|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
RED CELLS
From the Bristol Institute for Transfusion Sciences,
Bristol, United Kingdom; Life Sciences Division, University of
California Lawrence Berkeley National Laboratory, Berkeley CA; The
Jackson Laboratory, Bar Harbor, ME; and University of Bristol, Bristol,
United Kingdom.
Lutheran blood group glycoproteins (Lu gps) are receptors for the
extracellular matrix protein, laminin. Studies suggest that Lu gps may
contribute to vaso-occlusion in sickle cell disease and it has recently
been shown that sickle cells adhere to laminin isoforms containing the
The Lutheran blood group is composed of a complex
set of antigens expressed on 2 integral membrane glycoprotein isoforms
of 85 and 78 kd.1,2 The complementary DNA (cDNA) encoding
the 85-kd isoform has been cloned,3 and the predicted
structure is that of a type 1 membrane protein. There are 5 disulfide-bonded, extracellular, immunoglobulin superfamily (IgSF)
domains, a single hydrophobic membrane span, and a cytoplasmic tail of
59 residues.3 The composition of the extracellular IgSF
domains puts Lutheran blood group glycoproteins (Lu gps) in the subset
of adhesion molecules that includes the human tumor marker MUC18/MCAM4
and the chicken neural adhesion molecule Gicerin.4-6
Chicken gicerin binds neurite outgrowth factor, a variant of
the extracellular matrix (ECM) protein laminin7,8 and,
interestingly, recent studies suggest that Lu gp also functions as a
laminin receptor.9-11
The Lu gp cytoplasmic tail contains an SH3 binding motif and 5 potential phosphorylation sites, consistent with receptor signaling function. Of note, differences in the structure of the cytoplasmic tail
distinguish the 2 isoforms. The 78-kd isoform (also termed B-CAM12 or Lu[v13]13) is generated by
alternative splicing of intron 13 and differs from the larger form by
having a truncated cytoplasmic tail lacking the SH3 binding motif as
well as the potential phosphorylation sites. A recent study in
epithelial cells14 suggests that the cytoplasmic tail may,
in addition, contain basolateral membrane sorting signals. Analysis of
transfected MDCK cells showed that a cytoplasmic di-leucine
motif in the 85-kd isoform regulated its sorting to the
basolateral membrane while the smaller isoform demonstrated a
nonpolarized expression.14
Normal and sickle red cells, as well as stably transfected cells
expressing either the 85- or 78-kd isoform, bind
laminin.9-11,15-17 The degree of binding correlates with
the level of Lu gp expression and sickle red cells bind more laminin
than normal red cells.9-11 It therefore seems reasonable
to postulate that this newly characterized laminin receptor may
function not only during normal erythropoiesis in cell-ECM interactions
but it may also contribute to the pathophysiology of sickle cell
disease by mediating adhesion of sickle cells to vascular endothelial cells.
Many vital questions regarding the molecular characterization and the
biologic function of the Lu-laminin interaction remain. In this paper
we show that the Lu extracellular region binds specifically and with
high affinity to human laminin isoforms that contain the Sequencing of cDNA
Genomic cloning
Chromosomal localization The Jackson Laboratory BSS interspecific back-cross ([C57BL/6JEi X SPRET/Ei]F1 X SPRET/Ei) panel was used for mapping.19 A HhaI polymorphism (C57BL/6JEi, 95 and 125 base pairs [bp] fragments; SPRET/Ei, 220 bp) within a 220-bp PCR fragment amplified with the Lu specific forward and reverse primers 5'-GCAGTGGAGGCTTTGGAGAT-3' and 5'-CTCCCTCTTTCCCTCCCCA-3', respectively, was used to follow segregation of alleles in the 94 back-cross progeny from the BSS panel on ethidium-stained 2% agarose gels.The mouse Lu gene was also mapped by fluorescence in situ hybridization (FISH) analysis, using BAC DNA labeled by random priming with digoxigenin and stained with Texas red on mouse metaphase chromosome from C57 black mouse.20 Chromosome-specific probes were random labeled with biotin and stained with fluorescein isothiocyanate (FITC).21 Transfections Stable, transfected K562 cells expressing human Lu gp and domain deletion mutants were previously described.22 A control, stable transfectant expressing LW glycoprotein was prepared as outlined.22 Prior to use in cell adhesion assays, cell surface expression of Lu gp and mutants was confirmed by flow cytometric analysis using monoclonal antibody BRIC 224 against the N-terminal domain.22 Mean fluorescence intensity (MFI) values obtained and percent positive cells were respectively: control LW transfectant-MFI 4, 0%; full length Lu (FL)-MFI 557, 98%; domain 5 deleted (Del 5)-MFI 401, 98%; Del 4-5-MFI 219, 92%; Del 3-5-MFI 560, 98%; and Del 2-5-MFI 176, 94%.Chimeric fusion proteins comprising the extracellular domains of full-length human or mouse Lu gp or of human Lu domain deletion mutants and the hinge region and Fc domains of human IgG (Lu-Fc) were expressed as follows. Regions of human Lu cDNA encoding the extracellular domains (GenBank accession X83425, nucleotides 20-1660 or the corresponding regions in domain deleted cDNAs) were amplified by PCR using a sense primer with a 5' HindIII restriction site (TGGGATCCAGATAGGCCACGCGCAGCTCC) and an antisense primer with an in-frame 5' consensus splice sequence and BamHI site (ACGGATCCACTTACCTGTCTCTGGCGAGCCTTGGACCA). The PCR templates were full-length Lu cDNA or domain deletion Lu cDNAs in pBluescript prepared as previously described.22 PCR products were subcloned into pIg vector as described23 and verified by sequence analysis. The region of mouse Lu cDNA encoding the predicted extracellular domains was amplified by PCR using a sense primer with a 5' HindIII restriction site (AATATAAGCTTAACATGGAACCCCCTGACGCC) and an antisense primer with an in-frame, 5' SalI site (CTAGTCTAGACTGGGCAGTCTGAGGGGCCACA). The PCR product was subcloned into pIg+ vector (R&D Systems, Oxford, United Kingdom) and verified by sequence analysis. Recombinant proteins were overexpressed by transient transfection of COS-7 cells as described23 and either directly captured on anti-Fc on the cuvette of the optical biosensor or purified on protein A sepharose. Full-length Lu-Fc and domain deletion mutants were tested in the biosensor for binding of monoclonal antibodies against the first N-terminal IgSF domain (BRIC 108 and BRIC 224) or the fourth IgSF domain (BRIC 221) of human Lu gp22 prior to use in laminin binding experiments. Clones encoding the control Fc fusion proteins MUC18-Fc and NCAM-Fc were gifts from Dr David Simmons (SmithKline Beecham, Harlow, United Kingdom). Control LW-Fc and CD47-Fc were prepared as above. Laminin preparations Human placental laminin, affinity purified using antibody against laminin 5 chain (human laminin 10/11), was obtained from Calbiochem (Nottingham, United Kingdom) or from Gibco (Paisley, United
Kingdom); crude, human placental laminin (human merosin) from Gibco or
from Sigma (Poole, United Kingdom); and mouse EHS laminin 1 from Sigma.
The protein concentration of each preparation was confirmed using the
"Nano-orange" dye binding technique (Molecular Probes, Leiden, The
Netherlands). Molar concentrations of each laminin species were
calculated using published apparent molecular weights.24,25 Control ECM protein, human thrombospondin
were purchased from Calbiochem.
Cell adhesion assay Laminin or bovine serum albumin (BSA, Sigma) in 0.1 M sodium bicarbonate pH 9.6 was coated on microplates (Immulon-4, Dynex Technologies, Billingshurst, United Kingdom) at 4°C for 18 hours. Various amounts of laminin (0-5 × 10 12 mole) were
added to each well and allowed to bind passively. K562 transfectants
were fluorescently labeled using 2',
7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl
ester (BCECF, Sigma). Ten microliters of 1 mg/mL BCECF was added to
107 cells suspended in 1 mL Iscove modified Eagle medium
containing 5% human AB serum (IMEM-AB), incubated at 37°C for 15 minutes, then washed in IMEM-AB. Then, 104 cells, suspended
in IMEM-AB, were added to each well and allowed to adhere at 37°C for
1 hour before unbound cells were removed by washing with IMEM-AB.
Fluorescence was measured before and after washing and the percentage
bound cells quantitated.
Optical biosensor assay Binding of laminin to Lu-Fc was examined in an IAsys optical biosensor (Affinity Sensors, Cambridge, United Kingdom). Affinity purified goat antihuman Fc (Sigma) was covalently coupled to a carboxy methyl dextran reaction cuvette (Affinity Sensors) according to the manufacturer's instructions. Fc fusion proteins in phosphate-buffered saline (PBS) pH 7.4, 0.05% Tween 20 (PBSt) were captured on this matrix and tested for interaction with laminin. To characterize the kinetic rate and equilibrium constants for the interaction of Lu-Fc with human laminin 10/11 soluble, recombinant, full-length Lu-Fc was added to PBSt buffer (final concentration 10 µg/mL) and captured on the anti-Fc surface until the biosensor recorded a response of 100 arc seconds; then the buffer was changed. Dissociation of Lu-Fc from anti-Fc was negligible. Soluble, human laminin 10/11 was applied (final concentration 24 nM) and association recorded for 4 minutes before the laminin was exchanged for PBSt and dissociation of the complex recorded. In all subsequent experiments Lu-Fc or control recombinant Fc fusion proteins were applied to the anti-Fc matrix to give an instrument response of 100 arc seconds before washing with PBSt and examination of laminin interaction. Association and dissociation rates were estimated by curve fitting using biosensor software.Fluorescence-imaged microdeformation The redistribution of membrane components in response to mechanical deformation was analyzed by fluorescence-imaged microdeformation (FIMD).26-28 The membrane component of interest was fluorescently labeled in situ and then individual cells were aspirated into a glass micropipette (diameter 1.0-1.2 µm). Aspiration created an in-plane deformation of the membrane skeleton, which condensed to enter the micropipette and subsequently dilated down the micropipette. Aspiration length scaled by the micropipette radius (L/Rp) was predetermined by the surface-to-volume ratio of the cell (osmotically controlled) and by the large compressibility modulus of the lipid bilayer. The relative density of a fluorescently labeled component at different locations along the aspiration length was quantified as the fluorescence intensity at that location normalized by the fluorescence intensity of the labeled molecules in the spherical portion of the aspirated cell.
Cloning and characterization of mouse Lu By scanning the GenBank database with the human Lu protein sequence we identified 5 mouse EST clones (accession numbers AA034658, AA008742, W48082, W78289, and AA038169), which were more closely related to the human Lu protein than to any other member of the human IgSF. The clones were obtained from IMAGE Consortium and found to contain overlapping DNA sequences, suggesting that they were derived from the same cDNA. We characterized the cDNA insert sizes of these 5 ESTs and determined that the cDNA insert in IMAGE clone 466937 (GenBank accession number AA034658) was ~2.4 kb. Because the human Lu cDNA protein-coding region comprises ~1.89 kb, we anticipated that this ~2.4-kb cDNA insert would provide us with the complete protein coding region. The clone was sequenced and found to contain a cDNA insert of 2.34 kb with a single open reading frame of 1869 bp encoding the putative mouse Lu gp, the 3' nontranslated region and poly-A tail. The cDNA and translated amino acid sequences have been submitted to GenBank (accession number AF221507).To clone the murine Lu gene we screened a BAC murine genomic
library (CitbCJ7) derived from ES cell lines of the 129/SvJ mouse strain. Using primers in the 3' untranslated region, we isolated a BAC
clone 97J17, which was shown by PCR and hybridization with cDNA probes
to contain the entire Lu gene (GenBank accession number AF246667). Sequencing of the BAC DNA showed that the murine Lu
gene was 14.1 kb and contained 15 exons, ranging in size from 6 to
226 bp (Figure 1). All of the intron/exon
boundary sequences exhibited the characteristic 5' splice donor GT and
the 3' splice acceptor AG motifs (Table
1). The exonic sequences derived from our
genomic sequence were completely homologous with the sequence of the Lu
cDNA derived from the EST clone with the exception of 6 nucleotides (nt
4830, 5035, 5103, 6317,10114, and 12046). Three of these 6 nucleotide
differences would result in amino acid changes. Specifically, nt 5035 in exon 6 was G in the genomic sequence and A in the cDNA sequence,
generating codons for aspartic acid and asparagine, respectively.
Nucleotide 6317 in exon 8 was G in the genomic sequence and C in the
cDNA sequence, encoding glycine and arginine respectively. Finally, nt
10114 in exon 9 was C in the genomic sequence and T in the cDNA
sequence, coding for alanine and valine, respectively. The size and
organization of the murine gene was very similar to that of its human
counterpart, which also contains 15 exons distributed over 13 kb.22,29 Mouse Lu, like human LU,
does not have Kozak consensus sequence around the initiating ATG. In
addition, both mouse and human genes have stop codons at the beginning
of intron 13 (CCgtaagtg and CCgtgagtg, respectively). In the case of the human gene this structure results in
alternative splicing of intron 13 that generates 2 different stop
codons, producing the 85-kd and 78-kd isoforms of human Lu gp. Further
study will be necessary to determine whether similar splicing occurs in
the mouse.
Chromosomal localization of mouse Lu The chromosomal localization of the mouse Lu gene was mapped using The Jackson Laboratory BSS interspecific back-cross panel.19 Lu was nonrecombinant with Atp6c2 and D7Mit56, placing Lu ~4 cM distal to the centromere on mouse chromosome 7 (Figure 2). This region of mouse chromosome 7 shows conserved synteny with human 19q13.2,30 where human LU localizes.3,13 The typing data have been placed in the Mouse Genome Database (accession number J:60990) and can be accessed through the World Wide Web (http://www.jax.org). BAC DNA containing the Lu gene localized to the proximal end of chromosome 7 by FISH analysis (data not shown), confirming the linkage data.
Amino acid sequence comparisons of mouse and human Lu Characterization of mouse Lu cDNA allowed us to align the deduced amino acid sequences of murine and human Lu gp3 using the "BLAST 2 sequences" program (NCBI Entrez, Figure 3). The level of amino acid identity between the putative translated products was 72%. The mouse Lu cDNA we have sequenced encodes the 85-kd Lu glycoprotein isoform. Analysis of the extracellular region of the murine homologue of Lu revealed several interesting features. It appears likely that the disulfide-bonded IgSF domains will be similarly folded in the murine and human polypeptides because the critical cysteine residues, 22, 93, 140, 205, 260, 305, 353, 393, 441, and 492, as well as other key residues within each of the predicted IgSF domains, are conserved. In addition, 3 of the 4 potential glycosylation sites in the mouse third and fourth extracellular domains are conserved. Within the cytoplasmic tail the proline-rich SH3 binding motif P557PPXXP present in human is partially conserved in mouse (P557PAXXP) and each of the 5 serine residues is conserved, suggesting that ligand-induced receptor signaling may be similar in mouse and human cells.
Human and mouse Lu-Fc fusion proteins specifically bind human laminin 10/11 with high affinity Although there is now very good evidence that Lu gp serves as a laminin receptor, the particular laminin proteins that function as ligands in this interaction have not yet been characterized. Laminins are a large family of proteins, each composed of 3 polypeptide chains (,  , and  ).25 There are at least 5 distinct chains and similar numbers of and chains. Earlier studies on
laminin adhesion have used laminins prepared from mouse Engelbreth Holm Schwarm (EHS) tumor cell cultures or from human placenta. Mouse EHS-laminin is the prototype laminin 1 (111). In contrast, crude human placental laminin preparations (merosin) contain mainly laminin 2 (211), laminin 4 (221), and a comparatively
small proportion of laminins 10 (511) and 11 (521).24 Recently it has been discovered that
laminins 10 and 11 can be specifically purified from human placental
laminin,24 using a monoclonal antibody that recognizes the
laminin 5 chain.31 Thus a number of distinct laminin
isoforms are now available for adhesion assays. In the present study we
explored the possibility that a specific form of laminin is a
high-affinity ligand of Lu gp.
To define the laminin isoform(s) that associates with Lu gp, the
optical biosensor assay was used. Recombinant human Lu-Fc was captured
on the anti-Fc biosensor cuvette; then affinity purified human laminin
10/11, crude human placental laminin, or mouse laminin 1 was applied
(each at a final concentration of 42 nM) and association was recorded.
We observed that human Lu-Fc protein bound human laminin 10/11 (Figure
4A). In marked contrast, a relatively
small association response was observed with an equal molar
concentration of the crude human placental laminin preparation (laminin
2/4) and no binding occurred to mouse laminin 1 (Figure 4A).
Having obtained the predicted sequence of the murine homologue of
Lu gp, we were also able to determine whether murine Lu gp interacts
with the same laminin isoforms as human Lu gp. After expressing the
predicted extracellular domains of murine Lu as an Fc fusion protein,
we tested this recombinant polypeptide in the biosensor assay. Mouse
Lu-Fc also bound human laminin isoforms 10 and 11, a small proportion
of crude human placental laminin but not mouse laminin 1 (Figure 4B).
These data clearly show that both human and mouse Lu are specific
membrane receptors for laminin isoform(s) containing the To characterize the kinetics of the human Lu gp/laminin interaction, soluble recombinant, full-length Lu-Fc was added to PBSt buffer (final concentration 10 µg/mL) and captured on the anti-Fc surface (Figure 4C) until the biosensor recorded a response of 100 arc seconds and then the buffer was changed. Dissociation of Lu-Fc from the anti-Fc was negligible (Figure 4C). Soluble, human laminin 10/11 was then applied (final concentration 24 nM) and kinetics of the protein-protein interaction was recorded for 4 minutes before the laminin was exchanged for PBSt and dissociation of the protein complex recorded (Figure 4C). The association rates (kon) and dissociation rates
(koff) for the interaction with human laminin 10/11 were
measured at laminin concentrations in the range 0.1 to 100 nM. Values
for kon and koff were estimated by curve
fitting using biosensor software assuming simple, monophasic
interaction (A+B The interaction of human laminin 10/11 with mouse Lu-Fc was examined in
a similar manner (data not shown). Compared with human Lu-Fc the
affinity of the binding of laminin 10/11 to mouse Lu-Fc was found to be
approximately an order of magnitude lower
(kass = 3.5 ± 0.7 × 105
M To determine the specificity of the binding interaction, we tested other cell adhesion molecules expressed as soluble Fc fusion proteins. We observed that the extracellular region of the human structural analogue MUC 18-Fc failed to bind 10 nM laminin (Figure 4F) as did LW-Fc, NCAM-Fc, and CD47-Fc (data not shown). Soluble human thrombospondin (final concentration 2.9 nM) was also applied to captured human Lu-Fc and failed to bind (data not shown). K562 transfectants expressing human Lu gp specifically bind human laminin 10/11 As an independent and complementary approach to identifying the laminin ligand, K562 transfectants were tested in a microplate cell adhesion assay. Laminin preparations were titrated and added to microplates in the range 5 × 1012 to
5 × 1016 mole per microplate well. Fluorescently
labeled K562 transfectants expressing full-length human Lu gp were
allowed to adhere to the coated microplates, fluorescence was measured
before and after washing, and the percentage bound cells was
calculated. The titration results clearly show that in this static
adhesion assay system the human Lutheran transfectant adhered in
microplate wells coated with small quantities of human laminin 10/11
(37% cell adhesion at 5 × 1013 mole per well added
laminin, Figure 5). In contrast, the
transfectants showed poor adhesion in wells containing 10-fold greater
quantities of mouse laminin 1 or crude human placental laminin (3% and
11% cell adhesion, respectively, at 5 × 1012 mole per
well added laminin, Figure 5). The data from this series of
experiments, therefore, confirmed the results of the biosensor assays
and clearly demonstrated that human Lutheran Fc fusion proteins
specifically bind human laminins containing the 5
polypeptide chain.
The first 3, N-terminal IgSF domains of human Lu gp bind human laminin 10/11 To identify the laminin-binding domain(s) on Lu gp, Lu deletion mutants, lacking one or more IgSF domains (Figure 6A) were expressed as Fc fusion proteins and assayed for laminin binding. Each Fc fusion protein was captured on the anti-Fc biosensor cuvette to give an instrument response of 100 arc seconds. Human laminin 10/11 (final concentration 10 nM) was added to the cuvette and the binding response was recorded. Full-length Lu-Fc, the mutant lacking Lu domain 5 (Del 5), and the mutant lacking domains 4 and 5 (Del 4-5) gave a positive binding curve, whereas the mutant Lu-Fc fusion proteins lacking domains 3, 4, and 5 (Del 3-5); the mutant lacking domains 2, 3, 4, and 5 (Del 2-5); and MUC18-Fc (MUC18) control failed to bind laminin 10/11 (Figure 6B). These data imply that the first 3, N-terminal IgSF domains are critical for laminin binding to Lu gp.
As an independent and complementary approach to defining the
ligand binding domain on the Lu gp receptor, fluorescently labeled K562
transfectants expressing full-length or domain-deleted Lu gp were
tested in the microplate adhesion assay in microplates coated using
10 Lu interacts with the spectrin-based membrane skeleton To begin to characterize the binding interactions of the cytoplasmic domain of Lu gp we determined whether Lu gp interacts with the spectrin-based skeleton. For these studies, Lu gp in human erythrocytes was specifically labeled with FITC-conjugated monoclonal anti-Lu gp BRIC 221 and analyzed by fluorescence imaged microdeformation. The redistribution of Lu in response to microdeformation was mapped by quantitating the ratio of entrance to cap density (  /c) as a function of
aspiration length (L/Rp). We observed that FITC-labeled anti-Lu gp
exhibited a steep gradient in concentration along the projection, which
was almost as steep as that of skeletal-actin (Figure
7). This is in contrast to findings with
glycophorin A or band 3, which exhibit less steep gradients reflecting
the presence of both skeleton-associated and freely diffusing
populations of these molecules. Based on these findings we suggest that
BRIC 221-labeled Lu is predominantly linked to the membrane skeleton and we speculate that the interaction of its cytoplasmic tail may be
critical for laminin-induced signal transduction.
A major finding of the current study is that Lu gp is a specific,
high-affinity receptor for human laminins containing the We and others have previously shown that Lu gp first appears in erythroid differentiation at the stage of orthochromatic erythroblasts.32,33 These findings suggest that Lu gp/laminin binding may have a role in the later stages of erythroid maturation, specifically in the migration of maturing erythrocytes through the subendothelium of bone marrow sinusoids. Recently, a study of human and murine bone marrow demonstrated that laminin 10/11 is expressed in sinusoidal ECM.34 Our current data showing that laminin 10/11 is the specific Lu gp binding partner strengthens the hypothesis that Lu gp may mediate erythroid adhesion with bone marrow sinusoidal ECM and play a functional role in marrow egress. Our identification of To begin to understand the precise molecular mechanisms involved in Lu
gp receptor function we characterized in more detail the
protein-protein interactions of the extracellular and cytoplasmic domains of this adhesion molecule. Using domain-deleted Lu gp constructs expressed both as soluble fusion proteins and on the membranes of stable transfectants, we have located a laminin binding region within the first 3, N-terminal IgSF domains. Independently, another group has reported that cells transfected with a domain-deleted Lu gp construct containing only the membrane proximal, fifth IgSF domain adhered to laminin.11 In contrast to the data
presented here, these investigators found that deletion of domain 5 abolished laminin binding. We have shown, using 2 different techniques, that domain 5 is not critical for laminin binding. Of note, however, in
our experiments with transfected K562 cells we did observe that fewer
cells expressing mutants with deletions of domain 5 or 4-5 bound
laminin compared to cells expressing full-length Lu gp. Hence our
current data, coupled with that of Zen and colleagues,11 raises the intriguing possibility that there may be 2 laminin-binding regions on the Lu gp structure: one on domains 1-3 and the other on
domain 5. There is precedence for such a hypothesis since VCAM-1, which
has 7 IgSF domains, contains 2 distinct binding sites for The protein-protein interactions of the cytoplasmic domain of a receptor molecule can play critical roles in regulating receptor function. To determine whether Lu interacts with the spectrin-based skeleton we used a molecular mapping technique that is a powerful means of providing insight into in situ protein linkages. Our findings that BRIC 221-labeled Lu exhibited a steep gradient in concentration along the membrane projection, which was almost as steep as that of skeletal actin, implies that Lu is predominantly skeleton associated. We postulate that this interaction of the Lu gp cytoplasmic tail with the spectrin-based skeleton may also be critical for laminin-induced signal transduction. In future studies it will be interesting to determine whether laminin binding alters the protein interactions of the Lu cytoplasmic domain. Because we believe that the development of a suitable animal model is a key requirement for obtaining a detailed understanding of the role of Lu in normal erythropoiesis and in sickle cell adhesion, we cloned and sequenced the mouse gene encoding the murine homologue to human Lu gp. Our characterization of mouse Lu confirms and extends the observations very recently reported by Rahuel and colleagues.39 These investigators described the intron/exon boundaries, sequenced 7 of the 14 introns, and estimated the sizes of the remaining 7 introns. We have obtained and submitted to GenBank the complete sequence of the 15 exons and all 14 introns. The splice acceptor and donor site sequences obtained by our 2 groups are very similar with the differences being primarily at the single nucleotide level. With the exception of introns 1, 2, and 8 earlier estimates of intron size39 are within 4 to 94 nucleotides of our complete sequence data. In the case of introns 1, 2, and 8, Rahuel and colleagues predicted sizes of more than 2000, ~1600, and ~4200 nucleotides, respectively, whereas our genomic sequence data have shown that intron 1 is 1834 nt, intron 2 is 1365, and intron 8 is 3671. The exonic sequences derived from our genomic sequence were completely homologous with the cDNA sequence we obtained of the EST clones with the exception of single nucleotide variations in exons 5, 6, 8, 9, and 13. The only nucleotide differences that would result in changes in amino acid sequence occurred in exons 6, 8, and 9 where the genomic sequence would encode an aspartic acid, glycine, and alanine, respectively, whereas the cDNA sequence would encode an asparagine, arginine, and valine, respectively. Interestingly in human Lu gp, blood group single nucleotide polymorphisms have been mapped to each of the 5 IgSF domains22 and it is possible that a similar situation may exist for mouse. From our characterization of the murine homologue we discovered that
human and mouse Lu gps are highly conserved at the amino acid sequence
level (72% overall identity). This conservation was reflected within
individual IgSF domains but, among candidate ligand-binding domains,
the first domains showed least identity (65%), whereas the second and
third domains were most conserved (82% and 75%, respectively). The
fifth domain showed 69% identity. Strikingly consistent with these
findings, the predicted extracellular IgSF domains of mouse Lu gp, when
expressed as a fusion protein, displayed the same binding pattern as
human Lu gp and specifically bound human laminin 10/11 but not human
laminin 2/4 or mouse laminin 1. However, the affinity of the
interaction of human laminin 10/11 with mouse Lu gp, while still in the
nanomolar range, was an order of magnitude lower than that observed for
human Lu gp. Examination of published amino acid sequences of various
laminin
We would like to thank Dr Marja Ekblom for advice on the nature of commercial laminin preparations. We are very grateful to Dr Uli Weier and Dr Robert Lersch (LBNL, Berkeley, CA) for their invaluable help in FISH analysis and to Mr Michael Patterson for his expert technical assistance.
Submitted March 28, 2000; accepted September 6, 2000.
Supported in part by National Institutes of Health grants DK56267, DK26263, DK32094, and HL31579 and by the Director, Office of Health and Environment Research Division, US Department of Energy, under Contract DE-AC03- 76SF00098.
D.J.A. and J.A.C. contributed equally to the direction of this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Dr Joel Anne Chasis, Lawrence Berkeley National Laboratory, Bldg 74, 1 Cyclotron Rd, Berkeley, CA 94720; e-mail: jachasis{at}lbl.gov; David J. Anstee, Bristol Institute for Transfusion Sciences, Southmead Road, Bristol, BS10 5ND, United Kingdom; e-mail: david.anstee{at}nbs.nhs.uk.
1. Parsons SF, Mallinson G, Judson PA, Anstee DJ, Tanner MJ, Daniels GL. Evidence that the Lub blood group antigen is located on red cell membrane glycoproteins of 85 and 78 kd. Transfusion. 1987;27:61-63[CrossRef][Medline] [Order article via Infotrieve]. 2. Daniels GL, Khalid G. Identification, by immunoblotting, of the structures carrying Lutheran and para-Lutheran blood group antigens. Vox Sang. 1989;57:137-141[Medline] [Order article via Infotrieve].
3.
Parsons SF, Mallinson G, Holmes CH, et al.
The Lutheran blood group glycoprotein, another member of the immunoglobulin superfamily, is widely expressed in human tissues and is developmentally regulated in human liver.
Proc Natl Acad Sci U S A.
1995;92:5496-5500 4. Johnson JP, Rothbacher U, Sers C. The progression associated antigen MUC18: a unique member of the immunoglobulin supergene family. Melanoma Res. 1993;3:337-340[Medline] [Order article via Infotrieve]. 5. Corbel C, Bluestein HG, Pourquie O, Vaigot P, Le Douarin NM. An antigen expressed by avian neuronal cells is also expressed by activated T lymphocytes. Cell Immunol. 1992;141:99110. 6. Corbel C, Cormier F, Pourquie O, Bluestein HG. BEN, a novel surface molecule of the immunoglobulin superfamily on avian hemopoietic progenitor cells shared with neural cells. Exp Cell Res. 1992;203:91-99[CrossRef][Medline] [Order article via Infotrieve]. 7. Taira E, Takaha N, Taniura H, Kim CH, Miki N. Molecular cloning and functional expression of gicerin, a novel cell adhesion molecule that binds to neurite outgrowth factor. Neuron. 1994;12:861-872[CrossRef][Medline] [Order article via Infotrieve].
8.
Taira E, Nagino T, Taniura H, et al.
Expression and functional analysis of a novel isoform of gicerin, an immunoglobulin superfamily cell adhesion molecule.
J Biol Chem.
1995;270:28681-28687 9. Udani M, Zen Q, Cottman M, et al. Basal cell adhesion molecule/Lutheran protein. The receptor critical for sickle cell adhesion to laminin. J Clin Invest. 1998;101:2550-2558[Medline] [Order article via Infotrieve].
10.
El Nemer W, Gane P, Colin Y, et al.
The Lutheran blood group glycoproteins, the erythroid receptors for laminin, are adhesion molecules.
J Biol Chem.
1998;273:16686-16693
11.
Zen Q, Cottman M, Truskey G, Fraser R, Telen MJ.
Critical factors in basal cell adhesion molecule/Lutheran-mediated adhesion to laminin.
J Biol Chem.
1999;274:728-734
12.
Campbell IG, Foulkes WD, Senger G, Trowsdale J, Garin Chesa P, Rettig WJ.
Molecular cloning of the B-CAM cell surface glycoprotein of epithelial cancers: a novel member of the immunoglobulin superfamily.
Cancer Res.
1994;54:5761-5765
13.
Rahuel C, Le van Kim C, Mattei MG, Cartron JP, Colin Y.
A unique gene encodes spliceoforms of the B-cell adhesion molecule cell surface glycoprotein of epithelial cancer and the Lutheran blood group glycoprotein.
Blood.
1996;88:1865-1872
14.
El Nemer W, Colin Y, Bauvy C, et al.
Isoforms of the Lutheran/basal cell adhesion molecule glycoprotein are differentially delivered in polarized epithelial cells.
J Biol Chem.
1999;274:31903-31908 15. Gee B, Platt OS. CD44 may be a laminin receptor of normal and sickle erythrocytes [abstract]. Blood. 1995;86:137a.
16.
Hillery CA, Du MC, Montgomery RR, Scott JP.
Increased adhesion of erythrocytes to components of the extracellular matrix: isolation and characterization of a red blood cell lipid that binds thrombospondin and laminin.
Blood.
1996;87:4879-4886
17.
Lee SP, Cunningham ML, Hines PC, Joneckis CC, Orringer EP, Parise LV.
Sickle cell adhesion to laminin: potential role for the 18. Smith LM, Sanders JZ, Kaiser RJ, et al. Fluorescence detection in automated DNA sequence analysis. Nature. 1986;321:674-679[CrossRef][Medline] [Order article via Infotrieve]. 19. Rowe LB, Nadeau JH, Turner R, et al. Maps from two interspecific backcross DNA panels available as a community genetic mapping resource [published erratum appears in Mamm Genome 1994 Jul;5(7):463]. Mamm Genome. 1994;5:253-274[CrossRef][Medline] [Order article via Infotrieve]. 20. Weier HU, George CX, Greulich KM, Samuel CE. The interferon-inducible, double-stranded RNA-specific adenosine deaminase gene (DSRAD) maps to human chromosome 1q21.1-21.2. Genomics. 1995;30:372-375[CrossRef][Medline] [Order article via Infotrieve]. 21. Shi YP, Mohapatra G, Miller J, et al. FISH probes for mouse chromosome identification. Genomics. 1997;45:42-47[CrossRef][Medline] [Order article via Infotrieve].
22.
Parsons SF, Mallinson G, Daniels GL, Green CA, Smythe JS, Anstee DJ.
Use of domain-deletion mutants to locate Lutheran blood group antigens to each of the five immunoglobulin superfamily domains of the Lutheran glycoprotein: elucidation of the molecular basis of the Lua/Lub and the Aua/Aub polymorphisms.
Blood.
1997;89:4219-4225 23. Simmons DL. Cloning cell surface molecules by transient expression in mammalian cells. In: Hartley DA, ed. Cellular Interactions in Development: A Practical Approach. Oxford, UK: IRL Press; 1993:93-127. 24. Ferletta M, Ekblom P. Identification of laminin-10/11 as a strong cell adhesive complex for a normal and a malignant epithelial cell line. J Cell Sci. 1998;112:1-10[Abstract]. 25. Timpl R, Brown JC. The laminins. Matrix Biology. 1994;14:275-281.
26.
Discher DE, Mohandas N, Evans EA.
Molecular maps of red cell deformation: hidden elasticity and in situ connectivity.
Science.
1994;266:1032-1035 27. Discher DE, Mohandas N. Kinematics of red cell aspiration by fluorescence-imaged microdeformation. Biophys J. 1996;71:1680-1694[Medline] [Order article via Infotrieve].
28.
Knowles DW, Tilley L, Mohandas N, Chasis JA.
Erythrocyte membrane vesiculation: model for the molecular mechanism of protein sorting.
Proc Natl Acad Sci U S A.
1997;94:12969-12974
29.
El Nemer W, Rahuel C, Colin Y, Gane P, Cartron JP, Le van Kim C.
Organization of the human LU gene and molecular basis of the Lua/Lub blood group polymorphism.
Blood.
1997;89:4608-4616 30. Anonymous. Encyclopedia of the mouse genome: Mouse Genome Informatics Project. Bar Harbor, ME: The Jackson Laboratory; 1998.
31.
Tiger C, Champliaud M, Pedrosa-Domellof F, Thornell L, Ekblom P, Gullberg D.
Presence of laminin
32.
Southcott MJG, Tanner MJA, Anstee DJ.
The expression of human blood group antigens during erythropoiesis in a cell culture system.
Blood.
1999;93:4425-4435 33. Bony V, Gane P, Bailly P, Cartron J. Time-course expression of polypeptides carrying blood group antigens during human erythroid differentiation. Br J Haematol. 1999;107:263-274[CrossRef][Medline] [Order article via Infotrieve].
34.
Gu Y, Sorokin L, Durbeej M, Hjalt T, Jonsson J, Ekblom M.
Characterization of bone marrow laminins and identification of 35. Brown KA, Mahmalji R, Pearson TC, Spring FA, Parsons SF, Anstee DJ. Antibody blocking of sickled red blood cell attachment to cultured endothelium [abstract]. Br J Haematol. 1998;102:279. 36. Krishnan R, Brown KA, Pearson TC, et al. Increased expression of Lutheran and LW glycoproteins on red blood cells from patients with sickle cell disease [abstract]. Br J Haematol. 1999;105:64. 37. Clements JM, Newham P, Shepherd M, et al. Identification of a key integrin-binding sequence in VCAM-1 homologous to the LDV active site in fibronectin. J Cell Sci. 1994;107:2127-2135[Abstract]. 38. Needham LA, Van Dijk S, Pigott R, et al. Activation dependent and independent VLA-4 binding sites on vascular cell adhesion molecule-1. Cell Adhes Commun. 1994;2:87-99[Medline] [Order article via Infotrieve]. 39. Rahuel C, Colin Y, Goossens D, et al. Characterization of a mouse laminin receptor gene homologous to the human blood group Lutheran gene. Immunogenetics. 1999;50:271-277[CrossRef][Medline] [Order article via Infotrieve]. 40. Gimm JA, Peters LL, Lux SE, et al. Deficiencies in membrane proteins of the RBC affect the shear rigidity of cells but not the deformability of the membrane skeletal network [abstract]. Biophys J. 1998;74:A393.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  X. An, E. Gauthier, X. Zhang, X. Guo, D. J. Anstee, N. Mohandas, and J. A. Chasis Adhesive activity of Lu glycoproteins is regulated by interaction with spectrin Blood, December 15, 2008; 112(13): 5212 - 5218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. X. Mahoney, T. S. Stappenbeck, and J. H. Miner Laminin {alpha}5 influences the architecture of the mouse small intestine mucosa J. Cell Sci., August 1, 2008; 121(15): 2493 - 2502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Chasis and N. Mohandas Erythroblastic islands: niches for erythropoiesis Blood, August 1, 2008; 112(3): 470 - 478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rahuel, A. Filipe, L. Ritie, W. El Nemer, N. Patey-Mariaud, D. Eladari, J.-P. Cartron, P. Simon-Assmann, C. Le Van Kim, and Y. Colin Genetic inactivation of the laminin {alpha}5 chain receptor Lu/BCAM leads to kidney and intestinal abnormalities in the mouse Am J Physiol Renal Physiol, February 1, 2008; 294(2): F393 - F406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Mankelow, N. Burton, F. O. Stefansdottir, F. A. Spring, S. F. Parsons, J. S. Pedersen, C. L. P. Oliveira, D. Lammie, T. Wess, N. Mohandas, et al. The Laminin 511/521 binding site on the Lutheran blood group glycoprotein is located at the flexible junction of Ig domains 2 and 3 Blood, November 1, 2007; 110(9): 3398 - 3406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Qian, E. Georges-Labouesse, A. Nystrom, A. Domogatskaya, K. Tryggvason, S. E. W. Jacobsen, and M. Ekblom Distinct roles of integrins {alpha}6 and {alpha}4 in homing of fetal liver hematopoietic stem and progenitor cells Blood, October 1, 2007; 110(7): 2399 - 2407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-P. Wautier, W. El Nemer, P. Gane, J.-D. Rain, J.-P. Cartron, Y. Colin, C. Le Van Kim, and J.-L. Wautier Increased adhesion to endothelial cells of erythrocytes from patients with polycythemia vera is mediated by laminin {alpha}5 chain and Lu/BCAM Blood, August 1, 2007; 110(3): 894 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. El Nemer, M.-P. Wautier, C. Rahuel, P. Gane, P. Hermand, F. Galacteros, J.-L. Wautier, J.-P. Cartron, Y. Colin, and C. Le Van Kim Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell {alpha}4{beta}1integrin: role in adhesion of sickle red blood cells to endothelial cells Blood, April 15, 2007; 109(8): 3544 - 3551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Vainionpaa, Y. Kikkawa, K. Lounatmaa, J. H. Miner, P. Rousselle, and I. Virtanen Laminin-10 and Lutheran blood group glycoproteins in adhesion of human endothelial cells Am J Physiol Cell Physiol, March 1, 2006; 290(3): C764 - C775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Maatta, R. Butzow, J. Luostarinen, N. Petajaniemi, T. Pihlajaniemi, S. Salo, K. Miyazaki, H. Autio-Harmainen, and I. Virtanen Differential Expression of Laminin Isoforms in Ovarian Epithelial Carcinomas Suggesting Different Origin and Providing Tools for Differential Diagnosis J. Histochem. Cytochem., October 1, 2005; 53(10): 1293 - 1300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Gauthier, C. Rahuel, M. P. Wautier, W. El Nemer, P. Gane, J. L. Wautier, J. P. Cartron, Y. Colin, and C. Le Van Kim Protein Kinase A-dependent Phosphorylation of Lutheran/Basal Cell Adhesion Molecule Glycoprotein Regulates Cell Adhesion to Laminin {alpha}5 J. Biol. Chem., August 26, 2005; 280(34): 30055 - 30062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Hallmann, N. Horn, M. Selg, O. Wendler, F. Pausch, and L. M. Sorokin Expression and Function of Laminins in the Embryonic and Mature Vasculature Physiol Rev, July 1, 2005; 85(3): 979 - 1000. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Kjellgren, L.-E. Thornell, I. Virtanen, and F. Pedrosa-Domellof Laminin Isoforms in Human Extraocular Muscles Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4233 - 4239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Wandersee, S. C. Olson, S. L. Holzhauer, R. G. Hoffmann, J. E. Barker, and C. A. Hillery Increased erythrocyte adhesion in mice and humans with hereditary spherocytosis and hereditary elliptocytosis Blood, January 15, 2004; 103(2): 710 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Bruce, R. Beckmann, M. L. Ribeiro, L. L. Peters, J. A. Chasis, J. Delaunay, N. Mohandas, D. J. Anstee, and M. J.A. Tanner A band 3-based macrocomplex of integral and peripheral proteins in the RBC membrane Blood, May 15, 2003; 101(10): 4180 - 4188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Kikkawa, I. Virtanen, and J. H. Miner Mesangial cells organize the glomerular capillaries by adhering to the G domain of laminin {alpha}5 in the glomerular basement membrane J. Cell Biol., April 14, 2003; 161(1): 187 - 196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kikkawa, C. L. Moulson, I. Virtanen, and J. H. Miner Identification of the Binding Site for the Lutheran Blood Group Glycoprotein on Laminin alpha 5 through Expression of Chimeric Laminin Chains in Vivo J. Biol. Chem., November 15, 2002; 277(47): 44864 - 44869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. T. Sterk, C. A. W. Geuijen, J. G. van den Berg, N. Claessen, J. J. Weening, and A. Sonnenberg Association of the tetraspanin CD151 with the laminin-binding integrins {alpha}3{beta}1, {alpha}6{beta}1, {alpha}6{beta}4 and {alpha}7{beta}1 in cells in culture and in vivo J. Cell Sci., March 15, 2002; 115(6): 1161 - 1173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. El Nemer, P. Gane, Y. Colin, A. M. D'Ambrosio, I. Callebaut, J.-P. Cartron, and C. L. Van Kim Characterization of the Laminin Binding Domains of the Lutheran Blood Group Glycoprotein J. Biol. Chem., June 22, 2001; 276(26): 23757 - 23762. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
5 chain-containing human laminin
with high affinity
Top
Abstract
Introduction
3 of the 4 sites
in the mouse sequence are conserved. The proline-rich, putative
SH3-binding site within the cytoplasmic domain of human Lu gp is
underlined
15 minutes and
allowed to associate until the biosensor recorded a response of 100 arc
seconds. The Lu-Fc was removed and fresh buffer (PBSt) was added at
time 
AB, representative data for the association of
laminin 10/11 with human Lu-Fc are shown in Figure 
