Blood, 15 May 2001, Vol. 97, No. 10, pp. 3308-3310
BRIEF REPORT
Molecular genetic basis of porcine histo-blood group AO
system
Fumiichiro Yamamoto and
Miyako Yamamoto
From the Burnham Institute, La Jolla Cancer Research
Center, La Jolla, CA.
 |
Abstract |
Histo-blood group A and B antigens are oligosaccharide antigens
important in transfusion and transplantation medicine. The final steps
in the synthesis of these antigens are catalyzed by glycosyltransferases encoded by the functional alleles at the ABO
locus. Humans have 3 major alleles (A, B, and O), whereas pigs
are known to have only A and O alleles. This paper reports the
molecular genetic basis of the porcine AO system. The porcine A gene is
homologous to the ABO genes in humans and other species. It encodes an
1 
3
N-acetyl-D-galactosaminyltransferase that synthesizes A antigens. Southern hybridization experiments using a
porcine A gene coding-sequence probe failed to identify a corresponding homologous sequence in genomic DNA from group O pigs, thus suggesting a
major deletion in the O gene. Therefore, inadvertent activation of a
silent O gene seems unlikely in porcine organs xenotransplanted into humans.
(Blood. 2001;97:3308-3310)
© 2001 by The American Society of Hematology.
| |
Introduction |
The immunodominant structures of A and B antigens
are defined as N-acetyl-D-galactosamine (GalNAc)
1 3 (Fuc 12) Gal- and Gal 1 3 (Fuc
1 2) Gal-, respectively. The blood group A gene encodes A
transferase, which transfers GalNAc to the galactose residue of the
acceptor H substrates (Fuc 1 2 Gal-), whereas the B gene
encodes B transferase, which transfers galactose to the same
substrates. Group O genes are nonfunctional, and H substrates in group
O individuals remain without additional modifications.
For the past decade, we have been studying the genes that specify
the histo-blood group ABO polymorphism.1 On the basis of
the partial amino acid sequence of the soluble form of A
transferase,2 we cloned human A transferase complementary
DNAs (cDNAs).3 Subsequently, we cloned B transferase cDNAs
and nonfunctional O allelic cDNAs and elucidated the molecular genetic
basis of the human ABO locus.4 Four amino acid
substitutions were identified between A transferase and B transferase.
Most O alleles were found to contain a single base deletion near the
N-terminus of the coding sequence. In rare cases in which O alleles
were missing the single base deletion, an amino acid substitution was
found at a residue crucial for nucleotide-sugar recognition and
binding.5 In addition to the 3 major alleles, we
identified mutations in subgroup alleles and in cis
AB and B(A) alleles that specify the synthesis of both A and B
antigens.1 The updated list of ABO alleles is available at
the Blood Group Antigen Gene Mutation Database Web site
(http://www.bioc.aecom.yu.edu/bgmut/index.htm).
ABH antigens are not unique to humans; rather, they are widely present
in nature.6 Pigs, for example, have A and
H.7,8 Using a human A gene probe, we observed strong
hybridization signals in genomic DNAs from various
mammals.9 We also determined partial nucleotide sequences
of ABO genes from several primate species and observed that
conservation of amino acid residues critical for nucleotide-sugar
substrate recognition and binding in monkeys was dependent on their ABO
genotypes. We have now extended our ABO studies to other mammals.
Because pigs are primary candidates for organ donors for humans,
characterization of porcine O gene deficiency has both clinical and
scientific importance. We here report the molecular genetic basis of
the porcine AO system.
| |
Study design |
This study used polymerase chain reaction (PCR)
amplification of porcine AO gene fragments. The AO phenotypes of 33 porcine submaxillary glands were immunologically determined by examining A antigen expression with use of murine monoclonal antibody mixtures (Ortho, Raritan, NJ), avidin-biotin complex reagents, and 3, 3'-diaminobenzidine substrates (Vector, Burlingame, CA). A
transferase activity of submaxillary gland extracts was measured by
transfer of carbon 14 (14C) from 14C-uridine
diphosphate-GalNAc to the acceptor substrate 2'-fucosyllactose as
described previously.10 Genomic DNA was prepared from
representative group A and O pig glands. DNA fragments were amplified
by using FY-520 (5'-CCGGAATTCAACACTTCATGGTGGGACAC) and FY-521
(CCGGAATTCTAGCTCTCATCATGCCACAC), which are 2 primers that correspond to
sequences conserved between human ABO genes (AF134412), and recently
cloned murine genes (AB041039; M.Y. et al, unpublished data, 2001).
Amplified DNA fragments were digested with EcoRI and cloned
into pT7T318 vector. The nucleotide sequences were then determined.
| |
Results and discussion |
Of the 33 porcine submaxillary glands, 31 were group A and 2 were
group O. A transferase activity was detected only in the glands
positive for A antigen. Nucleotide sequencing revealed that 2 sequences
were amplified from the group A genomic DNA. One sequence (AB041040)
showed high homology to human and murine ABO genes. A search of GenBank
with the Basic Local Alignment Search Tool database identified the
entry AF050177, which appears to contain the complete coding sequence
of the putative A transferase. We cloned the sequence by reverse
transcriptase-PCR using poly A+ RNA from a group A
submaxillary gland and constructed pPigA expression constructs in sense
and antisense orientations. DNA from these constructs was then used for
DNA transfection assays. Both A antigen expression and A transferase
activity were observed with the sense construct (Table
1). Therefore, we concluded that
the sequence encoded A transferase.
View this table:
[in this window]
[in a new window]
|
Table 1.
Cell-surface A and B antigen expression and A and B
transferase activity in the extracts of HeLa cells transfected with
eukaryotic expression constructs
|
|
The other amplified sequence was also homologous to the ABO genes but
to a lesser degree. This sequence had greater homology to the human
hgt4 pseudogene sequence12 (data not shown). When genomic
DNA from a group O pig was used as a PCR template, however, only the
pseudogene fragment was amplified. Because amplification failure may
have resulted from mismatch of primer sequences, we did additional
evaluations using Southern hybridization. As shown in Figure
1B, no corresponding bands were
hybridized in the group O pig DNA with the porcine A gene
coding-sequence probe. We analyzed 2 group O pigs and obtained the same
results (data not shown). Therefore, the results showed that most of
the coding region was missing in the porcine O gene.
View larger version (96K):
[in this window]
[in a new window]
| Figure 1.
Southern hybridization experiments.
Genomic DNA from group A (lanes 1, 3, and 5) and group O (lanes 2, 4, and 6) porcine submaxillary glands was digested with EcoRI
(lanes 1 and 2) alone or BamHI (lanes 5 and 6) alone or with
both EcoRI and BamHI (lanes 3 and 4) and
electrophoresed through a 1% agarose gel. DNA was then transferred by
using the Southern method to a nylon membrane and hybridized in
Ultrahyb hybridization buffer (Ambion, Austin, TX) with a cloned
porcine A gene fragment probe, which was radiolabeled by using the
random-hexamer method. Hybridization was done at 42°C overnight.
Subsequently, the filter was washed twice with 2 × standard saline
citrate (SSC) and 0.1% sodium dodecyl sulfate (SDS) at 42°C for 10 minutes. This was followed by another washing with 0.1 × SSC and
0.1% SDS at 42°C for 15 minutes. The filter was then exposed to
x-ray film. The same filter was later hybridized with a radiolabeled
porcine 1-3 galactosyltransferase gene sequence
probe.13 Figure 1A shows the results of electrophoresis,
and Figures 1B and 1C show the results of hybridization experiments
with the porcine A gene probe (B) and the porcine 1 3
galactosyltransferase gene probe (C). The very weak bands common to the
A and O pig DNA may have resulted from cross-hybridization of the A
gene probe with the sequence homologous to the human hgt4
pseudogene.11
|
|
We then hybridized the membrane with the 1-3 galactosyltransferase
gene coding-sequence probe. The 1-3 galactosyltransferase specifies
the 1 3 Gal epitope that is expressed on various porcine
cells, including erythrocytes and aortic endothelial cells. Human
immune systems launch an immediate hyperacute rejection of cells
expressing this epitope.14 The gene that encodes the enzyme is a member of the ABO gene family,11 and the
porcine 1-3 galactosyltransferase gene is mapped on chromosome
1q2.10 to 2.11, which is homologous to the human chromosome 9q34, where the ABO locus resides.13 The presence of the 1-3 galactosyltransferase gene in the group O pig DNA (Figure 1C) indicated
that the deletion does not extend to the 1-3 galactosyltransferase
gene locus.
In spite of concern that porcine viruses could enter human cells and
cause disease or recombine with other viral sequences to create a new
virus,15 xenotransplantation of porcine organs into
patients with chronic organ failure has been considered an option for
overcoming the shortage of human organs for transplantation. Successful
pig cloning16,17 may help to reduce the risk of pig
xenotransplantation. With the aim of developing pigs suitable for organ
supply, attempts have been made to modify 1 3 Gal epitope
synthesis. These efforts include knockout of the 1-3 galactosyltransferase gene in mice (but not yet in pigs)18
and production of transgenic pigs with the introduced human 1-2 fucosyltransferase gene.19 Because the biosynthetic
pathways of carbohydrate structures of glycolipids and glycoproteins
are complex and interrelated, manipulation of 1-3 galactosyltransferase alone may not be sufficient. Pigs are negative
for the Forssman antigen, and the inactivating mechanism of the
Forssman glycolipid synthetase gene is still unknown.
In a phenomenon called incompatible A expression,20,21
expression of A antigen is observed in tumors in individuals with blood
group B or O, who do not normally produce A antigens. The molecular mechanism underlining this aberrant expression of A antigen
is unknown; however, the appearance of not only A antigens but also A
transferase activity22 suggests that the messages encoding
functional A transferase were produced by premature splicing or some
other mechanism. In this study, we found evidence of a major deletion
in the porcine O gene. In contrast to what may occur with human O
genes, it is unlikely that the dormant O gene would be fortuitously
activated in porcine organs xenotransplanted in humans, since most of
the coding sequence is missing in the porcine O gene.
| |
Acknowledgments |
We thank Dr Sandra S. Matsumoto for critically reading the
manuscript and Ami Yamamoto for editing the manuscript.
| |
Footnotes |
Submitted November 16, 2000; accepted January 18, 2001.
Supported in part by funds from the Burnham Institute and the
Department of Defense Breast Cancer Research Program (DAMD
17-98-1-8168).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Fumiichiro Yamamoto, Burnham Institute, La Jolla
Cancer Research Center, 10901 N Torrey Pines Rd, La Jolla, CA 92037;
e-mail: fyamamoto{at}burnham.org.
| |
References |
1.
Yamamoto F.
Molecular genetics of ABO.
Vox Sang.
2000;78:91-103.
2.
Clausen H, White T, Takio K, et al.
Isolation to homogeneity and partial characterization of a histo-blood group A defined Fuc 1 2 Gal 1 3-N-acetylgalactosaminyltransferase from human lung tissue.
J Biol Chem.
1990;265:1139-1145[Abstract/Free Full Text].
3.
Yamamoto F, Marken J, Tsuji T, White T, Clausen H, Hakomori S.
Cloning and characterization of DNA complementary to human UDP-GalNAc: Fuc 1 2 Gal 1 3GalNAc transferase (histo-blood group A transferase) mRNA.
J Biol Chem.
1990;265:1146-1151[Abstract/Free Full Text].
4.
Yamamoto F, Clausen H, White T, Marken J, Hakomori S.
Molecular genetic basis of the histo-blood group ABO system.
Nature.
1990;345:229-233[CrossRef][Medline]
[Order article via Infotrieve].
5.
Yamamoto F, McNeill PD, Yamamoto M, Hakomori S, Bromilow IM, Duguid JK.
Molecular genetic analysis of the ABO blood group system, 4: another type of O allele.
Vox Sang.
1993;64:175-178[Medline]
[Order article via Infotrieve].
6.
Kabat EA.
Blood Group Substances; Their Chemistry and Immunochemistry. New York, NY: Academic Press; 1956.
7.
Aminoff D, Morgan WTJ, Watkins WM.
Specific serological characters of the mucoids of hog gastric mucin.
Nature.
1946;158:879.
8.
Chadwick D, Smith H, Annison EF, Morgan WTJ.
Serological characters of hog gastric mucin.
Nature.
1949;164:61-62[CrossRef][Medline]
[Order article via Infotrieve].
9.
Kominato Y, McNeill PD, Yamamoto M, Russell M, Hakomori S, Yamamoto F.
Animal histo-blood group ABO genes.
Biochem Biophys Res Commun.
1992;189:154-164[CrossRef][Medline]
[Order article via Infotrieve].
10.
Yamamoto F, McNeill PD.
Amino acid residue at codon 268 determines both activity and nucleotide-sugar donor substrate specificity of human histo-blood group A and B transferases: in vitro mutagenesis study.
J Biol Chem.
1996;271:10515-10520[Abstract/Free Full Text].
11.
Yamamoto F, Hakomori S.
Sugar-nucleotide donor specificity of histo-blood group A and B transferases is based on amino acid substitutions.
J Biol Chem.
1990;265:19257-19262[Abstract/Free Full Text].
12.
Yamamoto F, McNeill PD, Hakomori S.
Identification in human genomic DNA of the sequence homologous but not identical to either the histo-blood group ABH genes or 1 3 galactosyltransferase pseudogene.
Biochem Biophys Res Commun.
1991;175:986-994[CrossRef][Medline]
[Order article via Infotrieve].
13.
Strahan KM, Gu F, Preece AF, Gustavsson I, Andersson L, Gustafsson K.
cDNA sequence and chromosome localization of pig 1,3 galactosyltransferase.
Immunogenetics.
1995;41:101-105[Medline]
[Order article via Infotrieve].
14.
Galili U, Macher BA, Buehler J, Shohet SB.
Human natural anti--galactosyl IgG, II: the specific recognition of (1 3)-linked galactose residues.
J Exp Med.
1985;162:573-582[Abstract/Free Full Text].
15.
Le Tissier P, Stoye JP, Takeuchi Y, Patience C, Weiss RA.
Two sets of human-tropic pig retrovirus.
Nature.
1997;389:681-682[CrossRef][Medline]
[Order article via Infotrieve].
16.
Polejaeva IA, Chen SH, Vaught TD, et al.
Cloned pigs produced by nuclear transfer from adult somatic cells.
Nature.
2000;407:86-90[CrossRef][Medline]
[Order article via Infotrieve].
17.
Onishi A, Iwamoto M, Akita T, et al.
Pig cloning by microinjection of fetal fibroblast nuclei.
Science.
2000;289:1188-1190[Abstract/Free Full Text].
18.
Tearle RG, Tange MJ, Zannettino ZL, et al.
The -1,3-galactosyltransferase knockout mouse: implications for xenotransplantation.
Transplantation.
1996;61:13-19[Medline]
[Order article via Infotrieve].
19.
Costa C, Zhao L, Burton WV, et al.
Expression of the human 1,2-fucosyltransferase in transgenic pigs modifies the cell surface carbohydrate phenotype and confers resistance to human serum-mediated cytolysis.
FASEB J.
1999;13:1762-1773[Abstract/Free Full Text].
20.
Clausen H, Hakomori S, Graem N, Dabelsteen E.
Incompatible A antigen expressed in tumors of blood group O individuals: immunochemical, immunohistologic, and enzymatic characterization.
J Immunol.
1986;136:326-330[Abstract].
21.
Metoki R, Kakudo K, Tsuji Y, Teng N, Clausen H, Hakomori S.
Deletion of histo-blood group A and B antigens and expression of incompatible A antigen in ovarian cancer.
J Natl Cancer Inst.
1989;81:1151-1157[Abstract/Free Full Text].
22.
David L, Leitao D, Sobrinho-Simoes M, et al.
Biosynthetic basis of incompatible histo-blood group A antigen expression: anti-A transferase antibodies reactive with gastric cancer tissue of type O individuals.
Cancer Res.
1993;53:5494-5500[Abstract/Free Full Text].
Top
Abstract
Introduction
