| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Hematology, University
Hospital; the Department of Pediatric Oncology/Hematology, Sophia
Children's Hospital; the Department of Statistics, Daniel den
Hoed Cancer Centre, Erasmus University, Rotterdam; and The
Dutch Childhood Leukemia Study Group, The Hague, The
Netherlands.
The expression of P-glycoprotein (P-gp), encoded by the
MDR1 gene, is an independent adverse prognostic factor for
response and survival in de novo acute myeloid leukemia (AML). Little
is known about MDR1 expression during the development of
disease. The present study investigated whether MDR1 gene-
related clonal selection occurs in the development from diagnosis to
relapsed AML, using a genetic polymorphism of the MDR1 gene
at position 2677. Expression and function of P-gp were studied using
monoclonal antibodies MRK16 and UIC2 and the Rhodamine 123 retention assay with or without PSC 833. No difference was
found in the levels of P-gp function and expression between diagnosis
and relapse in purified paired blast samples from 30 patients with AML.
Thirteen patients were homozygous for the genetic polymorphism of
MDR1 (n = 7 for guanine, n = 6 for thymidine), whereas
17 patients were heterozygous (GT). In the heterozygous patients, no
selective loss of one allele was observed at relapse. Homozygosity for
the MDR1 gene (GG or TT) was associated with shorter
relapse-free intervals (P = .002) and poor survival rates
(P = .02), compared with heterozygous patients. No
difference was found in P-gp expression or function in patients with
AML with either of the allelic variants of the MDR1 gene.
It was concluded that P-gp function or expression is not
upregulated at relapse/refractory disease and expression of one of
the allelic variants is not associated with altered P-gp expression or
function in AML, consistent with the fact that MDR1
gene-related clonal selection does not occur when AML evolves to
recurrent disease.
(Blood. 2001;97:3605-3611) Classic multidrug resistance (MDR) encoded by the
MDR1 gene is characterized by expression of P-glycoprotein
(P-gp), which acts as a drug efflux pump in the plasma membrane.
Expression of MDR1 has been identified as an independent
adverse prognostic factor for complete remission (CR) and survival in
patients with acute myeloid leukemia (AML), especially in
adults.1-11 Little is known about possible changes in
MDR1 gene expression during the development to relapse or
refractory disease, especially in paired analyses of clinical samples
of patients with AML. It is conceivable that MDR1 positive
clones develop by clonal selection during chemotherapy or by
MDR1 gene activation. This phenomenon has been described for
Burkitt lymphoma, in which single allelic MDR1 expression
was found to be up-regulated during the development of
disease.12
In the present study, we investigated whether clonal selection of one
MDR1 allele contributes to drug resistance in AML, by studying the genetic polymorphism of the MDR1 gene at
position 2677.13 This study was performed in paired
samples of patients with AML at time of diagnosis and at first relapse
or refractory disease. In addition, an analysis was performed of the
expression and function of P-gp. To the best of our knowledge, no
previous studies have been reported in which the P-gp levels were
measured in the allelic variants of the MDR1 gene.
Patients
Methods
Patient samples.
Bone marrow aspirates were obtained in heparinized tubes. Mononuclear
bone marrow cells (MNCs) were collected by Ficoll Hypaque density
gradient centrifugation (density 1.077g/m3) (Pharmacia,
Uppsala, Sweden). To obtain purified samples with more than 85%
blasts, T-cell depletion and adherence depletion were
performed.16 Cells were cryopreserved in Iscoves modified Dulbecco medium (IMDM; Gibco, Paisley, United Kingdom) supplemented with 10% dimethyl sulfoxide (DMSO; Merck, Darmstadt, Germany) and 20%
fetal calf serum (FCS; Gibco) and stored in liquid nitrogen. On the day
of the experiments bone marrow cells were thawed. For flowcytometry
experiments, cells were washed and resuspended in IMDM supplemented
with 10% FCS and gentamycin at a concentration of
4 × 106 cells/mL. Total RNA was isolated using Trisolv
extraction (Biotecx, Houston, TX).
Oligonucleotide hybridization and dotblot analysis.
Both DNA and RNA were used as templates in the polymerase chain
reaction (PCR). One microgram of genomic DNA was used as a template in the PCR for 40 cycles to investigate the genetic
polymorphism at the DNA level. One microgram of total RNA was reverse
transcribed and the cDNA template was subjected to 40 cycles of PCR.
The following primers were used as described by
Mickley12,13: 5' 2521 GCAAATCTTGGGACAGGAAT;
3' RNA, 2796 CTCCTTTCGTGTGTAGAAAC; 3',
DNA,2681CCTTC2687 CACTCAGTTTGATTT.
Expression of P-glycoprotein. For measurement of the expression of P-gp, cells were incubated at room temperature with the monoclonal anti-P-gp antibodies MRK1617 (Kamiya Biomedical, Tukwila, WA) at a concentration of 10 µg/mL and also, in separate tubes, with UIC218 (Immunotech, Marseille, France) at a concentration of 12.5 µg/mL or with an isotype-matched mIgG2a control antibody (Sigma, St Louis, MO) at a concentration of 10 µg/mL. Cell-bound antibodies were detected by fluorescein isothiocyanate (FITC)-labeled rabbit antimouse immunoglobulin antibodies (Dako, Glostrup, Denmark). Results are given as the ratio of the mean fluorescence of cells incubated with the anti-P-gp antibody divided by the mean fluorescence of cells incubated with the control mIgG2a antibody. To measure the expression of P-gp in CD34-positive cells, cells were labeled with phyco-erythrin-Cy5-labeled CD34 antibody or a phycoerythrin-Cy5-labeled matched mIgG1 antibody (Immunotech). Function of P-glycoprotein. For measurement of the function of P-gp, the fluorescent molecule Rhodamine 123 (Rho 123) (Sigma) was used as a P-gp substrate.19,20 Cells were incubated for 1 hour at 37°C at 5% CO2 in the absence or presence of 2 µM of the P-gp modulator PSC 833 (Novartis, Basel, Switzerland). After this incubation, 200 ng/mL Rho 123 was added to the cells. A sample was taken at t = 0 minutes to correct for background fluorescence and at t = 75 minutes to measure intracellular Rho 123 retention. Results were calculated as the PSC/Rho 123 retention ratio of the mean intracellular Rho 123 fluorescence of cells exposed to PSC 833 divided by the mean intracellular Rho 123 fluorescence of cells not exposed to PSC 833. As controls, the drug-sensitive human myeloma cell line 8226 S and the drug-resistant P-gp expressing variant 8226 D6 cells21 were included in each experiment. Taking all experiments together, the mean ratio of P-gp function of the negative control cell line 8226 S was 0.91 ± 0.07 (mean ± SD). The mean ratio of P-gp function of the positive control cell line 8226 D6 was 7.03 ± 4.69 (mean ± SD). For analysis of the function of P-gp in CD34-positive cells, cells were labeled with phyco-erythrin-Cy5-labeled CD34 antibody or as a control phycoerythrin-Cy5-labeled mIgG1 antibody (Immunotech). Fluorescence was measured using a FACScalibur flowcytometer (Becton Dickinson, San José, CA). Cells were incubated with 0.1 µM TO-PRO-3 (Molecular Probes, Eugene, OR) to exclude nonviable cells in the fuctional and expression studies.Statistical analysis.
Expression and functional levels of P-gp, either at diagnosis or at
relapse or refractory disease, were compared between subgroups using
the Mann-Whitney test in case of 2 subgroups, and the Kruskal-Wallis test in case of 3 subgroups. Moreover, MDR1 expression at
relapse or refractory disease was compared with that at diagnosis using the Wilcoxon matched-pairs signed-ranks test, which was restricted to
patients with data available both at diagnosis and at relapse or
refractory disease. All P values are 2-sided and a
significance level
Thirty patients with AML were studied at diagnosis and during the course of their disease. Twenty-seven patients developed a relapse after reaching CR with induction chemotherapy. Three patients were primary refractory to induction chemotherapy (Table 1). Oligonucleotide hybridization and dotblot analysis Oligonucleotide hybridization studies of position 2677 of the MDR1 gene revealed 7 patients with a G variant, 6 patients with a T variant, and 17 patients with a GT variant. The 17 patients with heterozygous expression at diagnosis also showed GT expression at relapse. In these patients, no up-regulation of either allele was noticed during the development of disease at RNA level. Consequently, in this group of patients no evidence of a MDR1 gene-associated selection of a resistant clone was found.P-glycoprotein expression and function MRK16 expression (n = 27) and UIC2 expression (n = 25) revealed no differences in P-gp expression at relapse or refractory disease as compared with diagnosis (P = .14 and P = .22, respectively) (Table 3). No difference of MRK16 expression in the CD34-positive subpopulation was found (n = 11) (P = 1.0) in the paired analysis. The analysis of UIC2/CD34 in matched pairs showed a trend to a lower expression level (P = .07) in relapsed/refractory disease as compared with diagnosis, although the number of patients that could be analyzed for UIC2/CD34 was small (n = 8) (Table 3; Figure 1C). The CD34 expression was not different at relapse as compared to diagnosis (P = .31).
The PSC/Rho 123 retention ratio (n = 27) was not significantly different between diagnosis and relapsed/refractory AML (P = .26). When analyzed in the CD34-positive subpopulation of blasts (n = 12), comparable results were found (P = .39) (Table 3; Figure 1A). No difference was found in P-gp expression (P = .67 for MRK16 expression, P = .82 for UIC2 expression) or PSC/Rho ratio (P = .09) at diagnosis nor at relapse/refractory disease (P values of .42, .67, and .11, respectively) between adults and children. P-glycoprotein versus MDR1 allelic expression As the functional meaning of the genetic polymorphism of the MDR1 gene has not been established as yet, we analyzed P-gp in patients with expression of the G, T, and GT variants. The median MRK16 expression ratio was not significantly different in the various allelic variants (P = .72 at diagnosis and P = .34 at relapse). Also, no difference was found with monoclonal antibody UIC2 (P = .81 at diagnosis and P = .25 at relapse) and the PSC/Rho 123 retention ratio (P = .26 at diagnosis, P = .11 at relapse). No difference was found in P-gp expression or function when homozygous patients were compared with heterozygous patients (Table 4). Similarly, in the CD34-positive fraction we did not find differences in P-gp expression and function between the different MDR1 allelic variants at diagnosis nor at relapse and/or refractory disease. The results show that there is no difference in P-gp expression and function in AML blast cells between the different specific allelic variants of the MDR1 gene. The therapeutic outcome of patients with the different allelic variants showed a significant difference, that is, homozygosity was associated with a shorter time from diagnosis to relapse (P = .002) and a shorter overall survival from relapse (P = .02) (Figure 2A,B).
Clinical resistance to chemotherapy is a major problem in relapsed and/or refractory AML. MDR1 expression in de novo AML is an adverse prognostic factor for CR and survival.3-7,11,22 It is conceivable that up-regulation of the MDR1 gene is involved in the development of relapse and/or refractory disease, although this has not been investigated in paired analyses of respectable numbers of clinical samples of patients with AML.12 In the present study we analyzed whether clonal selection associated with the MDR1 gene is involved in the development of relapsed AML. This is the first study that examined the allelic expression of MDR1 in AML, using the genetic polymorphism of the MDR1 gene. Our data show that there is no evidence of a MDR1 gene-related clonal selection in the evolution of AML to relapse or refractory disease. This is consistent with our observation that P-gp expression and
function did not increase from diagnosis to relapsed/refractory state.
Several studies have reported a higher MDR1 expression at
time of relapse as compared to diagnosis.23-29 However,
most studies compared patients who were not matched and studies in paired patient samples are scarce and generally they were performed in
small numbers of patients. Most studies suggest an identical expression
or even lower level of MDR1 in relapsed/refractory AML.29-32 Only the sequential analysis by Wood, who used
immunocytochemistry techniques, showed a higher percentage of
P-gp-positive samples in 14 relapsed patients with AML as compared
with diagnosis.33 In pediatric patients, only 3 case
reports are available.25,34,35 Therefore, although many
studies have suggested that MDR1 is up-regulated in relapsed
and/or refractory AML, sequential studies do not support this theory
(Table 5 and Table
6). The present analysis, which is the
largest paired study in AML thus far, is an attempt to quantify MDR1
expression at genomic and protein level during the development toward
resistant disease. In the 9 children and 21 adults studied, we did not
find evidence that MDR1, although being a strong prognostic
factor at the time of diagnosis, is up-regulated at time of relapse
and/or refractory disease in AML. We suggest that similar sequential
studies of other mechanisms of drug resistance should be performed in
patients with AML during the course of their disease in order to
determine which drug resistance proteins are associated with clonal
selection at relapse. In these studies it will be important to analyze
children and younger adults separately from elderly patients with AML,
since different mechanisms might be important in different age
groups.6 Until now, the only study that analyzed P-gp
expression in a large group of children with AML showed that in
contrast to adult AML, MDR1 expression was not of prognostic
significance.39 In the present study no difference was found in P-gp expression and function between adults and
children.
Our study emphasizes that it is important to study MDR1 expression in clinical samples from patients with AML. In many cell lines, including even AML cell lines, MDR expression may be up-regulated as a direct response of cells to antineoplastic drugs. However, it seems apparent that this does not occur in patients with AML.40-48 This is the first analysis of the functional significance of the genetic polymorphism of MDR1 in highly purified samples of AML. P-gp function and expression were similar in any one of the specific allelic variants (G, T, and GT). These findings suggest that the genetic polymorphism of the MDR1 gene (at position 2677) lacks functional importance in AML. However, we found that patients with homozygous expression of the MDR1 gene (GG or TT) had a shorter time to relapse and overall survival from relapse/refractory disease than heterozygous patients. This finding warrants further studies on the role of genetic polymorphisms of MDR1 in AML. MDR1 expression at diagnosis is a strong adverse prognostic factor in AML. However, our sequential analysis reveals that there is no higher function or expression of P-gp at relapse or refractory disease, and that specific allelic expression is not related to increased P-gp expression or function. Since no loss of a specific MDR1 allele has been observed in these patients with AML, MDR1 gene-related clonal selection plays no role in the development of resistant disease. These data suggest that mechanisms other than MDR1 might be responsible for the development of clinical resistance in these patients.
We thank the Dutch Childhood Leukemia Study Group for bone marrow samples of pediatric patients with AML.
Submitted October 10, 2000; accepted January 31, 2001.
Supported by the Sophia Foundation for Medical Research (SSWO grant 246), the Foundation Pediatric Oncology Centre Rotterdam (Stichting SKOR), and the Kröger Society.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: M. M. van den Heuvel-Eibrink, Sophia Children's Hospital, Department of Oncology/Hematology, Rm Sp 2429, Dr Molewaterplein 60, 3015 GJ Rotterdam, The Netherlands; e-mail: vandeheuvel{at}alkg.azr.nl.
1.
Campos L, Guyotat D, Archimbaud E, et al.
Clinical significance of multidrug resistance P-glycoprotein expression on acute non-lymphoblastic leukemia cells at diagnosis.
Blood.
1992;79:473-476 2. Del Poeta G, Stasi R, Venditti A, et al. Prognostic value of cell marker analysis in de novo acute myeloid leukemia. Leukemia. 1994;8:388-394[Medline] [Order article via Infotrieve].
3.
Del Poeta G, Stasi R, Aronica G, et al.
Clinical relevance of P-glycoprotein expression in de novo acute myeloid leukemia.
Blood.
1996;87:1997-2004
4.
Leith CP, Kopecky KJ, Godwin J, et al.
Acute myeloid leukemia in the elderly: assessment of multidrug resistance (MDR1) and cytogenetics distinguishes biologic subgroups with remarkably distinct responses to standard chemotherapy: a Southwest Oncology Group study.
Blood.
1997;89:3323-3329 5. Van den Heuvel-Eibrink MM, van der Holt B, te Boekhorst PA, et al. MDR 1 expression is an independent prognostic factor for response and survival in de novo acute myeloid leukaemia. Br J Haematol. 1997;99:76-83[CrossRef][Medline] [Order article via Infotrieve]. 6. Van den Heuvel-Eibrink MM, Sonneveld P, Pieters R. The prognostic significance of membrane transport-associated multidrug resistance (MDR) proteins in leukemia. Int J Clin Pharmacol Ther. 2000;38:94-110[Medline] [Order article via Infotrieve]. 7. Willman CL. The prognostic significance of the expression and function of multidrug resistance transporter proteins in acute myeloid leukemia: studies of the Southwest Oncology Group Leukemia Research Program. Semin Hematol. 1997;34:25-33[Medline] [Order article via Infotrieve].
8.
Senent L, Jarque I, Martin G, et al.
P-glycoprotein expression and prognostic value in acute myeloid leukemia.
Haematologica.
1998;83:783-787
9.
Legrand O, Simonin G, Zittoun R, Marie JP.
Both P-gp and MRP contribute to drug resistance in AML.
Blood.
1999;94:1046-1056
10.
Legrand O, Simonin G, Perrot JY, Zittoun R, Marie JP.
P-gp and MRP activities using calcein-AM are prognostic factors in adult acute myeloid leukemia patients.
Blood.
1998;91:4480-4488 11. Michieli M, Damiani D, Ermacora A, et al. P-glycoprotein, lung resistance-related protein and multidrug resistance associated protein in de novo acute non-lymphocytic leukaemias: biological and clinical implications. Br J Haematol. 1999;104:328-335[CrossRef][Medline] [Order article via Infotrieve].
12.
Mickley LA, Lee JS, Weng Z, et al.
Genetic polymorphism in MDR-1: a tool for examining allelic expression in normal cells, unselected and drug-selected cell lines, and human tumors.
Blood.
1998;91:1749-1756 13. Mickley LA, Spengler BA, Knutsen TA, Biedler JL, Fojo T. Gene rearrangement: a novel mechanism for MDR-1 gene activation. J Clin Invest. 1997;99:1947-1957[Medline] [Order article via Infotrieve]. 14. Bennett JM, Catovsky D, Daniel MT, et al. Proposed revised criteria for the classification of acute myeloid leukemia: a report of the French-American-British Cooperative Group. Ann Intern Med. 1985;103:620-625. 15. Mitelman F, ed. ISCN 1991: Guidelines for Cancer Cytogenetics: Supplement to an International System for Human Cytogenetic Nomenclature. Basel, Switzerland: Karger; 1991.
16.
Lowenberg B, van Putten WL, Touw IP, Delwel R, Santini V.
Autonomous proliferation of leukemic cells in vitro as a determinant of prognosis in adult acute myeloid leukemia.
N Engl J Med.
1993;328:614-619
17.
Sugawara I, Kataoka I, Morishita Y, et al.
Tissue distribution of P-glycoprotein encoded by a multidrug-resistant gene as revealed by a monoclonal antibody, MRK 16.
Cancer Res.
1988;48:1926-1929
18.
Mechetner EB, Roninson IB.
Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody.
Proc Natl Acad Sci U S A.
1992;89:5824-5828 19. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell. 1991;66:85-94[CrossRef][Medline] [Order article via Infotrieve]. 20. Ludescher C, Thaler J, Drach D, et al. Detection of activity of P-glycoprotein in human tumour samples using rhodamine 123. Br J Haematol. 1992;82:161-168[Medline] [Order article via Infotrieve].
21.
Dalton WS, Durie BG, Alberts DS, Gerlach JH, Cress AE.
Characterization of a new drug-resistant human myeloma cell line that expresses P-glycoprotein.
Cancer Res.
1986;46:5125-5130 22. Hunault M, Zhou D, Delmer A, et al. Multidrug resistance gene expression in acute myeloid leukemia: major prognostic significance for in vivo drug resistance to induction treatment. Ann Hematol. 1997;74:65-71[CrossRef][Medline] [Order article via Infotrieve]. 23. Musto P, Cascavilla N, Di Renzo N, et al. Clinical relevance of immunocytochemical detection of multidrug resistance associated P-glycoprotein in hematologic malignancies. Tumori. 1990;76:353-359[Medline] [Order article via Infotrieve].
24.
Marie JP, Zittoun R, Sikic BI.
Multidrug resistance (mdr1) gene expression in adult acute leukemias: correlations with treatment outcome and in vitro drug sensitivity.
Blood.
1991;78:586-592
25.
Beck WT, Grogan TM, Willman CL, et al.
Methods to detect P-glycoprotein-associated multidrug resistance in patients' tumors: consensus recommendations.
Cancer Res.
1996;56:3010-3020
26.
Guerci A, Merlin JL, Missoum N, et al.
Predictive value for treatment outcome in acute myeloid leukemia of cellular daunorubicin accumulation and P-glycoprotein expression simultaneously determined by flow cytometry.
Blood.
1995;85:2147-2153 27. Maslak P, Hegewisch-Becker S, Godfrey L, Andreeff M. Flow cytometric determination of the multidrug-resistant phenotype in acute leukemia. Cytometry. 1994;17:84-93[CrossRef][Medline] [Order article via Infotrieve]. 28. Michieli M, Giacca M, Fanin R, Damiani D, Geromin A, Baccarani M. Mdr-1 gene amplification in acute lymphoblastic leukaemia prior to antileukaemic treatment. Br J Haematol. 1991;78:288-289[Medline] [Order article via Infotrieve]. 29. List AF. Role of multidrug resistance and its pharmacological modulation in acute myeloid leukemia. Leukemia. 1996;10:937-942[Medline] [Order article via Infotrieve]. 30. Ito Y, Tanimoto M, Kumazawa T, et al. Increased P-glycoprotein expression and multidrug-resistant gene (mdr1) amplification are infrequently found in fresh acute leukemia cells: sequential analysis of 15 cases at initial presentation and relapsed stage. Cancer. 1989;63:1534-1538[CrossRef][Medline] [Order article via Infotrieve]. 31. Ino T, Miyazaki H, Isogai M, et al. Expression of P-glycoprotein in de novo acute myelogenous leukemia at initial diagnosis: results of molecular and functional assays, and correlation with treatment outcome. Leukemia. 1994;8:1492-1497[Medline] [Order article via Infotrieve]. 32. Hart SM, Ganeshaguru K, Hoffbrand AV, Prentice HG, Mehta AB. Expression of the multidrug resistance-associated protein (MRP) in acute leukaemia. Leukemia. 1994;8:2163-2168[Medline] [Order article via Infotrieve]. 33. Wood P, Burgess R, MacGregor A, Yin JA. P-glycoprotein expression on acute myeloid leukaemia blast cells at diagnosis predicts response to chemotherapy and survival. Br J Haematol. 1994;87:509-514[Medline] [Order article via Infotrieve]. 34. Kaczorowski S, Ochoka M, Aleksandrowicz R, Kaczorowska M, Matysiak M, Karwacki M. Expression of P-glycoprotein in children and adults with leukemia: correlation with clinical outcome. In: Hiddeman, et al., eds. Acute Leukemias V: Experimental Approaches and Management of Refractory Diseases. Berlin, Heidelberg: Springer-Verlag; 1996:101-107. 35. Gekeler V, Frese G, Noller A, et al. Mdr1/P-glycoprotein, topoisomerase, and glutathione-S-transferase pi gene expression in primary and relapsed state adult and childhood leukaemias. Br J Cancer. 1992;66:507-517[Medline] [Order article via Infotrieve]. 36. Beck J, Handgretinger R, Klingebiel T, et al. Expression of PKC isozyme and MDR-associated genes in primary and relapsed state AML. Leukemia. 1996;10:426-433[Medline] [Order article via Infotrieve]. 37. Sato H, Preisler H, Day R, et al. MDR1 transcript levels as an indication of resistant disease in acute myelogenous leukaemia. Br J Haematol. 1990;75:340-345[Medline] [Order article via Infotrieve]. 38. Marie JP, Faussat-Suberville AM, Zhou D, Zittoun R. Daunorubicin uptake by leukemic cells: correlations with treatment outcome and mdr1 expression. Leukemia. 1993;7:825-831[Medline] [Order article via Infotrieve]. 39. Sievers EL, Smith FO, Woods WG, et al. Cell surface expression of the multidrug resistance P-glycoprotein (P- 170) as detected by monoclonal antibody MRK-16 in pediatric acute myeloid leukemia fails to define a poor prognostic group: a report from the Childrens Cancer Group. Leukemia. 1995;9:2042-2048[Medline] [Order article via Infotrieve]. 40. Gekeler V, Frese G, Diddens H, Probst H. Expression of a P-glycoprotein gene is inducible in a multidrug resistant human leukemia cell line. Biochem Biophys Res Commun. 1988;155:754-760[CrossRef][Medline] [Order article via Infotrieve]. 41. Ma DD, Scurr RD, Davey RA, et al. Detection of a multidrug resistant phenotype in acute non-lymphoblastic leukaemia. Lancet. 1987;1:135-137[Medline] [Order article via Infotrieve].
42.
Baas F, Jongsma AP, Broxterman HJ, et al.
Non-P-glycoprotein mediated mechanism for multidrug resistance precedes P-glycoprotein expression during in vitro selection for doxorubicin resistance in a human lung cancer cell line.
Cancer Res.
1990;50:5392-5398
43.
Goldstein LJ, Galski H, Fojo A, et al.
Expression of a multidrug resistance gene in human cancers.
J Natl Cancer Inst.
1989;81:116-124
44.
Chaudhary PM, Roninson IB.
Induction of multidrug resistance in human cells by transient exposure to different chemotherapeutic drugs.
J Natl Cancer Inst.
1993;85:632-639 45. Gekeler V, Beck J, Noller A, et al. Drug-induced changes in the expression of MDR-associated genes: investigations on cultured cell lines and chemotherapeutically treated leukemias. Ann Hematol. 1994;69(suppl 1):S19-S24.
46.
Brock I, Hipfner DR, Nielsen BS, et al.
Sequential coexpression of the multidrug resistance genes MRP and mdr1 and their products in VP-16 (etoposide)-selected H69 small cell lung cancer cells.
Cancer Res.
1995;55:459-462
47.
Matsumoto Y, Takano H, Fojo T.
Cellular adaptation to drug exposure: evolution of the drug-resistant phenotype.
Cancer Res.
1997;57:5086-5092 48. Knutsen T, Mickley LA, Ried T, et al. Cytogenetic and molecular characterization of random chromosomal rearrangements activating the drug resistance gene, MDR1/P- glycoprotein, in drug-selected cell lines and patients with drug refractory ALL. Genes Chromosomes Cancer. 1998;23:44-54[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
H. Chang, S. Y. Rha, H. -C. Jeung, C. -K. Im, J. B. Ahn, W. S. Kwon, N. C. Yoo, J. K. Roh, and H. C. Chung Association of the ABCB1 gene polymorphisms 2677G>T/A and 3435C>T with clinical outcomes of paclitaxel monotherapy in metastatic breast cancer patients Ann. Onc., February 1, 2009; 20(2): 272 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Seedhouse, M. Grundy, P. White, Y. Li, J. Fisher, D. Yakunina, A. V. Moorman, T. Hoy, N. Russell, A. Burnett, et al. Sequential Influences of Leukemia-Specific and Genetic Factors on P-Glycoprotein Expression in Blasts from 817 Patients Entered into the National Cancer Research Network Acute Myeloid Leukemia 14 and 15 Trials Clin. Cancer Res., December 1, 2007; 13(23): 7059 - 7066. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, J. Wang, E. Tantoso, B. Wang, A. Y.P. Tai, L. L.P.J. Ooi, S. S. Chong, and C. G.L. Lee Signatures of recent positive selection at the ATP-binding cassette drug transporter superfamily gene loci Hum. Mol. Genet., June 1, 2007; 16(11): 1367 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Becton, G. V. Dahl, Y. Ravindranath, M. N. Chang, F. G. Behm, S. C. Raimondi, D. R. Head, K. C. Stine, N. J. Lacayo, B. I. Sikic, et al. Randomized use of cyclosporin A (CsA) to modulate P-glycoprotein in children with AML in remission: Pediatric Oncology Group Study 9421 Blood, February 15, 2006; 107(4): 1315 - 1324. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mahadevan and A. F. List Targeting the multidrug resistance-1 transporter in AML: molecular regulation and therapeutic strategies Blood, October 1, 2004; 104(7): 1940 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tang, L. P. Wong, E. J.D. Lee, S. S. Chong, and C. G.L. Lee Genomic evidence for recent positive selection at the human MDR1 gene locus Hum. Mol. Genet., April 15, 2004; 13(8): 783 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Solary, B. Drenou, L. Campos, P. de Cremoux, F. Mugneret, P. Moreau, B. Lioure, A. Falkenrodt, B. Witz, M. Bernard, et al. Quinine as a multidrug resistance inhibitor: a phase 3 multicentric randomized study in adult de novo acute myelogenous leukemia Blood, August 15, 2003; 102(4): 1202 - 1210. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Lockhart, R. G. Tirona, and R. B. Kim Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
G-T Ho, F M Moodie, and J Satsangi Multidrug resistance 1 gene (P-glycoprotein 170): an important determinant in gastrointestinal disease? Gut, May 1, 2003; 52(5): 759 - 766. [Abstract] [Full Text] |
||||
![]() |
T. Illmer, U. S. Schuler, C. Thiede, U. I. Schwarz, R. B. Kim, S. Gotthard, D. Freund, U. Schakel, G. Ehninger, and M. Schaich MDR1 Gene Polymorphisms Affect Therapy Outcome in Acute Myeloid Leukemia Patients Cancer Res., September 1, 2002; 62(17): 4955 - 4962. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Perel, A. Auvrignon, T. Leblanc, J.-P. Vannier, G. Michel, B. Nelken, V. Gandemer, C. Schmitt, J.-P. Lamagnere, L. De Lumley, et al. Impact of Addition of Maintenance Therapy to Intensive Induction and Consolidation Chemotherapy for Childhood Acute Myeloblastic Leukemia: Results of a Prospective Randomized Trial, LAME 89/91 J. Clin. Oncol., June 15, 2002; 20(12): 2774 - 2782. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||