| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Department of Hematology and Istituto di
Oncologia and Patologia Sperimentali, Istituto di Anatomia Patologica,
University of Florence, and Azienda Ospedaliera Careggi, Florence;
Dipartimento di Biomorfologia, Università G. D'Annunzio, Chieti;
and Servizio di Qualità and Sicurezza della Sperimentazione
Animale, Laboratorio di Biologia Cellulare, and di Biochimica Clinica,
Istituto Superiore di Sanità, Rome, Italy.
The response of mice genetically unable to up-regulate GATA-1
expression (GATA-1low mice) to acute
(phenylhydrazine [PHZ]-induced anemia) and chronic (in vivo
treatment for 5 days with 10 U erythropoietin [EPO] per mouse)
erythroid stimuli was investigated. Adult GATA-1low mice
are profoundly thrombocytopenic (platelet counts
[× 109/L] 82.0 ± 28.0 vs 840 ± 170.0 of their
control littermates, P < .001) but have a normal
hematocrit (Hct) (approximately .47 proportion of 1.0 [47%]). The spleens of these mutants are 2.5-fold larger
than normal and contain 5-fold more megakaryocytic (4A5+),
erythroid (TER-119+), and bipotent
(erythroid/megakaryocytic, TER-119+/4A5+)
precursor cells. Both the marrow and the spleen of these animals contain higher frequencies of burst-forming units-erythroid (BFU-E)- and colony-forming units-erythroid (CFU-E)-derived colonies (2-fold and 6-fold, respectively) than their normal littermates. The
GATA-1low mice recover 2 days faster from the PHZ-induced
anemia than their normal littermates (P < .01). In
response to EPO, the Hct of the GATA-1low mice raised to
.68 proportion of 1.0 (68%) vs the .55 proportion of 1.0 (55%)
reached by the controls (P < .01). Both the
GATA-1low and the normal mice respond to PHZ and EPO with
similar (2- to 3-fold) increases in size and cellularity of the spleen
(increases are limited mostly to cells, both progenitor and precursor,
of the erythroid lineage). However, in spite of the similar relative cellular increases, the increases of all these cell populations are
significantly higher, in absolute cell numbers, in the mutant than in
the wild-type mice. In conclusion, the GATA-1low mutation
increases the magnitude of the response to erythroid stimuli as a
consequence of the expansion of the erythroid progenitor cells in their spleen.
(Blood. 2001;97:3040-3050) GATA-1 is a member of a highly conserved family of
transcription factors whose expression is restricted to the Sertoli
cells in the testis and to hemopoietic cells.1 In the
hemopoietic system, expression of GATA-1 is activated at the level of
multilineage progenitor cells and is maintained in cells maturing
toward all the myeloid lineages.1,2 In most of those
lineages, GATA-1 expression decreases with maturation, with the
exception of the erythroid lineage, in which its expression actually
increases with progression toward differentiation.1 The
important role of GATA-1 in the regulation of erythroid differentiation
is strongly suggested by the fact that GATA-1 cognate sequences are
present in the regulatory regions of all the erythroid genes identified to date,1 including the erythropoietin receptor
(EpoR)3,4 and GATA-1 itself.5,6
Furthermore, mice whose expression of either GATA-1,7 or
its partner, Friend of GATA (Fog),8 has been impaired by gene disruption, die prenatally owing to severe anemia.
How GATA-1 specifically regulates erythroid differentiation has been
the subject of intensive investigation and is still unclear. Some
evidence has suggested that the levels of GATA-1 expression are
responsible for the establishment of this differentiation program. In
fact, avian myelomonocytic cell lines that have been transfected with
GATA-1 differentiate into hemopoietic cells whose phenotype is linked
to the levels of GATA-1 ectopic expression. Only those cell lines that
express the highest levels are erythroid.9 Similarly, when
murine stem cells are transfected with a GATA-1-containing retrovirus
and used to reconstitute hematopoiesis in sublethally irradiated mice,
the mice engrafted with those cells express lower white blood cell
counts and higher red blood cell counts than animals reconstituted with
normal stem cells.10 Furthermore, the GATA-1-transduced
stem cell recipients are partially resistant to induction of anemia by
phlebotomy and, when they finally become anemic, recover faster than
controls.10
To directly prove that the levels of GATA-1 expression determine
erythroid differentiation, genetically modified mice lacking upstream
regions have been generated by homologous recombination.11 The mutants lacking the first enhancer (DNA hypersensitive site I) and
the distal promoter are born both thrombocytopenic12 and
anemic.13 In the case of one of these mutants, the
GATA-1low (neo To clarify the mechanism of erythroid compensation in the adult
GATA-1low mice, we have characterized their hemopoiesis
under steady-state conditions (anatomic site of cell production, size
and growth factor sensitivity of the progenitor cells, levels of GATA-1
and GATA-2 expression, and apoptosis within the erythroblast
compartment, etc) and have measured their response to both acute
(phenylhydrazine [PHZ]-induced anemia) and chronic (prolonged
exposure to EPO) erythroid stimulation. The 2 stimuli operate through
at least partially different mechanisms: the response to PHZ is
mediated primarily by the glucocorticoid receptor,14 a
nonspecific receptor involved in the response to stress that stimulates
erythropoiesis by favoring proliferation over differentiation at the
levels of late erythroid progenitors.15 On the other hand,
EPO specifically induces production of red cells by promoting
commitment, proliferation, and survival of erythroid cells of all
types.16 The results presented indicate that the
GATA-1low mice have a normal hematocrit thanks to a massive
expansion of the early erythroid progenitors (colony-forming
units-erythroid [CFU-E]) in the spleen that compensate for the
increased apoptosis observed at the erythroblast level. Furthermore,
because of such an expansion, they have an accelerated response to both
acute and chronic erythroid stimuli, compared with their normal littermates.
Mice
In vivo stimulation of erythropoiesis
Hematological blood parameters Blood was collected from the retro-orbital plexus into EDTA-coated microcapillaries (20 to 40 µL per sampling). Hematocrit (Hct) and platelet counts were determined manually. Reticulocyte counts were done on smears of blood that had been stained with methylene blue according to standard protocols. At least 1000 red blood cells were counted in each determination.Immunohistochemical analysis Samples of spleen and bone marrow were routinely fixed in phosphate-buffered formalin (10%, vol/vol), paraffin embedded, and sectioned (2.5 to 3 µM) for hematoxilin-eosin staining and immunostaining with a GATA-1-specific antibody (N6) (Santa Cruz Biotechnology, CA). In some experiments, the spleens were quickly frozen in liquid nitrogen, and cryostated sections (3 µm) were labeled with 4A5 (a gift of Dr S. Burstein19). Immunohistochemical staining was performed according to the commercial 3-step alkaline phosphatase developing system (APAAP) (Dako, Carpinteria, CA) or with an indirect peroxidase method (Sigma).Flow cytometry analysis Marrow and spleen cells were suspended in Ca++-free, Mg++-free phosphate-buffered saline (PBS) supplemented with 1% (vol/vol) bovine serum albumin, 2 mM EDTA, and 0.1% NaN3 and labeled with the erythroid-specific phycoerythrin (PE)-conjugated TER-11920 (Ly-76) (Pharmingen, San Diego, CA) monoclonal antibody and the megakaryocytic-specific fluorescein isothiocyanate (FITC)-conjugated 4A5 (approximately 1 µg/106 cells) antibody for 30 minutes on ice. The cell fluorescence was analyzed with the FACScan flow cytometer (Becton Dickinson, San Jose, CA). Cells incubated with appropriately labeled isotype controls (Pharmingen) were used to gate nonspecific fluorescence signal. Mature red cells were depleted by hypotonic lysis (0.87% ammonium chloride for 15 minutes on ice), and dead cells were excluded by propidium iodide staining (5 µg/mL) (Sigma).Progenitor cell counts The frequency of progenitor cells in the light-density (fewer than 0.080) fractions (0.25 to 1.0 × 105 cells per plate) of marrow, isolated from either normal or GATA-1low mice as described,21 was determined in standard methylcellulose culture (0.9% wt/vol) in the presence of fetal bovine serum (30% vol/vol) (Sigma) and of a combination of recombinant growth factors, including rat stem cell factor (SCF) (100 ng/mL), mouse interleukin 3 (10 ng/mL) (both from Sigma), and either human EPO (2 U/mL) (Boehringer Mannheim, Germany) for burst-forming unit-erythroid (BFU-E) growth or mouse granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) (50 ng/mL each) for granulocyte-macrophage colony-forming unit (CFU-GM) growth (G-CSF and GM-CSF were purchased from Sigma).21 The growth of CFU-E-derived colonies was stimulated with EPO alone (2 U/mL).22 The cultures were incubated at 37°C in a humidified incubator containing 5% CO2 in air and scored either 3 days (for CFU-E-derived colonies) or 7 days (for CFU-GM- and BFU-E-derived colonies) following initiation of culture.RNA isolation and semiquantitative reverse transcriptase PCR analysis Total RNA was prepared with a commercial guanidine thiocyanate/phenol method (Trizol) (Gibco BRL, Paisley, United Kingdom) as described by the manufacturer. Glycogen (20 µg) (Boehringer Mannheim) was added to each sample as a carrier. Total RNA (1 µg) was reverse transcribed at 42°C for 30 minutes in 20 µL of 10 mM Tris-HCl, pH 8.3, containing 5 mM MgCl2, 1 U RNAse inhibitor, 2.5 U Moloney murine leukemia virus reverse-transcriptase, and 2.5 µM random hexamers (all from Perkin-Elmer, Norwalk, CT). The expression of -globin and of the total, proximal,
and distal GATA-1 transcripts was analyzed by amplifying
reverse-transcribed complementary DNA (cDNA) (2.5 µL) in the presence
of the specific sense and antisense primers (100 nM each) described
elsewhere.23 The following primers were used for the
amplification of GATA-2: sense 5'TGCAA-CACACCACCCGATACC3', antisense
5'CAATTTGCACAACAGGTGCCC3'. These primers generated an expected
amplification fragment of 336 base pairs. The reaction was performed in
100 µL of 10 mM Tris-HCl, pH 8.3, containing MgCl2 (2 mM), dNTP (200 µM each), 0.1 µCi
[ 32P]-deoxycytidine triphosphate (specific activity
3000 Ci/mmol) (Amersham Italia, Cologno Monzese, Italy), and 2 U
AmpliTaq DNA polymerase. Primers specific for
2-microglobulin (50 nM each) were added to each
amplification after the first 10 cycles as a control for the amount of
cDNA used in the reaction.23 PCR conditions were as
follows: 60 seconds at 95°C, 60 seconds at 60°C, and 60 seconds at 72°C. All of the reactions were done by means of a GeneAmp
2400 Perkin-Elmer thermocycler and were analyzed in the linear range of
amplification defined by preliminary experiments to be between 20 and
35 cycles for GATA-1 and GATA-2; 32 and 38 cycles for the distal and
proximal GATA-1 transcripts; 18 and 24 cycles for -globin; and 20 and 30 cycles for 2-microglobulin. Positive (RNA from
adult marrow) and negative (mock cDNA) controls were included in each
experiment. Aliquots (20 µL) were removed from the PCR mixture after
amplification, and the amplified bands separated by electrophoresis on
4% polyacrylamide gel. Gels were dried by means of a Biorad (Hercules,
CA) apparatus and exposed to Hyperfilm-MP (Amersham) for 2 hours at
70°C. All procedures were done according to standard
protocols.24
Purification of erythroblast precursors and terminal deoxy transferase uridine triphosphate nick end labeling reaction Erythroid precursors (TER-119+ cells) were purified from the spleens of wild-type and GATA-1low mice by immunoselection on magnetic beads (Miltenyi Biotec, Bologna, Italy) coated with the TER-119 antibody as described.26 The cells were either lysed in Trizol for gene expression analysis or cytocentrifuged for the detection of apoptotic cells by terminal deoxy transferase uridine triphosphate nich end-labeling (TUNEL). In this last case, the cytospin preparations were fixed with paraformaldehyde (4% vol/vol in PBS, pH = 7.4) for 30 minutes at room temperature and incubated in a permeabilizing solution (0.1% Triton, 0.1% sodium citrate) for 2 minutes on ice. The DNA strand breaks that are characteristic of apoptotic cells were identified by labeling the free 3'-OH nucleotide termini with fluorescein-deoxyuridine triphosphate with the In Situ Cell Death Detection Kit (Boehringer Mannheim) as described by the manufacturer. The cells were counterstained with propidium iodide, mounted in glycerol, and analyzed under a fluorescent microscope (Leica Microscopy System, Heidelberg, Germany).Statistical analysis Statistical analysis was performed by analysis of variance by means of Origin 3.5 software for Windows (Microcal Software, Northampton, MA).
Comparative analysis of the erythroid compartments in adult GATA-1low and wild-type mice The general hemopoietic features of adult (6 to 12 months of age) GATA-1low and wild-type mice are compared in Table 1 and Figure 1. As already reported,11,12 the blood of adult GATA-1low mice contained normal levels of red (Hct) and white cells but contained 10-fold fewer platelets than controls (P < .001) (Table 1). Furthermore, the few platelets detectable on the blood smears from GATA-1low mice appeared morphologically abnormal and bigger than normal platelets25 (also in data not shown).
The cellularity of the marrow and spleen from the GATA-1low animals was profoundly different from that of the controls: the marrow from the mutants contained 3 times fewer cells, whereas their spleen contained 3 times more cells than the corresponding tissues from the normal littermates (Table 1). The abnormal size, weight, and cellularity of the spleen from the mutants are also evident from the data presented in Figure 1. May-Grünwald staining of cytospin marrow preparations showed that
the tissue from the mutant mouse contains larger-than-normal red cells
and cells with clear morphological signs of apoptosis (see the picnotic
nuclei in the erythroblasts in Figure 2).
The higher percentage of apoptotic cells in the GATA-1low
marrow preparations was confirmed by TUNEL staining (Figure 2C): TUNEL-positive cells are 3 times more frequent (18% vs 5% of the cells labeled by propidium iodide) in cytocentrifuged preparations from
GATA-1low mice than from the normal littermates. By
fluorescence-activated cell sorting (FACS) analysis (not shown), the
marrow from the GATA-1low mice contained slightly higher
percentages of megakaryocytic (1.8% ± 0.4% vs 0.4% ± 0.1%
4A5+ cells) and bipotent (1.5% ± 0.5% vs
0.7% ± 0.2% 4A5+/TER-119+ cells)
precursors and similar percentages of erythroid precursors (11% ± 2.8% vs 12% ± 3.3% TER-119+ cells) than
the marrow from the controls. However, because of the poor cellularity
of the marrow from the mutants (Table 1), its overall erythroid
precursor cell content was lower than that of the wild-type marrow
(Table 2).
The increased cellularity of the spleen from the GATA-1low
mice is reflected by deep alterations in its whole structural
organization (Figure 3A,B): the
interfollicular space of the red pulp was filled with abnormally large
and dysplastic megakaryocytes recognized by the 4A5 antibody (Figure
3B,C). The spleens' red pulp and subcapsulary space was filled with
lymphocyte-sized cells resembling immature erythroid cells (Figure
3A,B) that could not be positively identified as erythroid in these
sections because the TER-119 antibody reacted poorly in
immunohistochemistry (data not shown). The anti-GATA-1 antibody
labeled all of the erythroidlike blasts but failed to recognize the
megakaryocytes within the spleens of the GATA-1low animals
(Figure 3D). Interestingly, it labeled all the megakaryocytes present
in the spleens of normal mice but only a portion (variable from
specimen to specimen) of the megakaryocytes in the splenic sections
from heterozygote females25 (Figure 3D, insert).
The FACS analyses of the erythroid and megakaryocytic precursor cell
content of the spleens from GATA-1low and normal mice are
compared in Figure 4. The spleens of the GATA-1low mice contained significantly higher numbers (7- to 20-fold, P < .01) of megakaryocytic (single
4A5+), erythroid (single TER-119+), and
bipotent (erythroid and megakaryocytic,
4A5+/TER-119+)26 precursors than
the spleens from normal mice (Figure 4).
The higher erythroid cell content of the spleen from the
GATA-1low mice was also reflected by the levels of
expression of the
The frequency of progenitor cells in the spleen and marrow from
normal and GATA-1low mice is compared in Figure
7. The tissues of the
GATA-1low mice displayed frequencies of myelomonocytic
progenitors (CFU-GM) similar to those found in the corresponding
tissues from their normal counterparts. In contrast, they contained
2-fold more early (BFU-E, P < .05) and 5- to 7-fold more
late (CFU-E, P < .001) erythroid progenitor cells than
the normal tissues.
To clarify the reason for the higher erythroid progenitor cell content in the tissues from the GATA-1low mice, we compared the effect of increasing EPO concentrations on the growth of erythroid colonies from the mutant or normal marrow and spleen cells in semisolid cultures (Figure 7C). The EPO growth/response curves for BFU-E- and CFU-E-derived colonies obtained in cultures of GATA-1low and wild-type spleen cells were identical. In both cases, 50% of maximal colony growth was sustained by a concentration of 0.1 U/mL EPO, and maximal colony formation was observed with 0.4 EPO U/mL. Response of the GATA-1low mice to in vivo stimulation of erythropoiesis The red cell recovery after PHZ treatment of normal and GATA-1low animals is compared in Figure 8. At 5 days after the PHZ treatment, the Hct of GATA-1low mice had exceeded .5 proportion of 1.0 (50%) (higher than the prebleeding level) while the wild-type mice had mostly, but not completely, recovered from their anemia17 (Figure 8A). Furthermore, at day 2 of recovery from the anemia, reticulocytes represented greater than 80% of the total red cells in the blood from the GATA-1low mice, as compared with fewer than 30% found in blood from the corresponding controls (Figure 8B). In the blood of the mutant mice, the percentages of reticulocytes remained significantly higher than in the blood of the controls until day 5 after PHZ treatment (Figure 8B).
Although the relative increases in size (by 2-fold) and cellularity (by
3.5-fold) of the spleens from the GATA-1low and wild-type
mice were similar, the spleens of the PHZ-treated mutants were
significantly (P < .01) bigger and contained more cells
than their PHZ-treated controls (Figure 1). At day 1 from the PHZ
treatment, the spleens from both GATA-1low and wild-type
animals were engulfed with erythroblasts expressing GATA-1 by
immunostaining (Figure 7). The sinusoid spaces were markedly enlarged
owing to the presence of red cells in the process of being lysed
locally after having been damaged by PHZ (Figure 9). The presence of this massive red cell
lysis was also evident by the dark red color of these spleens in gross
morphological examination (Figure 1).
At day 1, the PHZ treatment increased the frequency of erythroid (TER-119+), megakaryocytic (4A5+), and bipotent (TER-119+/4A5+) precursors, not only in the spleens of the wild-type mice as reported,26 but also in the spleens of the mutant animals (Figure 4). The spleens of the GATA-1low mice contained 2 to 3 times (P < .001) more erythroid/megakaryocytic precursors than the spleens from the wild-type mice although, in comparison with the corresponding baseline levels, the increases observed in the spleens of the normal mice were 2- to 3-fold higher than those observed in the GATA-1low mice (Figure 4). The increases of the erythroid precursors in the spleens of
PHZ-treated animals were paralleled by increases in the expression of
At day 1 of PHZ treatment, the frequency of late erythroid (CFU-E) progenitor cells, but not those of early erythroid (BFU-E) or myelomonocytic (CFU-GM) progenitors, increased in the marrow and spleen from the mutants as well as from the wild-type mice (Figure 7A,B). Particularly high was the frequency reached by the CFU-E in the hemopoietic tissues of the GATA-1low mice (greater than 600 and 1300 colonies per 105 marrow and spleen cells, respectively). In vivo administration of EPO (10 U per mouse for 5 days) induced a
statistically significant rise in the Hct of both the mutant and the
normal mice (Figure 10A). The peak of
the Hct increase was reached 6 days after the first EPO injection. In
the case of the mutant mice, the Hct increased sooner (the first
statistically different Hct value was observed at day 4 instead of day
6); more (up to .67 ± .05 proportion of 1.0 [67% ± 4.9%] as
compared with .57 ± .03 proportion of 1.0 [56.5% ± 3.4%],
P < .001); and for a longer period of time (until day 14 instead of day 12) than the Hct increases observed in their normal
littermates (Figure 10A).
The changes in Hct values were reflected by symmetrical increases in the percentage of circulating reticulocytes that were also higher in the blood of the mutants than in the blood of normal mice. At day 6 of the EPO treatment, reticulocytes represented up to 40% of the circulating red cells in the GATA-1low mice and only 20% of the red blood cells in the wild-type mice (Figure 10B). The cellular compartments in the marrow and spleen of some of the
animals treated with EPO were analyzed on day 6 of the treatment (ie,
when the highest Hct and reticulocyte increases had been observed). The
spleens of both the mutant and the normal mice became enormously
enlarged after EPO treatment and reached a weight of 780 ± 50 mg in
the GATA-1low mice and 365 ± 38 mg in the wild-type
animals (Figure 1). The total nucleated cells per organ increased
accordingly, and up to 2.8 ± 0.3 × 109 cells were
detected per spleen in the GATA-1low mice. The
immunohistochemistry revealed massive spleen infiltration of
GATA-1+ erythroblasts at all stages of maturation that
disrupted all the architecture of the organ both in the wild-type and
in the GATA-1low mice (Figure 9). After EPO treatment, the
spleens of the GATA-1low mice still contained a relatively
high number of GATA-1 The results of the histologic analysis were confirmed by FACS analysis
(Figure 3). At day 6 post-EPO treatment, the frequency of single
TER-119+ cells increased up to 59.0% in the normal spleen
and to 65% in the spleen of the GATA-1low mice
(P < .01). The percentage of single 4A5+ and
of double TER-119+/4A5+ cells decreased after
EPO stimulation both in the mutant and in the wild-type mice (Figure
3), although when total spleen cellularity is taken into account, their
total numbers either increased or remained constant (Table
3).
In contrast with the PHZ treatment, which increased the frequency of only CFU-E, EPO induced a significant rise in the frequency of both early (BFU-E) and late (CFU-E) erythroid progenitor cells in the marrow and spleen from the mutant and the normal mice (Figure 7). Once again, in absolute numbers, the increases in the erythroid progenitors in the mutant mice were statistically higher than those observed in the wild-type mice (Figure 7). No changes were detected after EPO treatment in the frequencies of myeloid progenitor cells (Figure 7). That the frequency of early (BFU-E) erythroid progenitors increased after EPO stimulation but not after PHZ stimulation (Figure 7) while the percentage of bipotent (erythroid/megakaryocytic) precursor cells increased after PHZ stimulation but decreased after EPO stimulation (Figure 3) supports the notion that at least partially different mechanisms are responsible for the erythroid stimulation exerted by EPO and PHZ.
We show that the phenotype of the GATA-1low mutants that survive until adulthood involves not only, as reported,12,25 accumulation of dysplastic megakaryocytes arrested at terminal stages of differentiation but also (1) massive expansion of erythroid progenitors (BFU-E and CFU-E) (Figure 7A,B) and bipotent (erythroid/megakaryocytic) precursors (Figure 4) and (2) the transition of the major hemopoietic site from the marrow to the spleen (Tables 2, 3). Because of their lower levels of GATA-1 expression, the GATA-1low erythroblasts should have an increased apoptotic rate.29 This suggests to us that the progenitor cell expansion is the reason the Hct levels in the adult mutants are normal and have an accelerated response to both acute (PHZ treatment) (Figure 8) and chronic (EPO administration) (Figure 10) erythroid stimulation. In fact, normal adult mice produce a constant number (64) of reticulocytes for every CFU-E, most of which (90%) egress and mature into red cells in the blood where they circulate with a half-life of 40 to 50 days. Since the Hct and the percentages of circulating reticulocytes in the GATA-1low mice were normal (Table 1, Figures 8, 10) but their CFU-E and bipotent precursor cell compartments were expanded (Tables 2, 3), the number of their erythroblasts actually maturing into reticulocytes had to be lower than normal. In agreement with this conclusion, the proportion of GATA-1low erythroblasts that stained positive for apoptosis was found to be higher than normal (60% vs 2%) (Figure 6B). In apparent contrast with these data, Shivdasani et al12 and McDevitt et al13 had reported that the liver from the GATA-1low fetuses (when the mutants are anemic) contained normal numbers of progenitor cells. Since these authors have not reported the number of progenitor cells in the adult tissues (when the mutants have a normal Hct), it is not possible to assess whether the different results obtained are due to the slightly different genetic background (mixed C57 Bl/6-SV 129 vs mixed C57 Bl/6-SV 129 plus CD 1) of the mice used in the 2 sets of studies or an ontogenetic switch in the control of the erythroid differentiation program. The high perinatal mortality rate of the GATA-1low mutants had suggested that the normal Hct in the adults was due to natural selection of those few animals whose erythroid cells either were more responsive to EPO30 or expressed higher levels of GATA-1 (or other members of the GATA family). In fact, in the case of targeted deletions of GATA-1,31 the GATA-1null erythroblasts capable of differentiating in vitro from the embryonic stem cells express 50-fold higher-than-normal levels of GATA-2, a factor whose functions are at least partially redundant with GATA-1.1 Furthermore, ectopic expression of GATA-3 rescues the GATA-1null mutation.32 However, the EPO concentration/response curves of the mutant BFU-E and CFU-E, both from the marrow (not shown) and the spleen (Figure 7C), were normal, and highly purified erythroblasts isolated from the GATA-1low spleens expressed very low GATA-1 levels while their level of expression of GATA-2 was comparable to that expressed by their counterpart isolated from normal spleens (Figure 6). It is known that the physiological functions of certain genes are not
always unveiled by ablation/overexpression studies in genetic mouse
models because the phenotype could be masked by a homeostatic
compensatory loop.33 This was the case, for example, of
the Stat5a The compensatory mechanism underlying the normal Hct of the
GATA-1low mice was found to be very similar to that of the
Stat5a That the GATA-1low mice have an accelerated response to both acute (Figure 8) and chronic (Figure 10) erythroid stimulation suggests that the mechanism that compensates for their erythroid defect does not saturate either the signaling pathway related to the response to stress (PHZ anemia) or the EPO pathway. It is unlikely, then, that it involves control elements extrinsic to the erythroid differentiation program,39 and it could be either extrinsic or intrinsic to the GATA-1 mutation itself. One possible extrinsic mechanism could result from the fact that the chronic thrombocytopenia stimulates growth factor production in vivo. Although the serum from the GATA-1low mice contains normal levels of EPO and SCF (data not shown), thrombocytopenia stimulates thrombopoietin (TPO) production,40 which has been shown in vivo to increase the number of megakaryocytic as well as erythroid progenitor cells.41 However, the frequency of megakaryocytic progenitors was normal in the tissues of the mutant mice (32.5 ± 7.5 vs 26.0 ± 6.5 per 105 cells). Furthermore, their marrow and spleen contained high numbers of immature megakaryocytes interspersed with the erythroid cells (Figure 2, 3; also results not shown). Since megakaryocytes are responsible for binding and degrading TPO in vivo,40 their high numbers make it unlikely that TPO could accumulate in the mutant tissues at levels above normal. Other growth factors, produced as a consequence of the thrombocytopenia, might prime erythroid cells to be more sensitive to EPO. However, as mentioned earlier, the EPO concentration/response curves of the mutant erythroid progenitors were normal (Figure 7C). Alternatively, the compensatory mechanism of the GATA-1low mutation in adult mice could be intrinsic to the mutation itself. In fact, it has been shown that GATA-2 expression favors proliferation over differentiation in experimental models32,42 and is suppressed, either directly or indirectly, by GATA-1 itself.43 It has been, therefore, suggested that the ratio between the levels of GATA-2 and GATA-1 expression determines whether a progenitor cell will proliferate (high GATA-2) or differentiate (high GATA-1).1 According to this model, the lower-than-normal levels of GATA-1 expression in the GATA-1low cells would allow the erythroid progenitors to express GATA-2 for a longer period of time, favoring their proliferation over differentiation. Eventually, because of the long GATA-1 messenger RNA and protein half-life, progenitor cells would accumulate enough GATA-1 to suppress GATA-2 expression and to begin erythroid differentiation. It remains to be explained why the phenotype of the adult mutants involves the transition of the major hemopoietic site from the marrow to the spleen. Similar increases in the percentage of erythroid cells were observed in the marrow and spleen from the GATA-1low mice (Figure 7 and results in the text). However, because the marrow from the mutants had poor cellularity (Table 1), it contained absolute numbers of erythroid progenitor and precursor cells similar to, if not lower than, normal (Table 2). It is possible that this transition is pleiotropic to the mutation itself and is linked to the different accessory cell populations present in the marrow and spleen and how they respond to growth factors released by the megakaryocytes. The marrow, but to a much lesser extent the spleen, contains fibroblasts, endothelial cells, and osteoblasts, all of which are exquisitely responsive to growth factors, such as platelet-derived growth factor, released by the megakaryocytes. Therefore, stromal cells within the GATA-1low marrow might be continuously stimulated, and their consequent proliferation might reduce, over time, the space available for the hemopoietic cells, forcing them to migrate in the spleen. In agreement with this hypothesis, marrow sections from adult GATA-1low mice show gross accumulation of collagen fibers and a myelofibrosis-like morphology. We are currently investigating whether the phenotype of the adult GATA-1low mutants involves development of myelofibrosis and how the mutation is eventually responsible for this disease. The data presented here might have some clinical relevance; in fact, 2 GATA-1 mutations have been recently described in humans that result in partially defective protein function and thrombocytopenia associated with either dyserythropoietic anemia44 or thalassemia.45 The fact that the GATA-1low mice respond better than the normal mice to erythroid stimulation (Figures 8 and 10) suggests that treatment with EPO may correct, at least in part, the erythroid defect in some of these patients.
We thank Dr Stuart Orkin for providing the GATA-1low mouse model, for continuous support, and for critical reading of the manuscript; Professor Giuliano D'Agnolo for encouragement; Luca Marsili for assistance with the breeding program; and Margaret Oppenheimer for editorial assistance.
Submitted September 26, 2000; accepted January 17, 2001.
Supported by Ministero per la Ricerca Scientifica e Tecnologica; Progetti di Ricerca di Interesse Nazionale 2000; grant 1172 from the Telethon Foundation, Fondi Ricerca Corrente, Ministry of Health; and institutional funds from Istituto Superiore di Sanità, Rome, Italy. C. Cellai was the recipient of a fellowship from Fondazione Italiana per la Ricerca sul Cancro (Milan, Italy).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Anna Rita Migliaccio, Laboratorio di Biochimica Clinica, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy; e-mail: migliar{at}iss.it.
1. Orkin SH. Transcription factors that regulate lineage decisions. In: Stamatoyannopoulos G,Majerus PW,Perlmutter R,Varmus H, eds. The Molecular Basis of Blood Diseases. 3rd edition. Philadelphia, PA: Saunders; 2001:80-102. 2. Moroni E, Cairns L, Ottolenghi S, et al. Expression in hematopoietic cells of GATA-1 transcripts from the alternative "testis" promoter during development and cell differentiation. Biochem Biophys Res Commun. 1997;231:299-304[CrossRef][Medline] [Order article via Infotrieve].
3.
Zon LI, Youssoufian H, Mather C, Lodish HF, Orkin SH.
Activation of the erythropoietin receptor promoter by transcription factor GATA-1.
Proc Natl Acad Sci U S A.
1991;88:10638-10641
4.
Chiba T, Ikawa Y, Todokoro K.
GATA-1 transactivates erythropoietin receptor gene, and erythropoietin receptor-mediated signals enhance GATA-1 gene expression.
Nucleic Acids Res.
1991;19:3843-3848
5.
Tsai SF, Strauss E, Orkin SH.
Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter.
Genes Dev.
1991;5:919-931
6.
Baron MH, Farrington SM.
Positive regulators of the lineage-specific transcription factor GATA-1 in differentiating erythroid cells.
Mol Cell Biol.
1994;14:3108-3114 7. Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for the transcription factor GATA-1. Nature. 1991;349:257-260[CrossRef][Medline] [Order article via Infotrieve].
8.
Tsang AP, Fujiwara Y, Hom DB, Orkin SH.
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG.
Genes Dev.
1998;12:1176-1188
9.
Kulessa H, Frampton J, Graf T.
GATA-1 reprograms avian myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts.
Genes Dev.
1995;9:1250-1262
10.
Farina SF, Girard LJ, Vanin EF, Nienhuis AW, Bodine DM.
Dysregulated expression of GATA-1 following retrovirus-mediated gene transfer into murine hematopoietic stem cells increases erythropoiesis.
Blood.
1995;86:4124-4133
11.
McDevitt MA, Fujiwara Y, Shivdasani RA, Orkin SH.
An upstream, DNase I hypersensitive region of the hemopoietic-expressed transcription factor GATA-1 gene confers developmental specificity in transgenic mice.
Proc Natl Acad Sci U S A.
1997;94:7976-7981 12. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 1997;16:3965-3973[CrossRef][Medline] [Order article via Infotrieve].
13.
McDevitt MA, Shivdasani RA, Fujiwara Y, Yang H, Orkin SH.
A "knockdown" mutation created by cis-element gene targeting reveals the dependence of erythroid cell maturation on the level of transcription factor GATA-1.
Proc Natl Acad Sci U S A.
1997;94:6781-6785
14.
Bauer A, Tronche F, Wessely O, et al.
The glucocorticoid receptor is required for stress erythropoiesis.
Genes Dev.
1999;13:2996-3002 15. Wessely O, Deiner EM, Beug H, von Lindern M. The glucocorticoid receptor is a key regulator of the decision between self-renewal and differentiation in erythroid progenitors. EMBO J. 1997;16:267-280[CrossRef][Medline] [Order article via Infotrieve].
16.
Krantz SB.
Erythropoietin.
Blood.
1991;77:419-434 17. Krystal G. A simple microassay for erythropoietin based on 3H-thymidine incorporation into spleen cells from phenylhydrazine treated mice. Exp Hematol. 1983;11:649-660[Medline] [Order article via Infotrieve]. 18. Vannucchi AM, Grossi A, Rafanelli D, Vannucchi L, Rossi Ferrini P. Binding of recombinant human 125I-erythropoietin to CFU-E from the spleen of anemic mice. Haematologica. 1990;75:21-26[Medline] [Order article via Infotrieve]. 19. Burstein SA, Friese P, Downs T, Mei RL. Characteristics of a novel rat anti-mouse platelet monoclonal antibody: application to studies of megakaryocytes. Exp Hematol. 1992;20:1170-1177[Medline] [Order article via Infotrieve].
20.
Okumura N, Tsuji K, Nakahata T.
Changes in cell surface antigen expressions during proliferation and differentiation of human erythroid progenitors.
Blood.
1992;80:642-650
21.
Migliaccio G, Migliaccio AR, Valinsky J, et al.
Stem cell factor induces proliferation and differentiation of highly enriched murine hematopoietic cells.
Proc Natl Acad Sci U S A.
1991;88:7420-7424 22. Iscove NN, Guilbert LJ, Weyman C. Complete replacement of serum in primary cultures of erythropoietin-dependent red cell precursors (CFU-E) by albumin, transferrin, iron, unsaturated fatty acid, lecithin and cholesterol. Exp Cell Res. 1980;126:121-126[CrossRef][Medline] [Order article via Infotrieve]. 23. Vannucchi AM, Linari S, Lin CS, Koury MJ, Bondurant MC, Migliaccio AR. Increased expression of the distal, but not of the proximal, Gata1 transcripts during differentiation of primary erythroid cells. J Cell Physiol. 1999;180:390-401[CrossRef][Medline] [Order article via Infotrieve]. 24. Sambrook J,Fritsch EF,Maniatis T, eds. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
25.
Vyas P, Ault K, Jackson CW, Orkin SH, Shivdasani RA.
Consequences of GATA-1 deficiency in megakaryocytes and platelets.
Blood.
1999;93:2867-2875
26.
Vannucchi AM, Paoletti F, Linari S, et al.
Identification and characterization of a bipotent (erythroid and megakaryocytic) cell precursor from the spleen of phenylhydrazine-treated mice.
Blood.
2000;95:2559-2568 27. Migliaccio AR, Carta C, Migliaccio G. In vivo expansion of purified hematopoietic stem cells transplanted in nonablated W/Wv mice. Exp Hematol. 1999;27:1655-1666[CrossRef][Medline] [Order article via Infotrieve]. 28. Ito E, Toki T, Ishihara H, et al. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature. 1993;362:466-468[CrossRef][Medline] [Order article via Infotrieve].
29.
Weiss MJ, Orkin SH.
Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis.
Proc Natl Acad Sci U S A.
1995;92:9623-9627
30.
Kelley LL, Koury MJ, Bondurant MC, Koury ST, Sawyer ST, Wickrema A.
Survival or death of individual proerythroblasts results from differing sensitivities: a mechanism for controlled rates of erythrocyte production.
Blood.
1993;82:2340-2352
31.
Weiss MJ, Keller G, Orkin SH.
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 32. Tsai FY, Browne CP, Orkin SH. Knock-in mutation of transcription factor GATA-3 into the GATA-1 locus: partial rescue of GATA-1 loss of function in erythroid cells. Dev Biol. 1998;196:218-227[CrossRef][Medline] [Order article via Infotrieve]. 33. Ihle JN. The challenges of translating knockout phenotypes into gene function. Cell. 2000;102:131-134[CrossRef][Medline] [Order article via Infotrieve]. 34. Teglund S, McKay C, Schuetz E, et al. Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell. 1998;93:841-850[CrossRef][Medline] [Order article via Infotrieve].
35.
Socolovsky M, Fallon AE, Wang S, Brugnara C, Lodish HF.
Fetal anemia and apoptosis of red cell progenitors in Stat5a 36. Ihle JN, Kerr IM. Jaks and Stats in signaling by the cytokine receptor superfamily. Trends Genet. 1995;11:69-74[CrossRef][Medline] [Order article via Infotrieve]. 37. Parganas E, Wang D, Stravopodis D, et al. Jak2 is essential for signaling through a variety of cytokine receptors. Cell. 1998;93:385-395[CrossRef][Medline] [Order article via Infotrieve]. 38. Neubauer H, Cumano A, Muller M, Wu H, Huffstadt U, Pfeffer K. Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell. 1998;93:397-409[CrossRef][Medline] [Order article via Infotrieve].
39.
Metcalf D, Enver T, Heyworth CM, Dexter TM.
Lineage commitment and maturation in hematopoietic cells: the case for extrinsic regulation.
Blood.
1998;92:345-351
40.
Kaushansky K.
Thrombopoietin: the primary regulator of platelet production.
Blood.
1995;86:419-431 41. Kaushansky K, Broudy VC, Grossmann A, et al. Thrombopoietin expands erythroid progenitors, increases red cell production, and enhances erythroid recovery following myelosuppressive therapy. J Clin Invest. 1995;96:1683-1687.
42.
Tsai FY, Orkin SH.
Transcription factor GATA-2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation.
Blood.
1997;89:3636-3643
43.
Briegel K, Lim KC, Plank C, Beug H, Engel JD, Zenke M.
Ectopic expression of a conditional GATA-2/estrogen receptor chimera arrests erythroid differentiation in a hormone-dependent manner.
Genes Dev.
1993;7:1097-1109 44. Nichols KE, Crispino JD, Poncz M, et al. Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA-1. Nat Genet. 2000;24:266-270[CrossRef][Medline] [Order article via Infotrieve]. 45. Yu C, Raskin WH, Niankan KK, Matsushita M, Stamatoyannopoulos G, Orkin SH. X-Linked thrombocytopenia with thalassemia due to a mutation affecting DNA: binding contribution of the N-finger od transcription factor GATA-1 [abstract]. Blood. 2000;96:495a.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. R. Migliaccio, F. Martelli, M. Verrucci, M. Sanchez, M. Valeri, G. Migliaccio, A. M. Vannucchi, M. Zingariello, A. Di Baldassarre, B. Ghinassi, et al. Gata1 expression driven by the alternative HS2 enhancer in the spleen rescues the hematopoietic failure induced by the hypomorphic Gata1low mutation Blood, September 3, 2009; 114(10): 2107 - 2120. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sawado, J. Halow, H. Im, T. Ragoczy, E. H. Bresnick, M. A. Bender, and M. Groudine H3 K79 dimethylation marks developmental activation of the {beta}-globin gene but is reduced upon LCR-mediated high-level transcription Blood, July 15, 2008; 112(2): 406 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gutierrez, S. Tsukamoto, M. Suzuki, H. Yamamoto-Mukai, M. Yamamoto, S. Philipsen, and K. Ohneda Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis Blood, April 15, 2008; 111(8): 4375 - 4385. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venkataraman, Y.-M. Lee, J. Michaud, S. Thangada, Y. Ai, H. L. Bonkovsky, N. S. Parikh, C. Habrukowich, and T. Hla Vascular Endothelium As a Contributor of Plasma Sphingosine 1-Phosphate Circ. Res., March 28, 2008; 102(6): 669 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suzuki, K. Ohneda, S. Hosoya-Ohmura, S. Tsukamoto, O. Ohneda, S. Philipsen, and M. Yamamoto Real-time monitoring of stress erythropoiesis in vivo using Gata1 and beta-globin LCR luciferase transgenic mice Blood, July 15, 2006; 108(2): 726 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhao, C. Kitidis, M. D. Fleming, H. F. Lodish, and S. Ghaffari Erythropoietin stimulates phosphorylation and activation of GATA-1 via the PI3-kinase/AKT signaling pathway Blood, February 1, 2006; 107(3): 907 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Stachura, S. T. Chou, and M. J. Weiss Early block to erythromegakaryocytic development conferred by loss of transcription factor GATA-1 Blood, January 1, 2006; 107(1): 87 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Martelli, B. Ghinassi, B. Panetta, E. Alfani, V. Gatta, A. Pancrazzi, C. Bogani, A. M. Vannucchi, F. Paoletti, G. Migliaccio, et al. Variegation of the phenotype induced by the Gata1low mutation in mice of different genetic backgrounds Blood, December 15, 2005; 106(13): 4102 - 4113. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Hall, N. J. Slater, C. G. Begley, J. M. Salmon, L. J. Van Stekelenburg, M. P. McCormack, S. M. Jane, and D. J. Curtis Functional but Abnormal Adult Erythropoiesis in the Absence of the Stem Cell Leukemia Gene Mol. Cell. Biol., August 1, 2005; 25(15): 6355 - 6362. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Munugalavadla, L. C. Dore, B. L. Tan, L. Hong, M. Vishnu, M. J. Weiss, and R. Kapur Repression of c-Kit and Its Downstream Substrates by GATA-1 Inhibits Cell Proliferation during Erythroid Maturation Mol. Cell. Biol., August 1, 2005; 25(15): 6747 - 6759. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vannucchi, L. Bianchi, F. Paoletti, A. Pancrazzi, E. Torre, M. Nishikawa, M. Zingariello, A. Di Baldassarre, R. A. Rana, R. Lorenzini, et al. A pathobiologic pathway linking thrombopoietin, GATA-1, and TGF-{beta}1 in the development of myelofibrosis Blood, May 1, 2005; 105(9): 3493 - 3501. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Halupa, M. L. Bailey, K. Huang, N. N. Iscove, D. E. Levy, and D. L. Barber A novel role for STAT1 in regulating murine erythropoiesis: deletion of STAT1 results in overall reduction of erythroid progenitors and alters their distribution Blood, January 15, 2005; 105(2): 552 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhou, X. Kong, and D. I. H. Linzer Enhanced Recovery from Thrombocytopenia and Neutropenia in Mice Constitutively Expressing a Placental Hematopoietic Cytokine Endocrinology, January 1, 2005; 146(1): 64 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakano, K. Ohneda, H. Yamamoto-Mukai, R. Shimizu, O. Ohneda, S. Ohmura, M. Suzuki, S. Tsukamoto, T. Yanagawa, H. Yoshida, et al. Transgenic over-expression of GATA-1 mutant lacking N-finger domain causes hemolytic syndrome in mouse erythroid cells Genes Cells, January 1, 2005; 10(1): 47 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakano, S. Imagawa, K. Matsumoto, C. Stockmann, N. Obara, N. Suzuki, T. Doi, T. Kodama, S. Takahashi, T. Nagasawa, et al. Oral administration of K-11706 inhibits GATA binding activity, enhances hypoxia-inducible factor 1 binding activity, and restores indicators in an in vivo mouse model of anemia of chronic disease Blood, December 15, 2004; 104(13): 4300 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Centurione, A. Di Baldassarre, M. Zingariello, D. Bosco, V. Gatta, R. A. Rana, V. Langella, A. Di Virgilio, A. M. Vannucchi, and A. R. Migliaccio Increased and pathologic emperipolesis of neutrophils within megakaryocytes associated with marrow fibrosis in GATA-1low mice Blood, December 1, 2004; 104(12): 3573 - 3580. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rylski, J. J. Welch, Y.-Y. Chen, D. L. Letting, J. A. Diehl, L. A. Chodosh, G. A. Blobel, and M. J. Weiss GATA-1-Mediated Proliferation Arrest during Erythroid Maturation Mol. Cell. Biol., July 15, 2003; 23(14): 5031 - 5042. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Migliaccio, R. A. Rana, M. Sanchez, R. Lorenzini, L. Centurione, L. Bianchi, A. M. Vannucchi, G. Migliaccio, and S. H. Orkin GATA-1 as a Regulator of Mast Cell Differentiation Revealed by the Phenotype of the GATA-1low Mouse Mutant J. Exp. Med., February 3, 2003; 197(3): 281 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, R. A. Rana, R. Lorenzini, G. Migliaccio, and A. R. Migliaccio Development of myelofibrosis in mice genetically impaired for GATA-1 expression (GATA-1low mice) Blood, July 30, 2002; 100(4): 1123 - 1132. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||