| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Molecular and Experimental
Medicine, The Scripps Research Institute, La Jolla; the Department of
Pediatrics, University of California at San Diego Medical Center; the
Immunology Program, Sidney Kimmel Cancer Center, San Diego, CA; and the
Department of Pathology, Johns Hopkins University, Baltimore, MD.
Childhood T-cell acute lymphoblastic leukemia (T-ALL) is one of the
most common childhood cancers. It is reported that preconditioning sublethally irradiated immunodeficient NOD/SCID (nonobese
diabetic/X-linked severe combined immunodeficient) mice with human
cord blood mononuclear cells facilitates the engraftment,
expansion, and dissemination in these mice of primary T-ALL cells
obtained from patients at the time of diagnosis. Cells recovered from
mouse bone marrow or spleen resembled the original leukemia cells from
patients with respect to surface lineage markers and T-cell receptor
V Childhood T-cell acute lymphoblastic leukemia
(T-ALL) comprises approximately 15% of the heterogeneous group of ALL
cases.1 Currently, more than 70% of children with ALL are
disease free 5 years after chemotherapy. However, subgroups of patients
remain refractory to treatment. Because T-ALL is an aggressive disease, patients often require intensive chemotherapy; should they relapse, the
clinical outcome is dismal.1 Even though a number of
leukemia cell lines of T-cell origin have been established from
patients,2-5 difficulty in maintaining primary cultures of
leukemia cells from patients has impeded study of the development of
the disease.
Kamel-Reid et al6 have shown that human non-T-ALL can
proliferate in the hematopoietic tissues of immunodeficient X-linked severe combined immunodeficient (SCID) mice. Successful engraftment of
T-lineage ALL, however, has until recently been limited to a few
samples obtained from patients at the time of relapse.7 The availability of nonobese diabetic (NOD)/SCID mice has provided a
new and improved milieu for the engraftment of human T-ALL, albeit with
modest and slow engraftment.8 We therefore addressed the
hypothesis that preconditioning NOD/SCID mice by engrafting human cord
blood-derived hematopoietic cells9,10 We report here that this preconditioning regimen for immunodeficient
mice does indeed facilitate the engraftment, expansion, and
dissemination in vivo of primary leukemia from patients with T-ALL. We
also show that in this system human T-ALL cells recovered from
engrafted mouse bone marrow are morphologically identifiable, similar
to primary leukemia cells, and maintain the leukemia-initiating capacity for serial transfer to other mouse recipients. Therefore, the
experimental approach described here should enable us to study the in
vivo growth properties of primary T-ALL cells obtained from patients
and should prove useful in evaluating the potential efficacy of
therapeutic strategies directed to T-ALL.
NOD/SCID mice
Primary leukemia cells
Human cord blood Fetal cord blood samples were obtained from umbilical cord scheduled for discard, according to procedures approved by our institutional Human Subjects Committee. After Ficoll-Hypaque density-gradient centrifugation, the MNCs were collected and washed with RPMI 1640 medium containing 2% fetal calf serum. Cord blood was used for injection, as described below.Mouse injections Before T-ALL implantation, each mouse received 3.5 Gy total body irradiation from a cesium Cs 137 -irradiator. Immediately thereafter, approximately 10 to 25 × 106 fetal cord
blood MNCs from healthy newborns was injected in 0.25 mL sterile
phosphate-buffered saline through the tail vein. For a given
experiment, cord blood from a single donor was used for all mice. Six
to 9 days later, approximately 1 to 5 × 106 viable fresh
or cryopreserved primary leukemia cells from a patient were suspended
in 0.25 mL phosphate-buffered saline and injected through the tail
vein. Mice not preconditioned with cord blood were irradiated on the
same day as the cord blood-preconditioned mice and injected with T-ALL
cells, 9 days after irradiation. For a given experiment, leukemia cells
from a single donor were used for all mice. Experiments were set up so
that each treatment was typically replicated in 2 to 4 mice.
Mice were killed when they became moribund with disseminated
leukemia or electively between 5 and 7 weeks after the leukemia cell
injection. Necropsies were performed, and the burden of human leukemia
cells in mouse tissues was determined by flow cytometry,
histocytochemistry, and T-cell receptor (TCR) V gene rearrangement,
as described below.
Collection of mouse tissues Gross examination of various mouse tissues was performed after laparotomy immediately after death. Multiple tissues from mice (including liver, kidney, lung, thymus, lymph node, adrenal gland, and brain) were fixed in aqueous-buffered zinc formalin (Z-Fix; Anatech, Battle Creek, MI), dehydrated, and embedded in paraffin by routine methods. Glass slides with 4-µm tissue sections were prepared and stained with hematoxylin/eosin. Mouse bone marrow was collected from femurs and tibias. Single-cell suspension was prepared by gentle pipetting. Spleen cells were collected by gentle dissociation. Red blood cells within the bone marrow and spleen cell suspensions were lysed using buffered ammonium chloride. Cell debris was removed by filtration through a sterile nylon cell strainer (Becton Dickinson, San Jose, CA). Mouse peripheral blood was collected into heparin by retro-orbital bleeding and cardiac puncture; MNCs were isolated by Ficoll-Hypaque centrifugation. In addition, bone marrow touch preparations and blood smears were made and stained with modified Wright solution.Flow cytometry Multiparameter analysis of single-cell suspensions from mouse bone marrow, spleen, and peripheral blood was carried out using a FACScan flow cytometer (Becton Dickinson). Two-color immunofluorescence was used to identify human T-lineage ALL cells. Fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated mouse antihuman monoclonal antibodies (mAbs) were obtained from PharMingen (San Diego, CA), with the exception of PE-conjugated anti-TCR V 2 (clone MPB2D5; Coulter, Miami, FL). The mAbs used in the work presented here include
those directed against human CD5 (clone UCHT2), CD7 (M-T701), CD19
(HIB19), and CD45 (clone HI30). During analysis, residual red blood
cells and debris were gated out on the basis of forward angle and
90° side scatter. At least 15 000 events were collected for
each sample. Isotype-matched control mAbs (FITC- or PE-conjugated IgG1
[clone MOPC-21]) were used to determine appropriate cursor settings
for analysis. Using CellQuest 3.2.1 software (Becton Dickinson), data
were analyzed and displayed by 2-dimensional plots and by 1-dimensional
histograms. In control experiments, it was shown that none of these
mAbs targeting toward human hematopoietic cells cross-reacted with
mouse cells (pictures not shown), and their respective isotype controls
were used in all analysis reported in this study.
Analysis of human T-cell receptor
V gene expression by cell
samples, semiquantitative polymerase chain reaction (PCR) analysis was
performed as described previously.12 Briefly, total RNA
was isolated using the RNeasy Total RNA kit (Qiagen, Chatsworth, CA),
and RNA from the equivalent of 1 × 106 cells was
converted to cDNA in a 25-µL reaction using reverse transcriptase in the presence of an oligonucleotide primer
(5'AGGCAGTATCTGGAGTCATTGA3') complementary to a sequence found in both
human TCR V constant region genes C -1 and
C -2. Half the cDNA reaction was then transferred to a tube
containing Taq polymerase (30 U), Taq buffer, dNTPs (200 µM) and a
C primer internal to the primer used for cDNA synthesis,
5'GGGCGGGCTGCTCCTTGAGG3' (0.6 µM). Fifty microliters mixture was then
added to each of 30 individual wells of a microtiter plate that
contained individual V -specific oligonucleotide primers (0.6 µM),
and the samples were subjected to 28 rounds of PCR amplification consisting of 1-minute denaturation at 94°C, 2-minute annealing at
55°C, and 2-minute extension at 72°C. After amplification, 30 µL
was removed from each well, denatured, neutralized, and spotted onto
nitrocellulose filters. The filters were hybridized with a
32P end-labeled C oligonucleotide corresponding to a
sequence 5' to the one used in the PCR (5'CTCTGCTTCTGATGGCTCAAAC3'),
washed, and exposed to x-ray film.
DNA sequences of the V
Engraftment of primary leukemia from patients with T-ALL in NOD/SCID mice Low-level engraftment of primary human leukemia cells from patients occurs in the traditionally irradiated immunodeficient mouse.6,13,14 We investigated whether preconditioning the NOD/SCID mice with human cord blood would facilitate the subsequent engraftment of primary T-ALL cells. T-ALL engraftment in mouse bone marrow and spleen was determined initially by flow cytometry. CD45 expression is indicative of total human hematopoietic cell engraftment. CD7 is expressed by engrafted human T-lineage ALL. CD19 is indicative of engrafted human cells of the B-cell lineage. In the experiments presented, leukemia samples and data from the 8 patients were collected under protocol 9400 of the Pediatric Oncology Group. Clinical information about the patient donors is presented in Table 1.As shown in Figure 1, efficient
engraftment of primary T-ALL by 6 weeks depends on preconditioning the
mice with fetal cord blood MNCs. In the experiment presented (Figure
1), mice were injected either with or without 10 × 106
cord blood MNCs and, 9 days later, with 2.3 × 106
primary T-ALL cells. Each group of mice showed a remarkable difference in the efficiency of engraftment of human primary leukemia. Mice preconditioned with cord blood showed a high level of leukemia engraftment on day 40 after T-ALL injection. For the mouse presented in
Figure 1, 95% of bone marrow cells were human CD45+ and
87% were human CD7+ (Figure 1A); similarly, 59% of spleen
cells were CD45+ and 54% were CD7+ (Figure
1B). In contrast, the mice without cord blood preconditioning showed
little engraftment of human leukemia cells (5% of bone marrow cells
for the mouse presented in Figure 1) at this time point (Figure 1A,B).
That cord blood preconditioning facilitates T-ALL expansion in NOD/SCID
mice is apparent from an analysis of the total number of engrafted
T-ALL cells recovered. In this experiment, 1.0 × 108
T-ALL cells were recovered from bone marrow plus spleen from the mouse
preconditioned with cord blood in Figure 1. From the mouse without cord
blood preconditioning, only 0.95 × 106 T-ALL was
recovered from bone marrow plus spleen.
Based on the number of CD5+CD7+ cells recovered
from mouse bone marrow and spleen at 5 to 7 weeks after leukemia cell
injection, it was found that using different primary leukemia from 9 patients with T-ALL, the engrafted human T-ALL cells comprised
72 × 25% of bone marrow cells and 73 × 21% of spleen cells from
mice (Table 2). On average, the total
number of T-ALL cells recovered from engrafted bone marrow plus spleen
was approximately 30-fold greater than the number of primary T-ALL
cells initially injected (not shown). In this study, primary leukemia
samples were obtained from patients at the time of diagnosis. In
addition, fresh or cryopreserved MNCs from T-ALL patients achieved
comparable engraftment in these and other experiments.
The results presented here, along with those obtained using mAbs directed against CD2, CD3, CD5, CD20, CD38, or glycophorin A (below and not shown), indicate that, to the extent studied, phenotypes of cells recovered from engrafted mouse bone marrow and spleen were identical to those of injected primary T-ALL cells obtained from the patient. This was found to be the case for each of 8 patients with T-ALL leukemia. It is also important to determine whether these CD5+CD7+ cells are derived from the proliferation or expansion of cells in cord blood. In this respect, our recent findings15 demonstrate that 3.5 Gy-irradiated cord blood also facilitates the engraftment of T-ALL cells in NOD/SCID mice in a manner similar to that of fresh cord blood, as presented in Figure 1. Such experiments using irradiated cord blood MNCs thus do not support the contention that the CD5+CD7+ cells are of cord blood origin. Finally, because human cells expanded in NOD/SCID mice engrafted with cord blood alone are predominantly CD19+ (not shown),9,10,16-18 the paucity of CD19+ cells in mouse bone marrow or spleen in Figure 1 suggests that the expansion of these cells from engrafted cord blood used for preconditioning is in large part displaced by the expansion of T-ALL leukemia cells. To confirm that the human cells growing in the NOD/SCID mice were
leukemic, the modified Wright-stained bone marrow touch preparations
harvested from engrafted mice 6 weeks after transplantation were
examined. As shown in Figure 2,
characteristic morphologic features of human leukemia blasts were
clearly identifiable in mouse marrow samples obtained from mice
engrafted with T-ALL (indicated with arrowheads in Figure 2A). This is
in direct contrast to the unique morphology of leukocytes and other
mature cells found in the control mouse (Figure 2B). The notable
absence of normal mouse leukocytes in Figure 2A is in line with the
predominantly high level of leukemia engraftment in these mice.
Analysis of TCR V variable region gene (TCR
V ) rearrangement19 allows this rearrangement to be
used as a clonal marker for primary leukemia. For each of 2 patients,
total RNA isolated from primary T-ALL cells and from engrafted mouse
bone marrow and spleen was analyzed for human TCR V
gene expression.
In the following experiment, mice were injected with
10 × 106 cord blood MNCs and, 6 days later, with
3.3 × 106 primary T-ALL cells. These T-ALL cells from
the patient had been shown in the laboratory to have a
CD3+ Furthermore, DNA sequencing of the V Based on these findings, cells from the same 3 samples were analyzed by
flow cytometry after they were stained with a specific anti-V
Finally, analogous TCR V In vivo dissemination of human T-ALL in preconditioned NOD/SCID mice To further assess the fidelity of this mouse model of T-ALL to the human disease, we investigated the dissemination of the leukemia cells to other tissues (summarized in Table 2) and in peripheral blood. The dissemination of human T-ALL in mice preconditioned with human cord blood is illustrated in Figure 4, resulting in universally fatal leukemia. In liver, there were notable infiltrations of leukemia cells in portal areas and sinusoidal spaces (Figure 4A). Leukemia cells showed a characteristic chromatin pattern in the nuclei of cells with high nuclear-cytoplasm ratios. In kidney, human leukemia cells aggregated in perivascular and periglomerular interstitial spaces (Figure 4B). Immunohistochemical analysis of liver and kidney indicated that the infiltrating cells observed here expressed human CD5 and CD7 (not shown), consistent with the phenotype of the primary T-ALL cells injected (Table 1).
Leukemia infiltration was also found in the cortex region of the adrenal gland (Figure 4C). Normal lymph node architecture was totally effaced by a diffuse infiltration of immature lymphoid cells similar to those seen in liver (Figure 4D). Numerous leukemia cells (Figure 4E) destroyed the architecture seen in the normal thymus (Figure 4F). In the lung, leukemia cells were detected in the visceral pleura (not shown). In brain, leukemia cells were observed in the leptomeninges but not in the parenchyma (not shown). Therefore, the engrafted human leukemia in cord blood-preconditioned NOD/SCID mice disseminated to various tissues in a pattern similar to human disease. In contrast, at the same time point, there was no sign of widespread dissemination of human leukemia for the mice injected with primary T-ALL without cord blood preconditioning (not shown). In this in vivo model of human T-ALL, we also observed leukemia cells
in the peripheral blood of mice. For example, for the mouse in Figure
5, approximately 90% of the peripheral
blood MNCs were human T-ALL cells. In this mouse, T-ALL was present in
peripheral blood at 14 × 106 T-ALL cells per milliliter
with CD5+CD7+ and
CD7+V
Transfer of engrafted T-ALL to a secondary recipient We then addressed whether human T-cell leukemia in mice can be transferred to a secondary mouse recipient and whether T-ALL engraftment in the secondary recipient was also facilitated by preconditioning with human cord blood. To this end, we injected T-ALL cells from the engrafted spleen of a primary mouse recipient into secondary recipients that had or had not been preconditioned with cord blood.For the experiment presented in Figure 6,
mice were (Figure 6A,B) or were not (Figure 6C, D) preconditioned with
25 × 106 human cord blood MNCs 8 days before the
injection of 2.4 × 106 T-ALL cells recovered previously
from the engrafted spleen of a primary mouse recipient (human T-ALL
constituted 92% of these injected spleen cells). Five weeks after
T-ALL injection, the mice receiving cord blood were killed, and the
fraction of human CD5+ and CD7+ (T-ALL) cells
in bone marrow and spleen was determined. Because the primary T-ALL
cells of the patient also expressed TCR V
In marked contrast, analysis of a representative mouse not receiving cord blood revealed that at 6 weeks after T-ALL injection only approximately 3% T-ALL engraftment in bone marrow (Figure 6C) and negligible T-ALL engraftment in the spleen (Figure 6D) occurred. Therefore, results also suggest that engraftment in a secondary recipient also is facilitated by preconditioning the mouse with human cord blood.
In this study, we report that preconditioning NOD/SCID
mice with fetal cord blood facilitates the engraftment, expansion, and
dissemination in mice of primary human T-ALL cells obtained from
patients. Cells recovered from engrafted mouse bone marrow or spleen
resembled the original cells from patients not only with respect to the
expression of various lineage markers but also with respect to
TCR V In this study, several independent approaches have been used
to provide evidence for the human leukemia origin in cells harvested from engrafted mice. These include (1) phenotypic analysis using more
than 9 different markers (including the lack of CD19+
cells), (2) gene usage of TCR V It has also been suggested that injected T-ALL cells may alter the growth or lead to the expansion of subsets of human cord blood cells in NOD/SCID mice. Although intriguing, this contention does not gain support from our recent findings15 that 3.5 Gy-irradiated cord blood also facilitates the engraftment of T-ALL cells in NOD/SCID mice in a manner similar to that of fresh cord blood. In addition, it was reported recently that CD5+ cells were found among CD19+ B lymphoid cells in NOD/SCID mice injected with only cord blood.23 This observation is in line with numerous reports that human cells expanded in NOD/SCID mice engrafted with cord blood alone are predominantly CD19+.9,10,16-18 The paucity of CD19+ cells in the engrafted NOD/SCID mice suggests that the demonstration of CD5+CD7+ cells in these mice is less likely be attributed to the expansion of this subset of CD5+CD19+ double-staining cells, as observed in Novelli et al.23 Instead, the results suggest that the expansion of the cells from engrafted cord blood used for preconditioning has, in large part, been displaced by the expansion of T-ALL leukemia cells. Efficient engraftment in mouse bone marrow was typically observed when
more than 1 × 106 primary T-ALL cells were injected and
was also dependent on the number of cord blood cells used for
preconditioning (D.P.D. et al, manuscript submitted). The
capacity of cord blood preconditioning to facilitate the subsequent
engraftment in NOD/SCID mice of primary human T-ALL is interesting in
light of previous in vivo work in SCID mice indicating that human cord
blood manifests antileukemia activity directed against leukemia cell
lines.24 A number of significant differences between the 2 in vivo systems Furthermore, we achieved approximately 30-fold expansion of human leukemia cells in primary mouse recipients. Transfer into secondary mouse recipients expanded the patient's primary leukemia approximately another 30-fold. These expanded leukemia cells can be stored and used subsequently for an increased number of in vivo preclinical tests of new therapies directed against childhood T-ALL. Therefore, this in vivo mouse model of human leukemia will enable not only the study of the growth properties of primary leukemia and the analysis of the so-called leukemia-initiating cell,25 it will also enable the evaluation of the potential efficacy of therapeutic strategies in vivo. Whereas in previous studies only subgroups of patients with more aggressive T-ALL or patients at relapse had successful engraftment of primary leukemia in immunodeficient mice,7,14 the present studies achieved significant engraftment, expansion, and dissemination of T-ALL cells obtained from patients at the time of diagnosis. In addition, both fresh and cryopreserved MNCs from patients with T-ALL achieved comparable engraftment in these and other experiments. Moreover, we have shown that this mouse model leads to engraftment of the leukemia in secondary mouse recipients that also were preconditioned with human cord blood. Present studies also indicated that the leukemia-initiating capacity was maintained within the leukemia-engrafted mouse. Leukemic progenitor cells have been implicated in the maintenance and expansion of leukemic blast populations.26,27 Until recently, clonogenic blast cells could only be identified based on their ability to proliferate and form colonies in semisolid media in response to specific growth factors,28,29 with the colony-forming blasts assumed to represent the in vitro counterparts of the in vivo ALL blast progenitors.26 Only recently have leukemia-initiating cells been demonstrated in vivo.25,30-32 The ongoing development of in vivo mouse models for leukemia is expected to expedite characterization of these leukemia-initiating cells.30 The phenotype of the leukemia-initiating cell for T-ALL is presently unknown; in particular, there is no specific marker to distinguish these clonogenic blasts from nonprogenitor blasts in the primary leukemia. We show here, by serial transfer of the leukemia, that in our mouse model the T-ALL leukemia-initiating capacity is maintained within the leukemia-engrafted mouse. Our mouse model should therefore facilitate the identification of signals driving in vivo expansion of these leukemic clonogenic cells and the identification of progenitor-specific markers. It is unknown how preconditioning cord blood facilitates the engraftment of human T-ALL in NOD/SCID mice. It is conceivable that the engraftment of primary leukemia cells is supported by multiple mechanisms, including the release of cytokines, the differences in homing of the "adherent stromal cells," and the proliferation of mature accessory cells in the cord blood used here for preconditioning. For example, studies by Ildstad et al33 suggest that mouse and primate lymphocytes contain "facilitating cells" that can increase allogeneic engraftment, but only when cotransplanted with the major histocompatibility complex-matched hematopoietic cells. Alternatively, accessory cells in the cord blood could release cytokines that facilitate engraftment of the subsequently injected primary T-ALL cells. This interpretation seems to be consistent with recent observations that preconditioning with the irradiated cord blood also enhanced the leukemia engraftment in NOD/SCID mice.15 Recently, the chemokine stromal derived factor-1 (SDF-1) has been implicated in the homing of normal human hematopoietic stem cells to bone marrow in the NOD/SCID mouse.34 Although it is intriguing to find expression of the receptor for SDF-1, namely CXCR4, in primary leukemia from patients with T-ALL, it is also shown that the presence of these CXCR4 receptors does not result in the transmigration of T-ALL cells induced by SDF-1 (D.P.D. et al, manuscript submitted). Therefore, the functionality of the expressed CXCR4 and the importance of cord blood-derived SDF-1 to the enhancement of leukemia engraftment are unknown. Collectively, the results presented here support the thesis that engrafted human cells of cord blood origin provide important microenvironmental signals that in the NOD/SCID mouse are otherwise limiting with respect to engraftment of human primary T-ALL. The identity of the putative limiting signal(s) and the cord blood cell(s) from which T-ALL is derived is under investigation in our laboratory. We have shown, for example, that a cord blood-conditioned medium significantly increases the number and the burst size of primary T-ALL colonies in methylcellulose culture.35,36 In addition, it was recently found that after reconstitution with human cord blood alone, a significant fraction of mouse bone marrow cells was of human cord blood cell origin and that cells harvested from mice indeed secreted factor(s) into conditioned medium that enhanced human leukemia colony formation in culture by at least 2-fold.15 However, much work will have to be performed to prove any mechanism(s) by which cord blood cells facilitate T-ALL engraftment observed in this study. In addition, it is also an unsettled, but important, issue to determine how these laboratory observations will translate for transplantations using cord blood. In conclusion, the significance of the work presented here is several-fold. It establishes a novel and possibly a more clinically relevant experimental avenue for delineating signals critical in vivo for T-ALL engraftment, expansion, and metastasis of primary leukemia obtained from patients. For example, the mouse model described here should lend itself to the characterization of signals driving engraftment and expansion of the putative leukemia-initiating cell. Finally, our work establishes a robust in vivo system for the evaluation of newly developed therapeutic strategies directed against T-ALL.
We thank Judith Preston for secretarial assistance in the preparation of this manuscript. We thank the investigators from the Pediatric Oncology Group for providing primary T-ALL samples, the staff at PharMingen for generously providing antibodies, and the staff at Scripps GCRC for flow cytometry support.
Submitted December 7, 2000; accepted January 18, 2001.
Supported by the Leukemia Society of America (grant 6226) and the National Institutes of Health (grants CA 79951 and MO1-RR00833). D.P.G. is a Scholar of the Leukemia Society of America.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: John Yu, Department of Molecular and Experimental Medicine, MEM265, The Scripps Research Institute, 10550 North Torrey Pines Rd, La Jolla, CA 92037.
1.
Kersey JH.
Fifty years of studies of the biology and therapy of childhood leukemia.
Blood.
1997;90:4243-4251
2.
Gjerset R, Yu A, Haas M.
Establishment of continuous cultures of T-cell acute lymphoblastic leukemia cells at diagnosis.
Cancer Res.
1990;50:10-14
3.
Smith SD, Uyeki EM, Lowman JT.
Colony formation in vitro by leukemic cells in acute lymphoblastic leukemia (ALL).
Blood.
1978;52:712-718
4.
Lange B, Valtieri M, Santoli D, et al.
Growth factor requirements of childhood acute leukemia: establishment of GM-CSF-dependent cell lines.
Blood.
1987;70:192-199
5.
Smith SD, Shatsky M, Cohen PS, Warnke R, Link MP, Glader BE.
Monoclonal antibody and enzymatic prolifes of human malignant T-lymphoid cells and derived cell lines.
Cancer Res.
1984;44:5657-5660
6.
Kamel-Reid S, Letarte M, Sirard C, et al.
A model of human acute lymphoblastic leukemia in immune-deficient SCID mice.
Science.
1989;246:1597-1600
7.
Cesano A, O'Connor R, Lange B, Finan J, Rovera G, Santoli D.
Homing and progression patterns of childhood actue lymphoblastic leukemias in severe combined immunodeficiency mice.
Blood.
1991;77:2463-2474
8.
Steele JPC, Clutterbuck RD, Powles RL, et al.
Growth of human T-cell lineage acute leukemia in severe combined immunodeficiency (SCID) mice and non-obese diabetic SCID mice.
Blood.
1997;90:2015-2019
9.
Vormoor J, Lapidot T, Pflumio F, et al.
Immature human cord blood progenitors engraft and proliferate to high levels in severe combined immunodeficient mice.
Blood.
1994;83:2489-2497
10.
Hogan CJ, Shpall EJ, McNulty O, et al.
Engraftment and development of human CD34+ -enriched cells from umbilical cord blood in NOD/LtSz-SCID/SCID mice.
Blood.
1997;90:85-96 11. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtsZ-SCID mice. J Immunol. 1995;154:180-191[Abstract]. 12. Wilson DB, Golding AB, Smith RA, et al. Results of a phase I clinical trial of a T cell receptor peptide vaccine in patients with multiple sclerosis, I: analysis of T cell receptor utilization in CSF cell population. J Neuroimmunol. 1997;76:15-28[CrossRef][Medline] [Order article via Infotrieve]. 13. Williams SS, Alosco TR, Croy BA, Bankert RB. The study of human neoplastic disease in severe combined immunodeficient mice. Lab Anim Sci. 1993;43:139-146[Medline] [Order article via Infotrieve].
14.
Uckun FM.
Severe combined immunodeficient mouse models of human leukemia.
Blood.
1996;88:1135-1146 15. Shao L, Yu J. Human leukemia colony enhancing activity derived from bone marrow of the human cord blood reconstituted NOD/SCID mice [abstract]. Blood. 2000;96:767. 16. Kollmann TR, Kim A, Zhuang X, Hachamovitch M, Goldstein H. Reconstitution of SCID mice with human lymphoid and myeloid cells after transplantation with human fetal bone marrow without the requirement for exogenous human cytokines. Immunology. 1994;91:8032-8036. 17. Yu J. Regulation and reconstitution of human hematopoiesis. J Formos Med Assoc. 1996;95:281-293[Medline] [Order article via Infotrieve].
18.
Pflumio F, Izac B, Katz A, Shultz LD, Vainchenker W, Coulombel L.
Phenotype and function of human hematopoietic cells engrafting immune-deficient CB17-severe combined immunodeficiency mice and nonobese diabetic-severe combined immunodeficiency mice after transplantation of human cord blood mononuclear cells.
Blood.
1996;88:3731-3740
19.
Arstila TP, Casrough A, Baron V, Even J, Kanellopoulos J, Kourilsky P.
A direct estimate of the human
20.
Clarke GR, Reyburn H, Lancaster FC, Boylston AW.
Bimodal distribution of V
21.
Davodeau F, Peyrat M-A, Fomagne F, et al.
Dual T cell receptor
22.
Padovan E, Giachino C, Cella M, Valitutti S, Acuto O, Lanzavecchia A.
Normal T lymphocytes can express two different T cell receptor 23. Novelli EM, Ramirez M, Leung W, Civin CI. Human hematopoietic stem/progenitor cells generate CD5+ B lymphoid cells in NOD/SCID mice. Stem Cells. 2000;17:242-252[Medline] [Order article via Infotrieve]. 24. Harris DT. In vitro and in vivo assessment of the graft-versus-leukemia activity of cord blood. Bone Marrow Transplant. 1995;15:17-23[Medline] [Order article via Infotrieve].
25.
Ailles LE, Gerhard B, Kawagoe H, Hogge DE.
Growth characteristics of acute myelogenous leukemia progenitors that initiate malignant hematopoiesis in nonobese diabetic/severe combined immunodeficient mice.
Blood.
1999;94:1761-1772 26. Uckun FM, Myers DE, Ledbetter JA, Swain SE, Gajl-Peczalska KJ, Vallera DA. Use of colony assays and anti-T cell immunotoxins to elucidate the immunobiologic features of leukemic progenitor cells in T-lineage acute lymphoblastic leukemia. Immunology. 1988;140:2103-2111.
27.
Uckun FM, Kersey JH, Vallera DA, et al.
Autologous bone marrow transplantation in high-risk remission T-lineage acute lymphoblastic leukemia using immunotoxins plus 4-hydroperoxycyclophosphamide for marrow purging.
Blood.
1990;76:1723-1733
28.
Touw I, Delwel R, van Zanen G, Lowenberg B.
Acute lymphoblastic leukemia and non-Hodgkin's lymphoma of T lineage: colony-forming cells retain growth factor (interleukin 2) dependence.
Blood.
1986;68:1088-1094
29.
Touw I, Delwel R, Bolhuis R, van Zanen G, Lowenberg B.
Common and pre-B acute lymphoblastic leukemia cells express interleukin 2 receptors, and interleukin 2 stimulates in vitro colony formation.
Blood.
1985;66:556-561
30.
Holyoake T, Jiang X, Eaves C, Eaves A.
Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia.
Blood.
1999;94:2056-2064 31. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737[CrossRef][Medline] [Order article via Infotrieve].
32.
Terpstra W, Prins A, Ploemacher RE, et al.
Long-term leukemia-initiating capacity of a CD34
33.
Kaufman CL, Colson YL, Wren SM, Watkins S, Simmons RL, Ildstad ST.
Phenotypic characterization of a novel bone marrow derived cell that facilitates engraftment of allogeneic bone marrow stem cells.
Blood.
1994;84:2436-2446
34.
Peled A, Petit I, Kollet O, et al.
Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4.
Science.
1999;283:845-848 35. Yu J, Dialynas DP, Shao L-E, Lee M-J, Gold DP, Yu AL. Fetal cord blood facilitates engraftment of primary childhood T-cell acute lymphoblastic leukemia in immunodeficient mice and enhances leukemia colony formation in vitro [abstract]. Proc Am Assoc Cancer Res. 1999;40:660. 36. Shao L-E, Dialynas DP, Yu AL, Mackintosh E, Yu J. Human cord blood conditioned medium enhances leukemia colony formation in vitro. Leuk Res. 2000;24:1041-1048[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
F. Armstrong, P. B. de la Grange, B. Gerby, M.-C. Rouyez, J. Calvo, M. Fontenay, N. Boissel, H. Dombret, A. Baruchel, J. Landman-Parker, et al. NOTCH is a key regulator of human T-cell acute leukemia initiating cell activity Blood, February 19, 2009; 113(8): 1730 - 1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Lin, M.-W. Kuo, J. Yu, H.-H. Kuo, R.-J. Lin, W.-L. Lo, and A. L. Yu c-Myb Is an Evolutionary Conserved miR-150 Target and miR-150/c-Myb Interaction Is Important for Embryonic Development Mol. Biol. Evol., October 1, 2008; 25(10): 2189 - 2198. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Cox, H. M. Martin, P. R. Kearns, P. Virgo, R. S. Evely, and A. Blair Characterization of a progenitor cell population in childhood T-cell acute lymphoblastic leukemia Blood, January 15, 2007; 109(2): 674 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. M. Liem, R. A. Papa, C. G. Milross, M. A. Schmid, M. Tajbakhsh, S. Choi, C. D. Ramirez, A. M. Rice, M. Haber, M. D. Norris, et al. Characterization of childhood acute lymphoblastic leukemia xenograft models for the preclinical evaluation of new therapies Blood, May 15, 2004; 103(10): 3905 - 3914. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Houghton, P. C. Adamson, S. Blaney, H. A. Fine, R. Gorlick, M. Haber, L. Helman, S. Hirschfeld, M. G. Hollingshead, M. A. Israel, et al. Testing of New Agents in Childhood Cancer Preclinical Models: Meeting Summary Clin. Cancer Res., December 1, 2002; 8(12): 3646 - 3657. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Lock, N. Liem, M. L. Farnsworth, C. G. Milross, C. Xue, M. Tajbakhsh, M. Haber, M. D. Norris, G. M. Marshall, and A. M. Rice The nonobese diabetic/severe combined immunodeficient (NOD/SCID) mouse model of childhood acute lymphoblastic leukemia reveals intrinsic differences in biologic characteristics at diagnosis and relapse Blood, May 13, 2002; 99(11): 4100 - 4108. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||