|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Department of Immunology and Cell Biology and
the Department of Immunochemistry and Biochemical Microbiology,
Research Center Borstel, Center for Medicine and Biosciences, Borstel,
Germany; the Division of Environmental Dermatology and Allergology
GSF/TUM, Munich, Germany; and the Department of Orthopedic Surgery,
Medical University Lübeck, Germany.
Bacterial lipopolysaccharide (LPS, endotoxin) is a ubiquitous
component of dust and air pollution and is suspected to contribute after inhalation to an activation of eosinophils in bronchial tissues
of asthmatic patients, provoking inflammatory and allergic processes.
We were therefore interested in the interaction of eosinophil
granulocytes with LPS and have examined the activation of and uptake to
human peripheral blood eosinophils by LPS. Eosinophils were stimulated
by LPS and the endotoxic component lipid A and the release of tumor
necrosis factor alpha (TNF- Human eosinophils, like other granulocytes, are
terminally differentiated effector cells that are recruited from the
bloodstream into tissue sites during inflammatory, particularly
allergic, reactions.1 In asthmatic patients, the airways
contain an increased number of eosinophils and the severity of their
asthmatic symptoms correlates with the number of eosinophils in the
bronchial tissue.1-3 Eosinophils synthesize and release a
number of substances, including leukotrienes, and a variety of
granule-associated proteins such as eosinophil cationic protein (ECP).
If released inappropriately, these substances contribute to tissue
damage and to the pathogenesis of allergic diseases.1-4 In
addition to their capacity to release lipid mediators and cytotoxic
granule proteins, eosinophils may contribute to the inflammatory
process through expression and synthesis of cytokines including tumor
necrosis factor alpha/beta (TGF- Although stimuli such as calcium ionophore and ionomycin have been
found capable of eliciting cytokine expression in eosinophils in
vitro,8,9 physiologic stimuli and the mechanisms that are
involved in the regulation of eosinophil cytokine responses remain
largely unknown. A potent candidate stimulus is lipopolysaccharide (LPS, endotoxin), the major constituent of the outer membrane of
gram-negative bacteria.10 LPS is present in the upper
respiratory tract,11 and its levels increase in the
infected and inflamed state locally and systemically. Furthermore, LPS
is a continuous ingredient of the environment, including air
pollution.12,13 In this context, LPS has been detected in
a variety of dust extracts, and it has been suggested that chronically
inhaled airborne endotoxin could contribute to the development or the
enhancement of several chronic obstructive bronchial diseases,
including asthma.12,14-19 Inhalation of low doses of
endotoxins has been reported to contribute to bronchial constriction in
asthmatic patients.16-18 Hence, in addition to allergens,
LPS inhalation could further activate myeloic cells, including
eosinophils, thus exacerbating the ongoing inflammatory process.
To our knowledge, the only evidence for stimulation of human
eosinophils by LPS has been provided by the work of Takanaski et
al,20 showing release of GM-CSF, TNF- In this report, we demonstrate that the inflammatory agent LPS and its
endotoxic principle lipid A are activators of secretion of both the
inflammatory cytokine TNF- Lipopolysaccharide, lipid A, and lipid A partial structure
3H-LPS was biosynthetic radiolabeled and isolated from the
E coli K-12 strain LCD25.34 This
preparation was obtained from LIST Biological Laboratories, Campbell.
Reagents and antibodies
Eosinophil isolation Blood was drawn from healthy nonatopic volunteers and separated by density gradient centrifugation with Ficoll-Isopaque (Pharmacia, Freiburg, Germany). The bottom layer containing neutrophils, eosinophils, and erythrocytes was harvested. Erythrocytes were eliminated by hypotonic lysis. Granulocytes were resuspended in phosphate-buffered saline-bovine serum albumin (PBS-BSA) 0.4%, washed, and incubated for 40 minutes at 4°C with anti-CD16-conjugated micromagnetic beads (Miltenyi Biotec GmbH, Bergisch-Gladbach, Germany). On passing through the magnetic column (MACS, Miltenyi Biotec GmbH), neutrophils bound to the beads were retained within the column, whereas eosinophils were passed through and collected. In each preparation, an eosin stain of the cells, which is specific for eosinophils, was performed on a cytospin smear containing a count of at least 500 cells to ensure pure eosinophil preparation. The purification procedure resulted in a highly purified preparation of eosinophils (more than 98%).Isolation of peripheral blood mononuclear cells and monocytes Peripheral blood mononuclear cells (PBMCs) from healthy donors were obtained from the top layer after density gradient centrifugation on Ficoll-Isopaque (Pharmacia). After repeated washing in HBSS (Biochrom, Berlin, Germany), monocytes were isolated by counterflow elutriation using the JE-6B elutriator system (Beckmann Instruments, Palo Alto, CA) as described previously.35TNF- For the stimulation experiments, eosinophils
(2 × 106/mL) were treated with LPS or lipid A for 16 hours at 37°C (under 5% CO2) in 200-µL cultures
(triplicate wells) in U-form microtiter plates (Greiner,
Nürtingen, Germany). For inhibition studies, anti-CD14 moAb
(MEM-18) or the antagonistic compound 406 was added at 4°C to the
cells for 20 minutes before stimulation with LPS or lipid A. After
incubation, supernatants were harvested and analyzed for cytokine
activity or ECP content. The concentration of TNF- Uptake of 3H-LPS For determination of 3H-LPS uptake, eosinophils, PBMCs, or monocytes were seeded in 24-well plates (2 × 106 cells/mL). Incubation with 3H-LPS was performed in the presence of 10% human serum for 1 hour at 37°C, cells were washed 3 times with PBS and lysed in PBS containing 2% SDS. Tritium counting of the lysates was performed in a liquid scintillation counter (Packard). In blocking experiments, eosinophils were pretreated with anti-CD14 moAb (MEM-18), the isotype control IgG1 (Sigma), the antagonistic compound 406, or unlabeled LPS for 30 minutes.Flow cytometry Flow cytometric analysis were performed using a FACS-Calibur (Becton Dickinson, Heidelberg, Germany). For immunofluorescent staining, anti-CD14-FITC moAb (My4-FITC; IgG2b) from Coulter were used. The cells (105/mL) were washed, resupended in 100 µL of azide-PBS and incubated with the FITC-labeled anti-CD14 antibodies for 30 minutes at 4°C. Incubation was stopped by adding 1.5 mL ice-cold azide-PBS. After washing, the cells were resuspended in 400 µL azide-PBS. Unlabeled cells and cells incubated with the isotype (IgG2b-FITC, Sigma) were used as controls.Reverse transcriptase-polymerase chain reaction Eosinophil and monocyte messenger RNA (mRNA) was isolated from 2 × 106 cells using oligo-dT magnetic beads (Dynal, Hamburg, Germany), according to the manufacturer's instructions. Synthesis of complementary DNA (cDNA) was performed with Oligo-dT17 as the primer for reverse transcriptase (Superscript, Gibco-BRL, Eggenstein, Germany) in the presence of 650 U/mL RNase-inhibitor. Thirty cycles of amplification of cDNA was conducted in an automatic DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) using an annealing temperature of 52°C (hCD14) or 58°C (hTLR2 and hTLR4). For the amplification of 2 µL cDNA, 200 µM deoxynucleotide triphosphate (Pharmacia), 1.25 units Taq polymerase (Gibco-BRL), and gene-specific sense and antisense primers (1 µM for hCD14, hTLR2, and hTLR4, or 0.1 µM for -actin) were used at a
final volume of 50 µL. PCR primer used were for hCD14
(ACTTATCGACCATGGAGC and AGGCATGGTGCCGGTTA), -actin
(AGCGGGAAATCGTGCGTG and CAGGGTACATGGTGGTGCC), hTLR2 (CACCGTTTCCATGGCCTG
and GGACTTTATCGCAGCTCT), and hTLR4 (CTGGCTGCATAAAGTATGGT and
ATAGATGTTGCTTCCTGCCA). All PCR products and the molecular weight marker
VI (pBR328 DNA × BglI + pBR328 DNA × HinfI, Boehringer, Mannheim, Germany) were resolved by 1.5%
agarose gel electrophoresis, and DNA bands were visualized by staining
the gel with 0.01 µg/mL ethidium bromide.
Statistics Each experiment was performed at least 3 times with cells from different donors. From these experiments, a typical one is shown demonstrating representative results. The results represent the mean ± SD of triplicate cultures. P values, if demonstrated, are estimated by the Student t test.
LPS and lipid A-induced cytokine production in eosinophils First, we investigated the ability of LPS and lipid A to induce the cytokine TNF- . Eosinophils (2 × 106/mL) were
stimulated with increasing concentrations of LPS or lipid A for 16 hours, supernatants were harvested, and TNF- content was determined
by ELISA. The results show that LPS and lipid A are able to induce
TNF- production in a dose-dependent manner (Figure
1A,B). The optimal biologic activity of
LPS and lipid A in inducing TNF- is expressed at a concentration of
10 ng of LPS or 10 000 ng of lipid A per milliliter.
LPS- and lipid A-induced eosinophil cationic protein production in human eosinophils To ensure the activation of human eosinophils by LPS and lipid A, the release of an eosinophil-specific protein was determined. Eosinophils were stimulated for 16 hours, supernatants were harvested, and ECP was measured by RIA. The results demonstrate that eosinophils were able to release ECP after stimulation with LPS and lipid A in a dose-dependent manner (Figure 1C,D).Effect of anti-CD14 moAb and lipid A partial structures on LPS-induced cytokine release by eosinophils To find out whether the LPS-induced TNF- release by human
eosinophils was CD14 dependent, eosinophils (2 × 106/mL)
were preincubated in the presence of various concentrations of
anti-CD14 moAb (MEM-18) for 20 minutes at 4°C. In addition, the use
of compound 406, a synthetic antagonistic lipid A partial structure,
showed that interaction of LPS with eosinophils is similar to that
found in monocytes and neutrophils. After 16 hours of stimulation with
LPS (100 ng/mL), supernatants were harvested and the TNF- content
was determined by ELISA. Whereas the anti-CD14 moAb or compound 406 alone was not able to induce TNF- production in eosinophils, both
reagents inhibited LPS-induced release of TNF- (Figure
2A,B). Mouse IgG1, which was used as an
isotype control, could not reduce the LPS-induced monokine
production.
Effect of anti-CD14 moAb and lipid A partial structures on LPS-induced release of ECP in eosinophils This experiment was performed to prove whether the LPS-induced ECP release was also CD14 dependent. To answer this question, eosinophils (2 × 106/mL) were preincubated in the presence of various concentrations of the anti-CD14 moAb (MEM-18) or the lipid A partial structure compound 406 for 20 minutes at 4°C. After 16 hours of stimulation with LPS (100 ng/mL), supernatants were harvested, and ECP content was determined by RIA. The anti-CD14 moAb or compound 406 alone was not able to induce ECP production in eosinophils. The results show that anti-CD14 moAb and compound 406 both blocked the LPS-induced release of ECP (Figure 2A,B). Mouse IgG1, which was used as an isotype control, could not reduce the LPS-induced ECP production.Specific 3H-LPS uptake by human eosinophils In further studies, we compared the uptake of 3H-LPS by eosinophils, mononuclear cells, and monocytes. It was found that all cells showed dose-dependent uptake of 3H-LPS. However, the 3H-LPS uptake of monocytes and mononuclear cells was considerably higher than the 3H-LPS uptake of eosinophils (Figure 3). A statistical significant (P < .05) uptake of 3H-LPS by eosinophils was observed with 100 ng/mL or more.
Next, we analyzed the specificity of 3H-LPS uptake by human
eosinophils by using unlabeled LPS. For further characterization of the
structural requirement of 3H-LPS uptake of eosinophils, we
also investigated the inhibiting activity of anti-CD14 moAb and
compound 406 in this system. Cells were pretreated with unlabeled LPS,
compound 406 (Figure 4A), or with
anti-CD14 moAb (MEM-18) (Figure 4B) for 30 minutes, followed by an
incubation with 3H-LPS. The specificity of the uptake of
3H-LPS could be confirmed by the addition of unlabeled LPS
in eosinophils as well as in PBMCs and monocytes (Figure 4A). In
addition, compound 406 and anti-CD14 moAb also led to a drastic
decrease of 3H-LPS uptake in eosinophils (Figure 4A,B). No
effect on 3H-LPS uptake of eosinophils was observed after
preincubation with an isotype moAb, IgG1 (Figure 4B).
Expression of CD14 on human eosinophils Inhibition of LPS-stimulation and 3H-LPS uptake in human eosinophils by anti-CD14 moAb indicated the presence of CD14 on the surface of these cells. Proof for the expression of this membrane molecule was obtained by anti-CD14 moAb and flow cytometric analysis. The results of these experiments showed an expression of CD14 on eosinophils to a degree less than that found on neutrophils (Figure 5). However, it should be mentioned that, in 2 of the 10 experiments, a similar degree of CD14 expression on eosinophils and neutrophils was found (data not given).
We also used RT-PCR and detected CD14-mRNA expression on human
eosinophils (Figure 6A). Because the
eosinophil preparations that we used were highly purified (more than
98%), the possibility that mRNA expression was due to other cells
types such as monocytes seems very unlikely. To completely rule out
this option, a preparation containing the maximum number of potentially
contaminating monocytes (1:20) was investigated for CD14 mRNA
expression. Although CD14 mRNA was also detectable by RT-PCR with this
low number of monocytes, much smaller amounts of RT-PCR products were
detected from these cells, indicating that the contribution of
monocytes to the CD14 mRNA expression in eosinophils was indeed
negligible (Figure 6A).
Expression of TLR2 and TLR4 on human eosinophils TLR2 and TLR4 are transmembrane molecules recently described to be CD14 coreceptors during LPS stimulation. Here we used RT-PCR to investigate the expression of these molecules in human eosinophils. The data show the presence of TLR2 and TLR4 mRNA in human peripheral blood eosinophils (Figure 6B).
LPS is known to trigger release of cytokines in monocytes and neutrophils,10,22,24,26,37 and endotoxin-induced leukocyte infiltration has been widely studied. However, the interaction between eosinophils and microbial components such as LPS so far has not been defined in detail. In an attempt to better understand the relationship between LPS and eosinophils, it was of interest therefore to determine whether eosinophils directly interact with or respond to LPS. Our data show that LPS induces the release of TNF- Our special interest focused on the question whether this activation is CD14 dependent, and whether it can be inhibited by antagonistic lipid A partial structures. Our data show that CD14 indeed appears to be involved in eosinophil activation by LPS (Figure 2A,C). Furthermore, the current study demonstrates a CD14-dependent uptake of LPS to human eosinophils (Figure 3). The involvement of CD14 is evident in FACS analyses (Figure 5) as well as in experiments showing the blocking of activation and 3H-LPS uptake of the cells by anti-CD14 moAb (Figure 4B). The 3H-LPS uptake was found to be dose dependent and specific, as the addition of a 10-fold excess of unlabeled LPS resulted in a nearly complete inhibition of the 3H-LPS uptake (Figure 4A). From our results, we have calculated uptake of 60 pg 3H-LPS/106 cells or 9000 molecules per cell after incubation of the eosinophils with 20 ng 3H-LPS/mL. This rate is at the low range of the amount of LPS-uptake found in neutrophils.37 Concerning the role of CD14 as a site of LPS recognition, our experiments show that this protein is involved. First, anti-CD14 moAb (clone MEM-18), which blocks the biologic activity of LPS, as well as the uptake to human monocytes and neutrophils, also inhibits the specific uptake of LPS to human eosinophils (Figure 2A,C). Second, the same inhibition was also observed by the use of compound 406, a lipid A partial structure (Figure 2B,C). Compound 406 has been said to represent an LPS antagonist that inhibits LPS bioactivity28,38,39,40 and, in higher doses, effectively blocks the uptake of LPS in a competitive way.41 At low doses, a noncompetitive inhibition by compound 406 has been shown in THP-1 cells.42 The presence of CD14 on eosinophils has been demonstrated by flow cytometric analysis (surface CD14) as well as by RT-PCR (CD14 mRNA) (Figures 5 and 6A). It has been previously mentioned, however, that eosinophils isolated from nonatopic healthy donors did not express CD14 molecules on their surfaces.20 The eosinophils used in those experiments were of the same sources and were isolated by a method similar to that used in our experiments. In contrast to our examinations, however, the expression of CD14 was investigated by an immunocytochemical method, which was not described in detail. Thereby, the immunocytochemical method and the type of antibody used in those experiments was not described by the authors.20 The reasons for these conflicting data are therefore not obvious. However, the amount of CD14 expressed by eosinophils is rather low, and therefore we like to speculate that the lower sensitivity of the immunocytochemical method or of the anti-CD14 moAb used may account for the failure of detection of CD14. Most recently, members of the human TLR2 and TLR4 have been implicated in the responses of cells to LPS. Toll is a type I transmembrane receptor that was first identified in Drosophila melanogaster for its role in larval development.43 At least 6 mammalian TLRs have recently been described.44,45 TLRs were proposed as candidates for the CD14-associated transmembrane signal transduction. Thus, transfection of human TLR2 into HEK 293 cells rendered these otherwise LPS nonresponsive cells responsive to LPS.29,30 TLR4 was proposed as a candidate for CD14-associated signal transducer.46 In this context, it is an interesting observation that we could detect TLR2 and TLR4 expression at least as mRNA in human eosinophils (Figure 6B). However, to date, there are no functional data demonstrating how TLR might function in these cells. In addition, other proteins may act as accessory LPS receptors.
Recently, we provided evidence for a functional role of CD55 during LPS
signaling.25,47 Also, the members of the In summary, our data provide evidence that the inflammatory agent LPS
and its endotoxic principle lipid A are activators of secretion of both
the inflammatory cytokine TNF-
We wish to express our gratitude to Carola Schneider, Ina Goroncy, Katrin Klopfenstein, and Johanna Grosch for excellent technical support. Vaclav Horejsi (Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, Czech Republic) was so kind to provide us with anti-CD14 moAb, clone MEM-18. Compound 406 was a kind gift of Shoichi Kusumoto (Osaka University, Osaka, Japan). LPS and lipid A were kindly provided by H. Brade (Research Center Borstel, Borstel, Germany). This paper is dedicated to our dear friend and estimated colleague Prof Dr Shoichi Kusumoto, University of Osaka, Japan, on the occasion of his 60th birthday.
Submitted February 3, 2000; accepted September 15, 2000.
Supported by a grant from the Deutsche Forschungsgemeinschaft (SFB 367, project C5), the Fonds der Chemie (EthR), and HSPIII (TUM).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Artur J. Ulmer, Research Center Borstel, Pakallee 22, 23845 Borstel, Germany; email: ajulmer{at}fz-borstel.de.
1. Gleich G-J. The eosinophil and bronchial asthma: current understanding. J Allergy Clin Immunol. 1990;85:422-436[CrossRef][Medline] [Order article via Infotrieve]. 2. Bousquet J, Chanez P, Lacoste JY, et al. Eosinophilic inflammation in asthma. N Engl J Med. 1990;323:1033-1039[Abstract]. 3. Gleich GJ, Flavahan NA, Fujisawa T, et al. The eosinophil as a mediator of damage to respiratory epithelium: a model for bronchial hyperreactivity. J Allergy Clin Immunol. 1988;81:776-781[CrossRef][Medline] [Order article via Infotrieve]. 4. Venge P, Byström J, Carlson M, et al. Eosinophil cationic protein (ECP): molecular and biological properties and the use of ECP as a marker of eosinophil activation in disease. Clin Exp Allergy. 1999;29:1172-1186[CrossRef][Medline] [Order article via Infotrieve]. 5. Czech W, Krutmann J, Budnik A, et al. Induction of intercellular adhesion molecule 1 (ICAM-1) expression in normal human eosinophils by inflammatory cytokines. J Invest Dermatol. 1993;100:417-423[CrossRef][Medline] [Order article via Infotrieve]. 6. Horie S, Kita H. CD11b/CD18 (Mac-1) is required for degranulation of human eosinophils induced by human recombinant granulocyte macrophage colony-stimulating factor and platelet-activating factor. J Immunol. 1994;152:5457-5457[Abstract]. 7. Neeley S-P, Hamann K-J, White S-R, Baranowski S-L, Burch R-A. Selective regulation of expression of surface adhesion molecules Mac-1, L-selectin, and VLA-4 on human eosinophils and neutrophils. Am J Respir Cell Mol Biol. 1993;8:633-639. 8. Braun RK, Franchini M, Erard F, et al. Human peripheral blood eosinophils produce and release interleukin-8 on stimulation with calcium ionophore. Eur J Immunol. 1993;23:956-960[Medline] [Order article via Infotrieve].
9.
Kita H, Ohnishi T, Okubo Y, Weiler D, Abrams J-S, Gleich G-J.
Granulocyte/macrophage colony-stimulating factor and interleukin 3 release from human peripheral blood eosinophils and neutrophils.
J Exp Med.
1991;174:745 10. Rietschel ET, Brade H, Holst O, et al. Bacterial endotoxin: chemical constitution, biological recognition, host response, and immunological detoxification. Curr Top Microbiol Immunol. 1996;216:39-81[Medline] [Order article via Infotrieve]. 11. Rosenthal S, Tager I-B. Prevalence of gram-negative rods in the normal pharyngeal flora. Ann Intern Med. 1975;83:355-357. 12. Di Luzio N-R, Friedman T-J. Bacterial endotoxins in the environment. Nature London. 1973;244:49-51[CrossRef][Medline] [Order article via Infotrieve]. 13. Jacobs R-R. Endotoxins in the environment. Int J Occup Environ Health. 1997;3:3-5. 14. Pauwels R-A, Kips J-C, Peleman R-A, van der Straeten M-E. The effect of endotoxin inhalation on airway responsiveness and cellular influx in rats. Am Rev Respir Dis. 1990;141:540-545[Medline] [Order article via Infotrieve]. 15. Folkerts G, Henricks P-A-J, Slootweg P-J, Nijkamp F-P. Endotoxin-induced inflammation and injury of the guinea pig respiratory airways cause bronchial hyporeactivity. Am Rev Respir Dis. 1988;137:1441-1448[Medline] [Order article via Infotrieve].
16.
Michel O, Duchateau J, Sergysels R.
Effect of inhaled endotoxin on bronchial reactivity in asthmatic and normal subjects.
J Appl Physiol.
1989;66:1059-1064 17. Michel O, Ginanni R, Duchateau J, Vertongen F, Le Bon B, Sergysels R. Domestic endotoxin exposure and clinical severity of asthma. Clin Exp Allergy. 1991;21:441-448[CrossRef][Medline] [Order article via Infotrieve]. 18. Michel O, Ginanni R, Le Bon B, Content J, Duchateau J, Sergysels R. Inflammatory response to acute inhalation of endotoxin in asthmatic patients. Am Rev Respir Dis. 1992;146:352[Medline] [Order article via Infotrieve]. 19. Uhlig S, Nusing R, von Bethmann A, et al. Cyclooxygenase-2-dependent bronchoconstriction in perfused rat lungs exposed to endotoxin. Mol Med. 1996;2:373-383[CrossRef][Medline] [Order article via Infotrieve].
20.
Takanaski S, Nonaka R, Xing Z, O'Byrne P, Dolovich J, Jordana M.
Interleukin-10 inhibits lipopolysaccharide-induced survival and cytokine production by human peripheral blood eosinophils.
J Exp Med.
1994;180:711-715
21.
Wright S-D, Ramos R-A, Tobias P-S, Ulevitch R-J, Mathison J-C.
CD14, a receptor for complexes of lipopolysachararide (LPS) and LPS binding protein.
Science.
1990;249:1431-1433
22.
Wright S-D, Ramos R-A, Hermanowski-Vosatka A, Rockwell P, Detmers P-A.
Activation of the adhesive capacity of CR3 on neutrophils by endotoxin: dependence on lipopolysaccharide binding protein and CD14.
J Exp Med.
1993;173:1281-1286
23.
Golenbock D-T, Liu Y, Millham F-H, Freeman M-W, Zoeller R-A.
Surface expression of human CD14 in Chinese hamster ovary fibroblasts imparts macrophage-like responsiveness to bacterial endotoxin.
J Biol Chem.
1993;268:22055-22059 24. Rietschel E-T, Brade H. Bacterial endotoxins. Sci Am. 1992;267:54-61[Medline] [Order article via Infotrieve]. 25. El-Samalouti VT, Schletter J, Brade H, et al. Detection of LPS-binding membrane proteins by immuno-coprecipitation with LPS and anti-LPS antibodies. Eur J Biochem. 1997;250:418-424[Medline] [Order article via Infotrieve]. 26. Vogel SN, Hogan MM. Role of cytokines in endotoxin-mediated host responses. In: Oppenheim JH,Shevach EM, eds. Immunophysiology: The Role of Cells and Cytokines in Immunity and Inflammation. New York, NY: Oxford University Press; 1997:238. 27. Bazil V, Horejsi V, Baudys M, et al. Biochemical characterization of a soluble form of the 53-kDa monocyte surface antigen. Eur J Immunol. 1986;16:1583-1589[Medline] [Order article via Infotrieve].
28.
Ulmer AJ, Feist W, Heine H, et al.
Modulation of endotoxin-induced monokine release in human monocytes by lipid a partial structures inhibiting binding of 125I-lipopolysacharide.
Infect Immun.
1992;60:5145-5152
29.
Kirschning C-J, Wesche H, Ayres T-M, Rothe M.
Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide.
J Exp Med.
1998;188:2091 30. Yang RB, Mark MR, Gray A, et al. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature. 1998;395:284-288[CrossRef][Medline] [Order article via Infotrieve]. 31. Galanos C, Lüderitz O, Westphal O. A new method for the extraction R-lipopolysacharide. Eur J Biochem. 1969;9:245-249[Medline] [Order article via Infotrieve]. 32. Galanos C, Lüderitz O, Westphal O. Preparation and properties of a standard lipopolysaccharide from Salmonella abortus equi (Novo-Pyrexal). Zentralbl Bakteriol [Orig A]. 1979;243:226-244. 33. Imoto M, Yoshimura H, Yamamoto M, Shimamoto T, Kusumoto S, Shiba T. Chemical synthesis of a biosynthetic precursor of lipid A with a phosphorylated tetraacyldisaccharide structure. Bull Chem Soc Jpn. 1987;60:2197-2204[CrossRef]. 34. Munford R-S, De Veaux L-C, Cronan J-E, Rick P-D. Biosynthetic radiolabeling of bacterial lipopolysacharide to high specific activity. J Immunol Methods. 1992;148:115-120[CrossRef][Medline] [Order article via Infotrieve]. 35. Grage-Griebenow E, Lorenzen D, Fetting R, Flad H-D, Ernst M. Phenotypical and functional characterization of Fcg receptor I (CD64)-negative monocytes, a minor human monocyte subpopulation with high accessory and antiviral activity. Eur J Immunol. 1993;23:3126-3135[Medline] [Order article via Infotrieve]. 36. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;7:491. 37. Luchi M, Munford R-S. Binding, internalization, and deacylation of bacterial lipopolysaccharide by human neutrophils. J Immunol. 1993;151:959-969[Abstract].
38.
Golenbock D-T, Hampton R-Y, Qureshi N, Takayama K, Raetz C-R-H.
Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes.
J Biol Chem.
1991;266:19490-19498 39. Loppnow H, Brade H, Duerrbaum I, et al. IL-1 induction capacity of defined lipopolysacharide and partial structures. J Immunol. 1989;142:3229-3238[Abstract].
40.
Kovach N-L, Yee E, Munford R-S, Raetz C-R-H, Harlan J-M.
Lipid IVa inhibits synthesis and release of tumor necrosis factor induced by lipopolysacharide in human whole blood ex vivo.
J Exp Med.
1990;172:77-84 41. Heine H, Brade H, Kusumoto S, et al. Inhibition of LPS-binding on human monocytes by phosphonooxyethyl analogs of lipid A. J Endotox Res. 1994;1:14-20.
42.
Kitchens R-L, Ulevitch R-J, Munford R-S.
Lipopolysacharide (LPS) partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway.
J Exp Med.
1992;176:485 43. Anderson K-V, Bokla L, Nusslein-Volhard C. Establishment of dorsal-ventral polarity in the Drosophila embryo: the induction of polarity by the Toll gene product. Cell. 1985;42:791-798[CrossRef][Medline] [Order article via Infotrieve].
44.
Rock F-L, Hardiman G, Timans J-C, Kastelein R-A, Bazan J-F.
A family of human receptors structurally related to Drosophila Toll.
Proc Natl Acad Sci U S A.
1998;95:588-593 45. Takeuchi O, Kawai T, Sanjo H, et al. TLR6: a novel member of an expanding Toll-like receptor family. Gene. 1999;231:59-65[CrossRef][Medline] [Order article via Infotrieve].
46.
Poltorak A, He X, Smirnova I, et al.
Defective LPS signaling in C3H/HeJ and C57 BL/10ScCr mice: mutations in TLR4 gene.
Science.
1998;282:2085-2088 47. Schletter J, Brade H, Brade L, et al. Binding of lipopolysaccharide (LPS) to an 80 kD membrane protein of human cells is mediated by soluble CD14 and LPS-binding protein. Infect Immun. 1995;63:2576-2580[Abstract].
48.
Delude RL, Savedra RJ, Zhao H, et al.
CD14 enhances cellular responses to endotoxin without imparting ligand specific recognition.
Proc Natl Acad Sci U S A.
1995;92:9288-9292 49. Ingalls RR, Arnanout MA, Delude RL, et al. The CD11/CD18 integrins: characterization of three novel LPS signaling receptors. Prog Clin Biol Res. 1998;397:107-117[Medline] [Order article via Infotrieve]. 50. Terstappen L-W, Nguyen M, Lazarus H-M, Medof M-E. Expression of the DAF (CD55) and CD59 antigens during normal hematopoietic cell differentiation. J Leukoc Biol. 1992;52:652-660[Abstract].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  V. Driss, F. Legrand, E. Hermann, S. Loiseau, Y. Guerardel, L. Kremer, E. Adam, G. Woerly, D. Dombrowicz, and M. Capron TLR2-dependent eosinophil interactions with mycobacteria: role of {alpha}-defensins Blood, April 2, 2009; 113(14): 3235 - 3244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. F.-Y. Cheung, C.-K. Wong, W.-K. Ip, and C. W.-K. Lam FAK-mediated activation of ERK for eosinophil migration: a novel mechanism for infection-induced allergic inflammation Int. Immunol., March 1, 2008; 20(3): 353 - 363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Monteseirin, A. Vega, P. Chacon, M. J. Camacho, R. El Bekay, J. A. Asturias, A. Martinez, P. Guardia, R. Perez-Cano, and J. Conde Neutrophils as a Novel Source of Eosinophil Cationic Protein in IgE-Mediated Processes J. Immunol., August 15, 2007; 179(4): 2634 - 2641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Wong, P. F. Y. Cheung, W. K. Ip, and C. W. K. Lam Intracellular Signaling Mechanisms Regulating Toll-Like Receptor-Mediated Activation of Eosinophils Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 85 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nagase, S. Okugawa, Y. Ota, M. Yamaguchi, H. Tomizawa, K. Matsushima, K. Ohta, K. Yamamoto, and K. Hirai Expression and Function of Toll-Like Receptors in Eosinophils: Activation by Toll-Like Receptor 7 Ligand J. Immunol., October 15, 2003; 171(8): 3977 - 3982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Mattsson, T. Persson, P. Andersson, J. Rollof, and A. Egesten Peptidoglycan Induces Mobilization of the Surface Marker for Activation Marker CD66b in Human Neutrophils but Not in Eosinophils Clin. Vaccine Immunol., May 1, 2003; 10(3): 485 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tsutsumi-Ishii and I. Nagaoka Modulation of Human {beta}-Defensin-2 Transcription in Pulmonary Epithelial Cells by Lipopolysaccharide-Stimulated Mononuclear Phagocytes Via Proinflammatory Cytokine Production J. Immunol., April 15, 2003; 170(8): 4226 - 4236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Wang, M. Doyle, B. J. Manning, Q. Di Wu, S. Blankson, and H. P. Redmond Induction of Bacterial Lipoprotein Tolerance Is Associated with Suppression of Toll-like Receptor 2 Expression J. Biol. Chem., September 20, 2002; 277(39): 36068 - 36075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sabroe, E. C. Jones, L. R. Usher, M. K. B. Whyte, and S. K. Dower Toll-Like Receptor (TLR)2 and TLR4 in Human Peripheral Blood Granulocytes: A Critical Role for Monocytes in Leukocyte Lipopolysaccharide Responses J. Immunol., May 1, 2002; 168(9): 4701 - 4710. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
