| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Division of Hematology, University of
Washington, Seattle, WA.
With the recent cloning and characterization of thrombopoietin,
appreciation of the molecular events surrounding megakaryocyte (MK)
development is growing. However, the final stages of platelet formation
are less well understood. Platelet production occurs after the
formation of MK proplatelet processes. In a study to explore the
molecular mechanisms underlying this process, mature MKs isolated from
suspension murine bone marrow cell cultures were induced to form
proplatelets by exposure to plasma, and the role of various
cell-signaling pathways was assessed. The results showed that (1)
bis-indolylmaleimide I, which blocks protein kinase C (PKC) activation;
(2) down-modulation of conventional or novel classes of PKC by phorbol
myristate acetate; and (3) ribozymes specific for PKC Platelet formation represents the terminal stage of
megakaryocyte (MK) development. This process, during which a large
polyploid cell fragments into thousands of anucleate progeny, is
virtually unique in mammalian cell biology. In addition to its
intrinsic interest to cell biologists, the generation of platelets
holds much medical interest. Several clinical states characterized by inadequate platelet production, such as myelodysplasia, may be due, at
least in part, to failure of platelet formation from seemingly normal
numbers of MKs. Moreover, although thrombopoietin (TPO), the major
regulator of MK development, has been cloned and is undergoing clinical
testing, the therapeutic response is slow because of the long time
required for MK progenitor cells to mature into platelets.
Theoretically, direct stimulation of MK platelet formation would be
more rapid. It is clear that a better understanding of the mechanisms
of platelet formation may lead to improved therapies for
thrombocytopenia or pharmacologic inhibition of this process in the
treatment of thrombocytosis.
It has long been observed that fully mature MKs form proplatelets in
culture. Proplatelets are long cytoplasmic processes protruding from
the MK surface composed of platelet-sized nodes separated by
constrictions. The morphology and ultrastructure of in vitro
proplatelet formation have been well described.1,2 Recently, an excellent real-time morphologic demonstration of this
process was captured by videomicroscopy by Italiano et
al.3 Fragmentation of proplatelets can give rise to
functional platelets in culture.4 Moreover, proplatelets
have also been identified and characterized by electron microscopy in
bone marrow sections, providing strong evidence that they form in
vivo.5-7 In addition, the ability to form proplatelets in
culture is correlated with in vivo platelet production in the NF-E2
knockout mouse.8 It is becoming clear that proplatelet
formation is a major mechanism of normal platelet formation.
The molecular mechanisms controlling proplatelet formation are unclear.
Because of the dramatic morphologic changes that characterize this
process, cytoskeletal reorganization has been a focus of much study.
Microtubules have been demonstrated in proplatelet processes by both
electron and fluorescent microscopy.2,3,9,10 Moreover,
pharmacologic disruption of microtubule polymerization markedly
inhibits proplatelet formation,11-13 and their
stabilization results in abnormal proplatelet processes,13
suggesting that microtubule reorganization is also critical for this
event. However, although tubulin is critical for the
process,3,14 the precise role of actin in proplatelet
formation is less clear. In various studies, inhibition of actin
polymerization has been shown to enhance,13
inhibit,15 or cause abnormal proplatelets3 in different model systems. This discrepancy may be due to species differences or differing concentrations of the actin polymerization inhibitors used in the studies, or actin might perform different functions at different stages of proplatelet formation.
Several studies suggest that proplatelet formation is regulated by
extracellular signals. In serum-containing human whole bone marrow
cultures, only small numbers of proplatelets are observed. However, if
purified MKs are cultured in the absence of serum, many proplatelets
are detectable.16 These data suggest that certain cells or
serum may exert an inhibitory effect on human proplatelet formation.
Thrombin has been shown to be a component in serum that inhibits
proplatelet formation in vitro.17,18 In contrast, coating
the culture vessels with various extracellular matrices10
or adding plasma4,9 stimulates proplatelet formation. The
extracellular matrix components that promote proplatelet formation have
been identified as vitronectin19,20 and
glycosaminoglycan-serglycin21 in different models. A role
for these proplatelet promoting factors is particularly attractive
because proplatelet formation occurs in the perivascular areas of the
marrow, precisely where these substances reside.7,22
Despite these morphologic and cell culture clues, however, the specific
signal transduction pathways governing proplatelet formation are still
poorly defined. In the present series of experiments, we used a murine
model of MK proplatelet formation and began to explore the molecular
mechanisms of this process.
Reagents
Proplatelet assay
Western blot analysis
PKC ribozymes (R1, R2, fluorescein isothiocyanate
[FITC]-conjugated ribozyme, and a control molecule called RC) were gifts generously provided by Dr Mouldy Sioud (Norwegian Radium Hospital, Oslo, Norway). The binding site for the R1 ribozyme is
5'GGGGGACCAUGGCUGACG3', and the site for the R2 is
5'GGGGGACCAUGGCUGACGUUU3'. The control ribozyme binding sequence is
identical to R1 but in the reverse orientation. The method of liposomal
transfection was performed as described.24 The
concentrations of ribozyme and DOTAP liposomal transfection
reagent (Boehringer Mannheim) were determined from 2 pilot experiments
using FITC-conjugated ribozyme. The transfection mixtures were prepared
by mixing DOTAP in OptiMEM I (Life Technologies, Rockville, MD) and
Ribozyme in OptiMEM I and incubating at room temperature for 30 minutes
before adding to cells. The volume of the added ribozyme/DOTAP mixtures was 10 µL per 100 µL of cells in each well. The final concentration of DOTAP was 10 µg/mL and the final concentration of each ribozyme was 2 µmol/L. Under these conditions, about 50% of the cells were FITC positive as observed by fluorescent microscopy at 24 hours after transfection.
Immunofluorescent microscopy MKs were cultured under the conditions described earlier. After 48 hours in human plasma, cytospins were prepared on a Superfrost/plus microscope slide (Fisher Scientific, Pittsburgh, PA). Cells were fixed for 10 minutes with 10% neutral-buffered formalin (Sigma) and permeabilized for 5 minutes with 0.1% Triton X-100 in phosphate-buffered saline (PBS). The slides were then blocked for at least 1 hour at room temperature by 10% fetal bovine serum (Hyclone, Logan, UT) in PBS. For polymerized actin staining, 1:100 rhodamine-conjugated phalloidin (Molecular Probes, Eugene, OR) in 3% BSA/TBS (0.1 mol/L Tris, pH 7.4, 150 mmol/L NaCl, 0.1% Triton X-100) was added for 1 hour at room temperature. For PKC staining, 1:100 anti-PKC antibody (Transduction Labs) in 3% BSA/TBS was added and incubated at 4°C overnight. Slides were washed with PBS for 10 minutes, 3 times each. FITC-conjugated goat-antimouse antibody (American Qualex, La Mirada, CA) 1:100 in 1% BSA/TBS was then added and incubated at room temperature for 1 hour. Slides were washed 3 times with PBS, mounted with Vectashield mounting medium with DAPI (4',6-diamidino-2-phenylindole) or Vectashield mounting medium with propidium iodide to stain nuclear DNA (Vector Laboratories, Burlingame, CA), and examined by fluorescent microscopy. For PKC/actin double staining, 1:100 rhodamine-conjugated phalloidin was added concomitantly with the secondary antibody. In some experiments, MKs were fixed in culture with 2% paraformaldehyde for 10 minutes to preserve proplatelet processes. Rhodamine-phalloidin/DAPI staining was then performed on cytospin preparations.
Inhibition of PKC reduces proplatelet formation To study the molecular basis of the final stages of platelet formation, we developed a murine model of proplatelet formation. In contrast to other animal models that use various extracellular matrix materials as a substratum for proplatelet formation,10,18-20 very few proplatelet-bearing murine MKs were found in tissue culture dishes coated with vitronectin, collagen, or Matrigel. MKs grown in a serum-free medium (IMDM containing 1% Nutridoma) do not produce proplatelets, as opposed to that reported for human MKs.15 However, a number of proplatelet-bearing MKs were seen in cultures containing either serum or plasma. Culture medium with 10% human plasma was found to maximally and reproducibly stimulate proplatelet formation. At 48 hours of culture, about 10% of BSA-gradient-purified mature MKs were actively forming numerous proplatelet processes (Figure 1A), a figure that likely underestimates the true number of MKs that form proplatelets in such cultures because of the rapid elimination of MKs that have completed platelet formation.To investigate the intracellular molecular pathways responsible for
proplatelet formation, we tested various signaling inhibitors. The
extracellular signal-regulated protein kinase (ERK)-mitogen-activated protein kinase (MAPK) pathway inhibitor PD 98059 (at 50 µmol/L), the
protein kinase A (PKA) inhibitor KT 5720 (at 200 nmol/L), or the p38
MAPK pathway inhibitor SB 203580 (at 20 µmol/L) did not inhibit
proplatelet formation or morphology at concentrations we have
previously found to affect other aspects of MK
development25 (data not shown). At higher doses of these
inhibitors, the number of proplatelet-forming MKs was decreased, but
the viable cell numbers determined by MTT assay were also markedly
affected, suggesting nonspecific toxicity. The
phosphoinositide-3-kinase (PI3K) inhibitor Ly 294002 (at 8 µmol/L)
also decreased proplatelet-bearing MK numbers and total MK numbers
proportionately, reflecting the importance of this pathway on cell
survival26 but making it difficult to determine whether
this signaling mediator also plays an independent role in proplatelet
development. Only PKC inhibitors at the indicated doses could markedly
inhibit proplatelet formation without significantly affecting cell
survival (Figure 1B). Addition of BIM and incubation of cells with PMA
for 48 hours both inhibited PKC activity and expression and decreased
the number of MKs bearing proplatelets. PKC
PKC , , and , responds to stimulation with both calcium and
diacylglycerol (DAG). The novel class, isoforms , , , and ,
responds to DAG, but not calcium. Finally, the atypical class, isoforms
, , and , does not respond to either stimulus. Chronic stimulation by PMA, a DAG analog, down-modulates expression of the
DAG-responsive conventional and novel isoforms of PKC. Because proplatelet formation is markedly inhibited by this agent, one or more
members of the first 2 classes of PKC are likely to play an important
role in proplatelet formation. The expression of conventional and novel
isoforms of PKC was thus investigated in primary MKs by Western blot
analysis. We found that PKC isoforms , , , and are
expressed in murine MKs, but that the isoform is not
(Figure 2A).
To confirm that PMA actually down-modulates PKC isoforms in MKs, we
tested the expression of PKC To establish appropriate transfection methods and to quantitate
transduction efficiencies, we transfected an FITC-conjugated ribozyme
into primary MKs using a liposomal method. The conditions of culture
were similar to the proplatelet assay. Twenty-four hours after
incubation, cells were examined under fluorescent microscopy to
evaluate ribozyme uptake. About 50% of cells were FITC positive. Next,
2 PKC
Correlation between actin reorganization and proplatelet formation The tremendous morphologic change seen during MK proplatelet formation suggests that a massive cytoskeletal reorganization occurs as part of the process. Actin dynamics during MK proplatelet formation were investigated using rhodamine-conjugated phalloidin to detect alterations in the level of polymerized actin and its subcellular distribution. In plasma-free cultures of murine MKs, low levels of polymerized actin are evenly distributed throughout the cytoplasm (Figure 4A) and there is no proplatelet formation. In contrast, in plasma-containing cultures that promote proplatelet formation, polymerized actin aggregates are found in most cells concentrated in a mass (Figure 4B). The DNA of the same cells was stained with DAPI in Figure 4E, indicating that these actin aggregates are not associated with the nucleus. Down-modulation of PKCs by incubation with PMA for the duration of the culture prevented actin reorganization in the plasma-containing MK cultures (Figure 4D). The result was the same for another PKC inhibitor, BIM, at 3 µmol/L (data not shown). Proplatelet processes could be observed emanating from MKs in another experiment in which the cells were preserved with 2% paraformaldehyde in culture before cytospin preparation. By rhodamine-phalloidin staining, approximately 50% to 60% of cells display actin aggregation and 10% of cells form proplatelets. Polymerized actin aggregation can be seen in the proplatelet-forming MKs (Figure 4C,F). In these cells, the actin aggregates can be seen adjacent to the base of proplatelet formation.
Thrombin has been reported to cause actin aggregates in primary MKs.28 Because there may be trace amounts of thrombin in plasma, we used a thrombin inhibitor in additional studies; actin polymerization, actin aggregation, and proplatelet formation were not inhibited by the specific thrombin inhibitor hirudin (data not shown). Therefore, thrombin is not responsible for this cytoskeletal change. To begin to determine whether plasma-induced MK actin
reorganization plays an important role in proplatelet formation, and whether this represents an important target for PKC inhibition, we
interfered with actin dynamics by 2 other experimental manipulations: MK integrin blockade and inhibition of actin polymerization. Using 2 disintegrins, including kistrin, a snake venom-derived,
broad-spectrum disintegrin, and the
PKC distributed throughout the cells, possibly primarily localized
to the cell membrane. In the presence of plasma, when MKs were forming
proplatelets, PKC was localized in a ring- or ball-like pattern in
the cytoplasm of the cells (Figure 6B). This distribution was not found
when cells were stained with the isotype-matched primary antibody
control. After exposure to PMA for 48 hours, PKC expression was
markedly decreased (Figure 6C), consistent with the Western blot result (Figure 2B). No specific change in the pattern of staining of PKC
and was detectable by immunostaining in the presence or absence of
plasma or PMA (data not shown).
To determine whether PKC isoforms localize to actin during proplatelet
formation, we triply stained MKs for F-actin, PKC isoforms, and DNA. As
shown in Figure 7, polymerized actin and
PKC
Although TPO is the major regulator of MK development, by itself the hormone is not sufficient to promote maximal proplatelet formation in culture.28-30 Identification of (an)other extracellular signal(s) affecting this process is likely to be very useful in controlling platelet production clinically. To identify the intracellular signaling pathways responsible for proplatelet formation, we tested inhibitors of the PI3K, ERK, p38 MAPK, PKA, and PKC pathways in mature murine MK cultures. The major findings of our study are that blockade of PKC function seriously impairs MK proplatelet formation and that the kinase is redistributed to a large aggregate of F-actin that forms only under conditions associated with proplatelet development. PKC inhibition, secondary to exposure to PMA or incubation with BIM, substantially blocked proplatelet formation at inhibitor levels that avoided general cellular toxicity. Inhibition of MAPKs, PKA, and PI3K failed to affect proplatelet formation at inhibitor concentrations that avoid cell survival or proliferation effects. More than 10 isoforms of PKC have been described that differ in their
tissue-specific expression, mechanisms of control, substrates, and
roles in cellular physiology. Isoform-specific inhibition of PKC could
provide a rational target for pharmacologic therapy of disorders linked
to specific PKC pathways. Clinical trials of PKC isoform inhibition are
underway in patients with cancer and other diseases. Therefore, we
sought to identify the specific isoforms of PKC involved in proplatelet
process formation. Specific inhibition of PKC The pathway downstream of PKC Recently, a PKC In this study, we have shown that proplatelet formation was markedly
inhibited by kistrin, a broad-spectrum disintegrin, which suggests that
integrin activation may play an important role in this process. This
result is consistent with previous studies showing that some components
of the extracellular matrix induce proplatelet formation in bovine and
guinea pig MKs in serum-containing cultures.10,19 Notably,
EMF-10, a disintegrin relatively specific for integrin A notable feature of the murine model of proplatelet formation
described in this work is the changes induced in cellular actin polymerization. Aggregation of polymerized actin occurred in most of
the cells under proplatelet-promoting conditions, but was markedly decreased in the absence of plasma, in the presence of a disintegrin, when actin polymerization was inhibited, or when cultured with PKC
inhibitors, all of which blocked proplatelet formation. Therefore, actin reorganization correlates well with proplatelet formation, suggesting (but not yet proving) a cause-effect relationship. Supporting this hypothesis, actin aggregation is detectable in proplatelet-forming MKs (Figure 4D). We also found that PKC In summary, an experimental model of proplatelet formation in murine
MKs has been developed. Proplatelet formation is inhibited by
disintegrins and PKC inhibitors, suggesting that integrin signaling and
PKC play important roles in this process. Actin aggregation is induced
in MKs only under conditions that promote proplatelet formation.
Additionally, prevention of actin polymerization by cytochalasin
inhibits proplatelet formation. These findings suggest that actin
polymerization may also be important for this process. Because PKC
We thank Drs Stefan Niewiarowski, Mouldy Sioud, and Donald Foster for kindly providing the vital reagents.
Submitted April 5, 2000; accepted September 1, 2000.
Supported by Chulalongkorn University, Bangkok, Thailand (P.R.) and National Institutes of Health grants R01 CA31615 and R01 DK49855 (K.K.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Kenneth Kaushansky, Division of Hematology, Box 357710, University of Washington, Seattle, WA 98195; e-mail: kkaushan{at}u.washington.edu.
1. Haller CJ, Radley JM. Time-lapse cinemicrography and scanning electron microscopy of platelet formation by megakaryocytes. Blood Cells. 1983;9:407-418[Medline] [Order article via Infotrieve].
2.
Cramer EM, Norol F, Guichard J, et al.
Ultrastructure of platelet formation by human megakaryocytes cultured with the Mpl ligand.
Blood.
1997;89:2336-2346
3.
Italiano JE Jr, Lecine P, Shivdasani RA, Hartwig JH.
Blood platelets are assembled principally at the ends of proplatelet processes produced by differentiated megakaryocytes.
J Cell Biol.
1999;147:1299-1312
4.
Choi ES, Nichol JL, Hokom MM, Hornkohl AC, Hunt P.
Platelets generated in vitro from proplatelet-displaying human megakaryocytes are functional.
Blood.
1995;85:402-413 5. Tavassoli M, Aoki M. Migration of entire megakaryocytes through the marrow-blood barrier. Br J Haematol. 1981;48:25-29[Medline] [Order article via Infotrieve].
6.
Radley JM, Scurfield G.
The mechanism of platelet release.
Blood.
1980;56:996-999 7. Becker RP, De Bruyn PP. The transmural passage of blood cells into myeloid sinusoids and the entry of platelets into the sinusoidal circulation; a scanning electron microscopic investigation. Am J Anat. 1976;145:183-205[CrossRef][Medline] [Order article via Infotrieve].
8.
Lecine P, Villeval JL, Vyas P, Swencki B, Xu Y, Shivdasani RA.
Mice lacking transcription factor NF-E2 provide in vivo validation of the proplatelet model of thrombocytopoiesis and show a platelet production defect that is intrinsic to megakaryocytes.
Blood.
1998;92:1608-1616
9.
Leven RM, Yee MK.
Megakaryocyte morphogenesis stimulated in vitro by whole and partially fractionated thrombocytopenic plasma: a model system for the study of platelet formation.
Blood.
1987;69:1046-1052
10.
Topp KS, Tablin F, Levin J.
Culture of isolated bovine megakaryocytes on reconstituted basement membrane matrix leads to proplatelet process formation.
Blood.
1990;76:912-924
11.
Radley JM, Haller CJ.
The demarcation membrane system of the megakaryocyte: a misnomer?
Blood.
1982;60:213-219 12. Handagama PJ, Jain NC, Feldman BF, Farver TB, Kono CS. In vitro platelet release by rat megakaryocytes: effect of heterologous antiplatelet serum. Am J Vet Res. 1987;48:1147-1149[Medline] [Order article via Infotrieve].
13.
Tablin F, Castro M, Leven RM.
Blood platelet formation in vitro: the role of the cytoskeleton in megakaryocyte fragmentation.
J Cell Sci.
1990;97:59-70
14.
Lecine P, Italiano JE, Kim SW, Villeval JK, Shivdasani RA.
The hematopoietic-specific beta 1 tubulin participates in a pathway of platelet biogenesis dependent on the transcription factor NF-E2.
Blood.
2000;96:1366-1373 15. Handagama PJ, Feldman BF, Jain NC, Farver TB, Kono CS. In vitro platelet release by rat megakaryocytes: effect of metabolic inhibitors and cytoskeletal disrupting agents. Am J Vet Res. 1987;48:1142-1146[Medline] [Order article via Infotrieve]. 16. Norol F, Vitrat N, Cramer E, et al. Effects of cytokines on platelet production from blood and marrow CD34+ cells. Blood. 1998;1:830-843. 17. Radley JM, Hartshorn MA, Green SL. The response of megakaryocytes with processes to thrombin. Thromb Haemost. 1987;58:732-736[Medline] [Order article via Infotrieve]. 18. Hunt P, Hokom MM, Wiemann B, Leven RM, Arakawa T. Megakaryocyte proplatelet-like process formation in vitro is inhibited by serum prothrombin, a process which is blocked by matrix-bound glycosaminoglycans. Exp Hematol. 1993;21:372-381[Medline] [Order article via Infotrieve]. 19. Leven RM, Tablin F. Extracellular matrix stimulation of guinea pig megakaryocyte proplatelet formation in vitro is mediated through the vitronectin receptor. Exp Hematol. 1992;20:1316-1322[Medline] [Order article via Infotrieve]. 20. Leven RM. Differential regulation of integrin-mediated proplatelet formation and megakaryocyte spreading. J Cell Physiol. 1995;163:597-607[CrossRef][Medline] [Order article via Infotrieve]. 21. Hunt P, Hokom MM, Hornkohl A, Wiemann B, Rohde MF, Arakawa T. The effect of the platelet-derived glycosaminoglycan serglycin on in vitro proplatelet-like process formation. Exp Hematol. 1993;21:1295-1304[Medline] [Order article via Infotrieve]. 22. Scurfield G, Radley JM. Aspects of platelet formation and release. Am J Hematol. 1981;10:285-296[Medline] [Order article via Infotrieve].
23.
Drachman JG, Sabath DF, Fox NE, Kaushansky K.
Thrombopoietin signal transduction in purified murine megakaryocytes.
Blood.
1997;89:483-492
24.
Myklebust JH, Smeland EB, Josefsen D, Sioud M.
Protein kinase C-alpha isoform is involved in erythropoietin-induced erythroid differentiation of CD34(+) progenitor cells from human bone marrow.
Blood.
2000;95:510-518
25.
Rojnuckarin P, Drachman JG, Kaushansky K.
Thrombopoietin-induced activation of the mitogen-activated protein kinase (MAPK) pathway in normal megakaryocytes: role in endomitosis.
Blood.
1999;94:1273-1282 26. Geddis AE, Miyakawa Y, Rojnuckarin P, Fox NE, Kaushansky K. Effects of PI3-kinase inhibition on Mpl signaling in engineered receptor bearing cells and in immature marrow megakaryocytes (MKs). Blood. 1999;92:654a. 27. Sioud M, Sorensen DR. A nuclease-resistant protein kinase C alpha ribozyme blocks glioma cell growth. Nat Biotechnol. 1998;16:556-561[CrossRef][Medline] [Order article via Infotrieve]. 28. Choi ES, Hokom MM, Chen JL, et al. The role of megakaryocyte growth and development factor in terminal stages of thrombopoiesis. Br J Haematol. 1996;95:227-233[Medline] |