Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van den Heuvel-Eibrink, M. M.
Right arrow Articles by Sonneveld, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van den Heuvel-Eibrink, M. M.
Right arrow Articles by Sonneveld, P.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 June 2001, Vol. 97, No. 11, pp. 3605-3611

NEOPLASIA

MDR1 gene-related clonal selection and P-glycoprotein function and expression in relapsed or refractory acute myeloid leukemia

Marry M. van den Heuvel-Eibrink, Erik A. C. Wiemer, Marjan J. de Boevere, Bronno van der Holt, Paula J. M. Vossebeld, Rob Pieters, and Pieter Sonneveld

From the Department of Hematology, University Hospital; the Department of Pediatric Oncology/Hematology, Sophia Children's Hospital; the Department of Statistics, Daniel den Hoed Cancer Centre, Erasmus University, Rotterdam; and The Dutch Childhood Leukemia Study Group, The Hague, The Netherlands.


    Abstract
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

The expression of P-glycoprotein (P-gp), encoded by the MDR1 gene, is an independent adverse prognostic factor for response and survival in de novo acute myeloid leukemia (AML). Little is known about MDR1 expression during the development of disease. The present study investigated whether MDR1 gene- related clonal selection occurs in the development from diagnosis to relapsed AML, using a genetic polymorphism of the MDR1 gene at position 2677. Expression and function of P-gp were studied using monoclonal antibodies MRK16 and UIC2 and the Rhodamine 123 retention assay with or without PSC 833. No difference was found in the levels of P-gp function and expression between diagnosis and relapse in purified paired blast samples from 30 patients with AML. Thirteen patients were homozygous for the genetic polymorphism of MDR1 (n = 7 for guanine, n = 6 for thymidine), whereas 17 patients were heterozygous (GT). In the heterozygous patients, no selective loss of one allele was observed at relapse. Homozygosity for the MDR1 gene (GG or TT) was associated with shorter relapse-free intervals (P = .002) and poor survival rates (P = .02), compared with heterozygous patients. No difference was found in P-gp expression or function in patients with AML with either of the allelic variants of the MDR1 gene. It was concluded that P-gp function or expression is not upregulated at relapse/refractory disease and expression of one of the allelic variants is not associated with altered P-gp expression or function in AML, consistent with the fact that MDR1 gene-related clonal selection does not occur when AML evolves to recurrent disease. (Blood. 2001;97:3605-3611)

© 2001 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Classic multidrug resistance (MDR) encoded by the MDR1 gene is characterized by expression of P-glycoprotein (P-gp), which acts as a drug efflux pump in the plasma membrane. Expression of MDR1 has been identified as an independent adverse prognostic factor for complete remission (CR) and survival in patients with acute myeloid leukemia (AML), especially in adults.1-11 Little is known about possible changes in MDR1 gene expression during the development to relapse or refractory disease, especially in paired analyses of clinical samples of patients with AML. It is conceivable that MDR1 positive clones develop by clonal selection during chemotherapy or by MDR1 gene activation. This phenomenon has been described for Burkitt lymphoma, in which single allelic MDR1 expression was found to be up-regulated during the development of disease.12

In the present study, we investigated whether clonal selection of one MDR1 allele contributes to drug resistance in AML, by studying the genetic polymorphism of the MDR1 gene at position 2677.13 This study was performed in paired samples of patients with AML at time of diagnosis and at first relapse or refractory disease. In addition, an analysis was performed of the expression and function of P-gp. To the best of our knowledge, no previous studies have been reported in which the P-gp levels were measured in the allelic variants of the MDR1 gene.


    Patients and methods
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Patients

Bone marrow samples from 30 patients with AML (9 children, 21 adults) were obtained from the iliac crest at diagnosis and at time of first relapse (n = 27) or refractory disease (n = 3) (Table 1). Written informed consent was obtained from each patient and/or their parents to perform these studies. AML classification, according to the French-American-British (FAB) criteria14 was M1 (n = 8), M2 (n = 11), M4 (n = 2), M5 (n = 7), and M6 (n = 2). Cytogenetic analysis was carried out by standard techniques, and the findings were described according to the international nomenclature.15 Patients with a deletion or loss of chromosome 7 were not included in the study, because of the (possible) loss of one MDR1 gene which is located on 7q21.1, which complicates the analysis of polymorphism in these patients. All patients were treated according to the Helsinki agreement and were included in treatment protocols of the Dutch-Belgian Hemato-Oncology Collaborative Group (protocol HOVON 4/4a resp. HOVON 29) for young adults (n = 17), European Organisation for Research and Treatment of Cancer (EORTC protocol LAM 9) (n = 1) for patients 60 years or older, and the Dutch Childhood Leukemia Study Group (DCLSG: protocol ANLL 87 and 94) (n = 9) for children (younger than 18 years old). After relapse or in case of refractory disease after induction therapy, adults were treated according to the HOVON 30 protocol. The pediatric patients received treatment according to institutional protocols (Table 2). For some patients, individual therapy choices were made (Table 1). CR status was defined as normocellular marrow with < 5% blasts in a bone marrow (BM) smear and normal peripheral blood cell counts.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics of 30 patients with acute myeloid leukemia


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Cumulative drug doses in the treatment protocols for acute myeloid leukemia

Methods

Patient samples. Bone marrow aspirates were obtained in heparinized tubes. Mononuclear bone marrow cells (MNCs) were collected by Ficoll Hypaque density gradient centrifugation (density 1.077g/m3) (Pharmacia, Uppsala, Sweden). To obtain purified samples with more than 85% blasts, T-cell depletion and adherence depletion were performed.16 Cells were cryopreserved in Iscoves modified Dulbecco medium (IMDM; Gibco, Paisley, United Kingdom) supplemented with 10% dimethyl sulfoxide (DMSO; Merck, Darmstadt, Germany) and 20% fetal calf serum (FCS; Gibco) and stored in liquid nitrogen. On the day of the experiments bone marrow cells were thawed. For flowcytometry experiments, cells were washed and resuspended in IMDM supplemented with 10% FCS and gentamycin at a concentration of 4 × 106 cells/mL. Total RNA was isolated using Trisolv extraction (Biotecx, Houston, TX).

Oligonucleotide hybridization and dotblot analysis. Both DNA and RNA were used as templates in the polymerase chain reaction (PCR). One microgram of genomic DNA was used as a template in the PCR for 40 cycles to investigate the genetic polymorphism at the DNA level. One microgram of total RNA was reverse transcribed and the cDNA template was subjected to 40 cycles of PCR. The following primers were used as described by Mickley12,13: 5' 2521 GCAAATCTTGGGACAGGAAT; 3' RNA, 2796 CTCCTTTCGTGTGTAGAAAC; 3', DNA,2681CCTTC2687 CACTCAGTTTGATTT.

Reverse transcriptase treatment preceded amplification in order to evaluate RNA expression. All PCR experiments included controls without DNA or RNA. After amplification of 1 µg template, 30% of the PCR product was loaded in each of 2 adjacent wells of a slot-blot apparatus. The Zeta Probe nylon filter (Biorad, Hercules, CA) was cut out into 2 halves and each half was hybridized with a different oligonucleotide. Two 19-bp allele-specific oligonucleotide probes (HMO7 and HMO8) were 5'-phosphorylated with [gamma 32P]-ATP and T4 polynucleotide kinase. HMO7 and HMO8 cover residues 2667 to 2685 and were used for hybridizations. HMO7 possessess a G at position 2677 and HMO8 contains a T at the same position. Internal controls for hybridization and specificity were included in all experiments. For this purpose, two 30-bp oligonucleotides, designated HMC3 and HMC4, were used. These oligonucleotides cover residues 2656 to 2685 of the MDR1 gene with HMC3 possessing a G at position 2677 and HMC4 a T at the same position. Equal amounts of each control were spotted on both sides of the filter. Because the hybridizations were performed under identical conditions, with probes labeled to similar specific activities, the signals from the control oligonucleotides were similar. For quantification of the hybridization spots, the blots were exposed to a Phosfor Imager screen (Molecular Dynamics, Sunnyvale, CA).

Expression of P-glycoprotein. For measurement of the expression of P-gp, cells were incubated at room temperature with the monoclonal anti-P-gp antibodies MRK1617 (Kamiya Biomedical, Tukwila, WA) at a concentration of 10 µg/mL and also, in separate tubes, with UIC218 (Immunotech, Marseille, France) at a concentration of 12.5 µg/mL or with an isotype-matched mIgG2a control antibody (Sigma, St Louis, MO) at a concentration of 10 µg/mL. Cell-bound antibodies were detected by fluorescein isothiocyanate (FITC)-labeled rabbit antimouse immunoglobulin antibodies (Dako, Glostrup, Denmark). Results are given as the ratio of the mean fluorescence of cells incubated with the anti-P-gp antibody divided by the mean fluorescence of cells incubated with the control mIgG2a antibody. To measure the expression of P-gp in CD34-positive cells, cells were labeled with phyco-erythrin-Cy5-labeled CD34 antibody or a phycoerythrin-Cy5-labeled matched mIgG1 antibody (Immunotech).

Function of P-glycoprotein. For measurement of the function of P-gp, the fluorescent molecule Rhodamine 123 (Rho 123) (Sigma) was used as a P-gp substrate.19,20 Cells were incubated for 1 hour at 37°C at 5% CO2 in the absence or presence of 2 µM of the P-gp modulator PSC 833 (Novartis, Basel, Switzerland). After this incubation, 200 ng/mL Rho 123 was added to the cells. A sample was taken at t = 0 minutes to correct for background fluorescence and at t = 75 minutes to measure intracellular Rho 123 retention. Results were calculated as the PSC/Rho 123 retention ratio of the mean intracellular Rho 123 fluorescence of cells exposed to PSC 833 divided by the mean intracellular Rho 123 fluorescence of cells not exposed to PSC 833. As controls, the drug-sensitive human myeloma cell line 8226 S and the drug-resistant P-gp expressing variant 8226 D6 cells21 were included in each experiment. Taking all experiments together, the mean ratio of P-gp function of the negative control cell line 8226 S was 0.91 ± 0.07 (mean ± SD). The mean ratio of P-gp function of the positive control cell line 8226 D6 was 7.03 ± 4.69 (mean ± SD).

For analysis of the function of P-gp in CD34-positive cells, cells were labeled with phyco-erythrin-Cy5-labeled CD34 antibody or as a control phycoerythrin-Cy5-labeled mIgG1 antibody (Immunotech). Fluorescence was measured using a FACScalibur flowcytometer (Becton Dickinson, San José, CA). Cells were incubated with 0.1 µM TO-PRO-3 (Molecular Probes, Eugene, OR) to exclude nonviable cells in the fuctional and expression studies.

Statistical analysis. Expression and functional levels of P-gp, either at diagnosis or at relapse or refractory disease, were compared between subgroups using the Mann-Whitney test in case of 2 subgroups, and the Kruskal-Wallis test in case of 3 subgroups. Moreover, MDR1 expression at relapse or refractory disease was compared with that at diagnosis using the Wilcoxon matched-pairs signed-ranks test, which was restricted to patients with data available both at diagnosis and at relapse or refractory disease. All P values are 2-sided and a significance level alpha  = .05 was used.


    Results
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Thirty patients with AML were studied at diagnosis and during the course of their disease. Twenty-seven patients developed a relapse after reaching CR with induction chemotherapy. Three patients were primary refractory to induction chemotherapy (Table 1).

Oligonucleotide hybridization and dotblot analysis

Oligonucleotide hybridization studies of position 2677 of the MDR1 gene revealed 7 patients with a G variant, 6 patients with a T variant, and 17 patients with a GT variant. The 17 patients with heterozygous expression at diagnosis also showed GT expression at relapse. In these patients, no up-regulation of either allele was noticed during the development of disease at RNA level. Consequently, in this group of patients no evidence of a MDR1 gene-associated selection of a resistant clone was found.

P-glycoprotein expression and function

MRK16 expression (n = 27) and UIC2 expression (n = 25) revealed no differences in P-gp expression at relapse or refractory disease as compared with diagnosis (P = .14 and P = .22, respectively) (Table 3). No difference of MRK16 expression in the CD34-positive subpopulation was found (n = 11) (P = 1.0) in the paired analysis. The analysis of UIC2/CD34 in matched pairs showed a trend to a lower expression level (P = .07) in relapsed/refractory disease as compared with diagnosis, although the number of patients that could be analyzed for UIC2/CD34 was small (n = 8) (Table 3; Figure 1C). The CD34 expression was not different at relapse as compared to diagnosis (P = .31).

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Paired analysis of P-glycoprotein expression and function in patients with acute myeloid leukemia at diagnosis and relapse/refractory disease



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. P-glycoprotein expression and function in the CD34-positive population of the paired AML patients. (C) The UIC2 and (B) MRK16 ratios represent the expression of P-gp, and (A) PSC 833/Rho123 represents the function of P-gp. Dx indicates diagnosis; Rel/RD, relapsed/refractory AML. The dotted lines indicate the median values.

The PSC/Rho 123 retention ratio (n = 27) was not significantly different between diagnosis and relapsed/refractory AML (P = .26). When analyzed in the CD34-positive subpopulation of blasts (n = 12), comparable results were found (P = .39) (Table 3; Figure 1A). No difference was found in P-gp expression (P = .67 for MRK16 expression, P = .82 for UIC2 expression) or PSC/Rho ratio (P = .09) at diagnosis nor at relapse/refractory disease (P values of .42, .67, and .11, respectively) between adults and children.

P-glycoprotein versus MDR1 allelic expression

As the functional meaning of the genetic polymorphism of the MDR1 gene has not been established as yet, we analyzed P-gp in patients with expression of the G, T, and GT variants. The median MRK16 expression ratio was not significantly different in the various allelic variants (P = .72 at diagnosis and P = .34 at relapse). Also, no difference was found with monoclonal antibody UIC2 (P = .81 at diagnosis and P = .25 at relapse) and the PSC/Rho 123 retention ratio (P = .26 at diagnosis, P = .11 at relapse). No difference was found in P-gp expression or function when homozygous patients were compared with heterozygous patients (Table 4). Similarly, in the CD34-positive fraction we did not find differences in P-gp expression and function between the different MDR1 allelic variants at diagnosis nor at relapse and/or refractory disease. The results show that there is no difference in P-gp expression and function in AML blast cells between the different specific allelic variants of the MDR1 gene. The therapeutic outcome of patients with the different allelic variants showed a significant difference, that is, homozygosity was associated with a shorter time from diagnosis to relapse (P = .002) and a shorter overall survival from relapse (P = .02) (Figure 2A,B).

                              
View this table:
[in this window]
[in a new window]
 
Table 4. Analysis of P-glycoprotein expression and function in the homozygous vs the heterozygous allelic variants of the MDR1 gene at time of relapse/refractory disease



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Survival of the patients with AML. Distinguishing patients that are homozygous (GG and TT) from patients that are heterozygous (GT) for the genetic polymorphism of position 2677 of the MDR1 gene. (A) Time from diagnosis until relapse/refractory disease. (B) Overall survival from relapse/refractory disease. N indicates number of patients investigated; O, observed events.


    Discussion
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Clinical resistance to chemotherapy is a major problem in relapsed and/or refractory AML. MDR1 expression in de novo AML is an adverse prognostic factor for CR and survival.3-7,11,22 It is conceivable that up-regulation of the MDR1 gene is involved in the development of relapse and/or refractory disease, although this has not been investigated in paired analyses of respectable numbers of clinical samples of patients with AML.12 In the present study we analyzed whether clonal selection associated with the MDR1 gene is involved in the development of relapsed AML. This is the first study that examined the allelic expression of MDR1 in AML, using the genetic polymorphism of the MDR1 gene. Our data show that there is no evidence of a MDR1 gene-related clonal selection in the evolution of AML to relapse or refractory disease.

This is consistent with our observation that P-gp expression and function did not increase from diagnosis to relapsed/refractory state. Several studies have reported a higher MDR1 expression at time of relapse as compared to diagnosis.23-29 However, most studies compared patients who were not matched and studies in paired patient samples are scarce and generally they were performed in small numbers of patients. Most studies suggest an identical expression or even lower level of MDR1 in relapsed/refractory AML.29-32 Only the sequential analysis by Wood, who used immunocytochemistry techniques, showed a higher percentage of P-gp-positive samples in 14 relapsed patients with AML as compared with diagnosis.33 In pediatric patients, only 3 case reports are available.25,34,35 Therefore, although many studies have suggested that MDR1 is up-regulated in relapsed and/or refractory AML, sequential studies do not support this theory (Table 5 and Table 6). The present analysis, which is the largest paired study in AML thus far, is an attempt to quantify MDR1 expression at genomic and protein level during the development toward resistant disease. In the 9 children and 21 adults studied, we did not find evidence that MDR1, although being a strong prognostic factor at the time of diagnosis, is up-regulated at time of relapse and/or refractory disease in AML. We suggest that similar sequential studies of other mechanisms of drug resistance should be performed in patients with AML during the course of their disease in order to determine which drug resistance proteins are associated with clonal selection at relapse. In these studies it will be important to analyze children and younger adults separately from elderly patients with AML, since different mechanisms might be important in different age groups.6 Until now, the only study that analyzed P-gp expression in a large group of children with AML showed that in contrast to adult AML, MDR1 expression was not of prognostic significance.39 In the present study no difference was found in P-gp expression and function between adults and children.

                              
View this table:
[in this window]
[in a new window]
 
Table 5. Review of analyses of MDR1 expression in paired samples of patients with acute myeloid leukemia


                              
View this table:
[in this window]
[in a new window]
 
Table 6. Review of MDR1 expression in acute myeloid leukemia in nonpaired studies

Our study emphasizes that it is important to study MDR1 expression in clinical samples from patients with AML. In many cell lines, including even AML cell lines, MDR expression may be up-regulated as a direct response of cells to antineoplastic drugs. However, it seems apparent that this does not occur in patients with AML.40-48 This is the first analysis of the functional significance of the genetic polymorphism of MDR1 in highly purified samples of AML. P-gp function and expression were similar in any one of the specific allelic variants (G, T, and GT). These findings suggest that the genetic polymorphism of the MDR1 gene (at position 2677) lacks functional importance in AML. However, we found that patients with homozygous expression of the MDR1 gene (GG or TT) had a shorter time to relapse and overall survival from relapse/refractory disease than heterozygous patients. This finding warrants further studies on the role of genetic polymorphisms of MDR1 in AML.

MDR1 expression at diagnosis is a strong adverse prognostic factor in AML. However, our sequential analysis reveals that there is no higher function or expression of P-gp at relapse or refractory disease, and that specific allelic expression is not related to increased P-gp expression or function. Since no loss of a specific MDR1 allele has been observed in these patients with AML, MDR1 gene-related clonal selection plays no role in the development of resistant disease. These data suggest that mechanisms other than MDR1 might be responsible for the development of clinical resistance in these patients.


    Acknowledgments

We thank the Dutch Childhood Leukemia Study Group for bone marrow samples of pediatric patients with AML.


    Footnotes

Submitted October 10, 2000; accepted January 31, 2001.

Supported by the Sophia Foundation for Medical Research (SSWO grant 246), the Foundation Pediatric Oncology Centre Rotterdam (Stichting SKOR), and the Kröger Society.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: M. M. van den Heuvel-Eibrink, Sophia Children's Hospital, Department of Oncology/Hematology, Rm Sp 2429, Dr Molewaterplein 60, 3015 GJ Rotterdam, The Netherlands; e-mail: vandeheuvel{at}alkg.azr.nl.


    References
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

1. Campos L, Guyotat D, Archimbaud E, et al. Clinical significance of multidrug resistance P-glycoprotein expression on acute non-lymphoblastic leukemia cells at diagnosis. Blood. 1992;79:473-476[Abstract/Free Full Text].

2. Del Poeta G, Stasi R, Venditti A, et al. Prognostic value of cell marker analysis in de novo acute myeloid leukemia. Leukemia. 1994;8:388-394[Medline] [Order article via Infotrieve].

3. Del Poeta G, Stasi R, Aronica G, et al. Clinical relevance of P-glycoprotein expression in de novo acute myeloid leukemia. Blood. 1996;87:1997-2004[Abstract/Free Full Text].

4. Leith CP, Kopecky KJ, Godwin J, et al. Acute myeloid leukemia in the elderly: assessment of multidrug resistance (MDR1) and cytogenetics distinguishes biologic subgroups with remarkably distinct responses to standard chemotherapy: a Southwest Oncology Group study. Blood. 1997;89:3323-3329[Abstract/Free Full Text].

5. Van den Heuvel-Eibrink MM, van der Holt B, te Boekhorst PA, et al. MDR 1 expression is an independent prognostic factor for response and survival in de novo acute myeloid leukaemia. Br J Haematol. 1997;99:76-83[CrossRef][Medline] [Order article via Infotrieve].

6. Van den Heuvel-Eibrink MM, Sonneveld P, Pieters R. The prognostic significance of membrane transport-associated multidrug resistance (MDR) proteins in leukemia. Int J Clin Pharmacol Ther. 2000;38:94-110[Medline] [Order article via Infotrieve].

7. Willman CL. The prognostic significance of the expression and function of multidrug resistance transporter proteins in acute myeloid leukemia: studies of the Southwest Oncology Group Leukemia Research Program. Semin Hematol. 1997;34:25-33[Medline] [Order article via Infotrieve].

8. Senent L, Jarque I, Martin G, et al. P-glycoprotein expression and prognostic value in acute myeloid leukemia. Haematologica. 1998;83:783-787[Abstract/Free Full Text].

9. Legrand O, Simonin G, Zittoun R, Marie JP. Both P-gp and MRP contribute to drug resistance in AML. Blood. 1999;94:1046-1056[Abstract/Free Full Text].

10. Legrand O, Simonin G, Perrot JY, Zittoun R, Marie JP. P-gp and MRP activities using calcein-AM are prognostic factors in adult acute myeloid leukemia patients. Blood. 1998;91:4480-4488[Abstract/Free Full Text].

11. Michieli M, Damiani D, Ermacora A, et al. P-glycoprotein, lung resistance-related protein and multidrug resistance associated protein in de novo acute non-lymphocytic leukaemias: biological and clinical implications. Br J Haematol. 1999;104:328-335[CrossRef][Medline] [Order article via Infotrieve].

12. Mickley LA, Lee JS, Weng Z, et al. Genetic polymorphism in MDR-1: a tool for examining allelic expression in normal cells, unselected and drug-selected cell lines, and human tumors. Blood. 1998;91:1749-1756[Abstract/Free Full Text].

13. Mickley LA, Spengler BA, Knutsen TA, Biedler JL, Fojo T. Gene rearrangement: a novel mechanism for MDR-1 gene activation. J Clin Invest. 1997;99:1947-1957[Medline] [Order article via Infotrieve].

14. Bennett JM, Catovsky D, Daniel MT, et al. Proposed revised criteria for the classification of acute myeloid leukemia: a report of the French-American-British Cooperative Group. Ann Intern Med. 1985;103:620-625.

15. Mitelman F, ed. ISCN 1991: Guidelines for Cancer Cytogenetics: Supplement to an International System for Human Cytogenetic Nomenclature. Basel, Switzerland: Karger; 1991.

16. Lowenberg B, van Putten WL, Touw IP, Delwel R, Santini V. Autonomous proliferation of leukemic cells in vitro as a determinant of prognosis in adult acute myeloid leukemia. N Engl J Med. 1993;328:614-619[Abstract/Free Full Text].

17. Sugawara I, Kataoka I, Morishita Y, et al. Tissue distribution of P-glycoprotein encoded by a multidrug-resistant gene as revealed by a monoclonal antibody, MRK 16. Cancer Res. 1988;48:1926-1929[Abstract/Free Full Text].

18. Mechetner EB, Roninson IB. Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc Natl Acad Sci U S A. 1992;89:5824-5828[Abstract/Free Full Text].

19. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell. 1991;66:85-94[CrossRef][Medline] [Order article via Infotrieve].

20. Ludescher C, Thaler J, Drach D, et al. Detection of activity of P-glycoprotein in human tumour samples using rhodamine 123. Br J Haematol. 1992;82:161-168[Medline] [Order article via Infotrieve].

21. Dalton WS, Durie BG, Alberts DS, Gerlach JH, Cress AE. Characterization of a new drug-resistant human myeloma cell line that expresses P-glycoprotein. Cancer Res. 1986;46:5125-5130[Abstract/Free Full Text].

22. Hunault M, Zhou D, Delmer A, et al. Multidrug resistance gene expression in acute myeloid leukemia: major prognostic significance for in vivo drug resistance to induction treatment. Ann Hematol. 1997;74:65-71[CrossRef][Medline] [Order article via Infotrieve].

23. Musto P, Cascavilla N, Di Renzo N, et al. Clinical relevance of immunocytochemical detection of multidrug resistance associated P-glycoprotein in hematologic malignancies. Tumori. 1990;76:353-359[Medline] [Order article via Infotrieve].

24. Marie JP, Zittoun R, Sikic BI. Multidrug resistance (mdr1) gene expression in adult acute leukemias: correlations with treatment outcome and in vitro drug sensitivity. Blood. 1991;78:586-592[Abstract/Free Full Text].

25. Beck WT, Grogan TM, Willman CL, et al. Methods to detect P-glycoprotein-associated multidrug resistance in patients' tumors: consensus recommendations. Cancer Res. 1996;56:3010-3020[Abstract/Free Full Text].

26. Guerci A, Merlin JL, Missoum N, et al. Predictive value for treatment outcome in acute myeloid leukemia of cellular daunorubicin accumulation and P-glycoprotein expression simultaneously determined by flow cytometry. Blood. 1995;85:2147-2153[Abstract/Free Full Text].

27. Maslak P, Hegewisch-Becker S, Godfrey L, Andreeff M. Flow cytometric determination of the multidrug-resistant phenotype in acute leukemia. Cytometry. 1994;17:84-93[CrossRef][Medline] [Order article via Infotrieve].

28. Michieli M, Giacca M, Fanin R, Damiani D, Geromin A, Baccarani M. Mdr-1 gene amplification in acute lymphoblastic leukaemia prior to antileukaemic treatment. Br J Haematol. 1991;78:288-289[Medline] [Order article via Infotrieve].

29. List AF. Role of multidrug resistance and its pharmacological modulation in acute myeloid leukemia. Leukemia. 1996;10:937-942[Medline] [Order article via Infotrieve].

30. Ito Y, Tanimoto M, Kumazawa T, et al. Increased P-glycoprotein expression and multidrug-resistant gene (mdr1) amplification are infrequently found in fresh acute leukemia cells: sequential analysis of 15 cases at initial presentation and relapsed stage. Cancer. 1989;63:1534-1538[CrossRef][Medline] [Order article via Infotrieve].

31. Ino T, Miyazaki H, Isogai M, et al. Expression of P-glycoprotein in de novo acute myelogenous leukemia at initial diagnosis: results of molecular and functional assays, and correlation with treatment outcome. Leukemia. 1994;8:1492-1497[Medline] [Order article via Infotrieve].

32. Hart SM, Ganeshaguru K, Hoffbrand AV, Prentice HG, Mehta AB. Expression of the multidrug resistance-associated protein (MRP) in acute leukaemia. Leukemia. 1994;8:2163-2168[Medline] [Order article via Infotrieve].

33. Wood P, Burgess R, MacGregor A, Yin JA. P-glycoprotein expression on acute myeloid leukaemia blast cells at diagnosis predicts response to chemotherapy and survival. Br J Haematol. 1994;87:509-514[Medline] [Order article via Infotrieve].

34. Kaczorowski S, Ochoka M, Aleksandrowicz R, Kaczorowska M, Matysiak M, Karwacki M. Expression of P-glycoprotein in children and adults with leukemia: correlation with clinical outcome. In: Hiddeman, et al., eds. Acute Leukemias V: Experimental Approaches and Management of Refractory Diseases. Berlin, Heidelberg: Springer-Verlag; 1996:101-107.

35. Gekeler V, Frese G, Noller A, et al. Mdr1/P-glycoprotein, topoisomerase, and glutathione-S-transferase pi gene expression in primary and relapsed state adult and childhood leukaemias. Br J Cancer. 1992;66:507-517[Medline] [Order article via Infotrieve].

36. Beck J, Handgretinger R, Klingebiel T, et al. Expression of PKC isozyme and MDR-associated genes in primary and relapsed state AML. Leukemia. 1996;10:426-433[Medline] [Order article via Infotrieve].

37. Sato H, Preisler H, Day R, et al. MDR1 transcript levels as an indication of resistant disease in acute myelogenous leukaemia. Br J Haematol. 1990;75:340-345[Medline] [Order article via Infotrieve].

38. Marie JP, Faussat-Suberville AM, Zhou D, Zittoun R. Daunorubicin uptake by leukemic cells: correlations with treatment outcome and mdr1 expression. Leukemia. 1993;7:825-831[Medline] [Order article via Infotrieve].

39. Sievers EL, Smith FO, Woods WG, et al. Cell surface expression of the multidrug resistance P-glycoprotein (P- 170) as detected by monoclonal antibody MRK-16 in pediatric acute myeloid leukemia fails to define a poor prognostic group: a report from the Childrens Cancer Group. Leukemia. 1995;9:2042-2048[Medline] [Order article via Infotrieve].

40. Gekeler V, Frese G, Diddens H, Probst H. Expression of a P-glycoprotein gene is inducible in a multidrug resistant human leukemia cell line. Biochem Biophys Res Commun. 1988;155:754-760[CrossRef][Medline] [Order article via Infotrieve].

41. Ma DD, Scurr RD, Davey RA, et al. Detection of a multidrug resistant phenotype in acute non-lymphoblastic leukaemia. Lancet. 1987;1:135-137[Medline] [Order article via Infotrieve].

42. Baas F, Jongsma AP, Broxterman HJ, et al. Non-P-glycoprotein mediated mechanism for multidrug resistance precedes P-glycoprotein expression during in vitro selection for doxorubicin resistance in a human lung cancer cell line. Cancer Res. 1990;50:5392-5398[Abstract/Free Full Text].

43. Goldstein LJ, Galski H, Fojo A, et al. Expression of a multidrug resistance gene in human cancers. J Natl Cancer Inst. 1989;81:116-124[Abstract/Free Full Text].

44. Chaudhary PM, Roninson IB. Induction of multidrug resistance in human cells by transient exposure to different chemotherapeutic drugs. J Natl Cancer Inst. 1993;85:632-639[Abstract/Free Full Text].

45. Gekeler V, Beck J, Noller A, et al. Drug-induced changes in the expression of MDR-associated genes: investigations on cultured cell lines and chemotherapeutically treated leukemias. Ann Hematol. 1994;69(suppl 1):S19-S24.

46. Brock I, Hipfner DR, Nielsen BS, et al. Sequential coexpression of the multidrug resistance genes MRP and mdr1 and their products in VP-16 (etoposide)-selected H69 small cell lung cancer cells. Cancer Res. 1995;55:459-462[Abstract/Free Full Text].

47. Matsumoto Y, Takano H, Fojo T. Cellular adaptation to drug exposure: evolution of the drug-resistant phenotype. Cancer Res. 1997;57:5086-5092[Abstract/Free Full Text].

48. Knutsen T, Mickley LA, Ried T, et al. Cytogenetic and molecular characterization of random chromosomal rearrangements activating the drug resistance gene, MDR1/P- glycoprotein, in drug-selected cell lines and patients with drug refractory ALL. Genes Chromosomes Cancer. 1998;23:44-54[CrossRef][Medline] [Order article via Infotrieve].

© 2001 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Anticancer ResHome page
M. PRENKERT, B. UGGLA, E. TINA, U. TIDEFELT, and H. STRID
Rapid Induction of P-Glycoprotein mRNA and Protein Expression by Cytarabine in HL-60 Cells
Anticancer Res, October 1, 2009; 29(10): 4071 - 4076.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
H. Chang, S. Y. Rha, H. -C. Jeung, C. -K. Im, J. B. Ahn, W. S. Kwon, N. C. Yoo, J. K. Roh, and H. C. Chung
Association of the ABCB1 gene polymorphisms 2677G>T/A and 3435C>T with clinical outcomes of paclitaxel monotherapy in metastatic breast cancer patients
Ann. Onc., February 1, 2009; 20(2): 272 - 277.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. H. Seedhouse, M. Grundy, P. White, Y. Li, J. Fisher, D. Yakunina, A. V. Moorman, T. Hoy, N. Russell, A. Burnett, et al.
Sequential Influences of Leukemia-Specific and Genetic Factors on P-Glycoprotein Expression in Blasts from 817 Patients Entered into the National Cancer Research Network Acute Myeloid Leukemia 14 and 15 Trials
Clin. Cancer Res., December 1, 2007; 13(23): 7059 - 7066.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Z. Wang, J. Wang, E. Tantoso, B. Wang, A. Y.P. Tai, L. L.P.J. Ooi, S. S. Chong, and C. G.L. Lee
Signatures of recent positive selection at the ATP-binding cassette drug transporter superfamily gene loci
Hum. Mol. Genet., June 1, 2007; 16(11): 1367 - 1380.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Becton, G. V. Dahl, Y. Ravindranath, M. N. Chang, F. G. Behm, S. C. Raimondi, D. R. Head, K. C. Stine, N. J. Lacayo, B. I. Sikic, et al.
Randomized use of cyclosporin A (CsA) to modulate P-glycoprotein in children with AML in remission: Pediatric Oncology Group Study 9421
Blood, February 15, 2006; 107(4): 1315 - 1324.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Mahadevan and A. F. List
Targeting the multidrug resistance-1 transporter in AML: molecular regulation and therapeutic strategies
Blood, October 1, 2004; 104(7): 1940 - 1951.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Tang, L. P. Wong, E. J.D. Lee, S. S. Chong, and C. G.L. Lee
Genomic evidence for recent positive selection at the human MDR1 gene locus
Hum. Mol. Genet., April 15, 2004; 13(8): 783 - 797.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Solary, B. Drenou, L. Campos, P. de Cremoux, F. Mugneret, P. Moreau, B. Lioure, A. Falkenrodt, B. Witz, M. Bernard, et al.
Quinine as a multidrug resistance inhibitor: a phase 3 multicentric randomized study in adult de novo acute myelogenous leukemia
Blood, August 15, 2003; 102(4): 1202 - 1210.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. C. Lockhart, R. G. Tirona, and R. B. Kim
Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy
Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
G-T Ho, F M Moodie, and J Satsangi
Multidrug resistance 1 gene (P-glycoprotein 170): an important determinant in gastrointestinal disease?
Gut, May 1, 2003; 52(5): 759 - 766.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
T. Illmer, U. S. Schuler, C. Thiede, U. I. Schwarz, R. B. Kim, S. Gotthard, D. Freund, U. Schakel, G. Ehninger, and M. Schaich
MDR1 Gene Polymorphisms Affect Therapy Outcome in Acute Myeloid Leukemia Patients
Cancer Res., September 1, 2002; 62(17): 4955 - 4962.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
Y. Perel, A. Auvrignon, T. Leblanc, J.-P. Vannier, G. Michel, B. Nelken, V. Gandemer, C. Schmitt, J.-P. Lamagnere, L. De Lumley, et al.
Impact of Addition of Maintenance Therapy to Intensive Induction and Consolidation Chemotherapy for Childhood Acute Myeloblastic Leukemia: Results of a Prospective Randomized Trial, LAME 89/91
J. Clin. Oncol., June 15, 2002; 20(12): 2774 - 2782.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van den Heuvel-Eibrink, M. M.
Right arrow Articles by Sonneveld, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van den Heuvel-Eibrink, M. M.
Right arrow Articles by Sonneveld, P.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020