synthesis of cells biochemically transformed with herpesvirus genetic information.
Antimicrob Agents Chemother.
1987;31:844-849 34. Pollok KE, van der Loo JC, Cooper RJ, Kennedy L, Williams DA. Costimulation of transduced T lymphocytes via T cell receptor-CD3 complex and CD28 leads to increased transcription of integrated retrovirus. Hum Gene Ther. 1999;10:2221-2236[CrossRef][Medline] [Order article via Infotrieve]. 35. Yang L, Hwang R, Chiang Y, Gordon EM, Anderson WF, Parekh D. Mechanisms for ganciclovir resistance in gastrointestinal tumor cells transduced with a retroviral vector containing the herpes simplex virus thymidine kinase gene. Clin Cancer Res. 1998;4:731-741[Abstract].
36.
Sorrentino BP, McDonagh KT, Woods D, Orlic D.
Expression of retroviral vectors containing the human multidrug resistance 1 cDNA in hematopoietic cells of transplanted mice.
Blood.
1995;86:491-501 37. Abonour R, Williams DA, Einhorn L, et al. Efficient retrovirus-mediated transfer of the multidrug resistance 1 gene into autologous human long-term repopulating hematopoietic stem cells. Nat Med. 2000;6:652-658[CrossRef][Medline] [Order article via Infotrieve]. 38. Tiberghien P, Ferrand C, Lioure B, et al. Administration of herpes simplex-thymidine kinase- expressing donor T cells with a T-cell-depleted allogeneic marrow graft. Blood. 2000;97:61-70.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. Deschamps, P. Mercier-Lethondal, J. M. Certoux, C. Henry, B. Lioure, C. Pagneux, J. Y. Cahn, E. Deconinck, E. Robinet, P. Tiberghien, et al. Deletions within the HSV-tk transgene in long-lasting circulating gene-modified T cells infused with a hematopoietic graft Blood, December 1, 2007; 110(12): 3842 - 3852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ciceri, C. Bonini, S. Marktel, E. Zappone, P. Servida, M. Bernardi, A. Pescarollo, A. Bondanza, J. Peccatori, S. Rossini, et al. Antitumor effects of HSV-TK engineered donor lymphocytes after allogeneic stem-cell transplantation Blood, June 1, 2007; 109(11): 4698 - 4707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Kolb, C. Schmid, A. J. Barrett, and D. J. Schendel Graft-versus-leukemia reactions in allogeneic chimeras Blood, February 1, 2004; 103(3): 767 - 776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sauce, N. Rufer, P. Mercier, M. Bodinier, J.-P. Remy-Martin, A. Duperrier, C. Ferrand, P. Herve, P. Romero, F. Lang, et al. Retrovirus-mediated gene transfer in polyclonal T cells results in lower apoptosis and enhanced ex vivo cell expansion of CMV-reactive CD8 T cells as compared with EBV-reactive CD8 T cells Blood, August 15, 2003; 102(4): 1241 - 1248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Baum, J. Dullmann, Z. Li, B. Fehse, J. Meyer, D. A. Williams, and C. von Kalle Side effects of retroviral gene transfer into hematopoietic stem cells Blood, March 15, 2003; 101(6): 2099 - 2113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. F. Hartwig, M. Robbers, C. Wickenhauser, and C. Huber Murine acute graft-versus-host disease can be prevented by depletion of alloreactive T lymphocytes using activation-induced cell death Blood, April 15, 2002; 99(8): 3041 - 3049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sauce, M. Bodinier, M. Garin, B. Petracca, N. Tonnelier, A. Duperrier, J. V. Melo, J. F. Apperley, C. Ferrand, P. Herve, et al. Retrovirus-mediated gene transfer in primary T lymphocytes impairs their anti-Epstein-Barr virus potential through both culture-dependent and selection process-dependent mechanisms Blood, February 15, 2002; 99(4): 1165 - 1173. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
, nontransduced CEM cells; 
, transduced CEM-Tk clones.
;
1020 bp) is shown (C).
