|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
PHAGOCYTES
From the Institute of Tissue Typing and Dialysis, CNR;
and the Department of Surgery and the Department of Biopathology,
University "Tor Vergata," Rome, Italy.
Polymorphonuclear cells (PMNs) contribute to the initiation and
progression of the immune response by mediating cytotoxicity, phagocytosis, and cytokine secretion. Because CD44 serves as a cytotoxic-triggering molecule on PMNs, it was hypothesized that it
could also trigger cytokine production. In this study, the effect of
anti-CD44 antibodies on interleukin-6 (IL-6) production in human PMNs
was assessed. By using a reverse transcriptase-polymerase chain
reaction, it was shown that PMNs stimulated with a mouse monoclonal or
a rabbit polyclonal F(ab)2 anti-CD44 transcribe IL-6
messenger RNA. A similar effect was obtained when an anti-CD44 antibody
was replaced with hyaluronic acid (HA). Kinetic studies showed that
anti-CD44 and HA induced IL-6 gene transcription, initiated 3 hours
after stimulation, peaked between 12 and 24 hours, and disappeared
after 48 hours. Analogous results were achieved when secreted IL-6
protein was measured by enzyme-linked immunosorbent assay in the PMN
culture supernatants. To characterize which metabolic pathways
regulated CD44-dependent IL-6 production in PMNs, an RNA polymerase
inhibitor, actinomycin D, and 2 protein kinase inhibitors, such as
genistein and staurosporine, were tested. Actinomycin D and genistein
blocked IL-6 production, whereas staurosporine did not, suggesting that
CD44-dependent IL-6 production requires gene transcription and tyrosine
kinase activity. Furthermore, the relationship between CD44 and
cytokines that affect PMN function, including interferon Polymorphonuclear cells (PMNs) have long been
considered as cells only endowed with effector functions, including
phagocytosis and killing of target cells. PMN-specific cell surface
receptors, such as the Fc fragment of the constant portion of
immunoglobulin G (IgG),1 regulate PMN cellular mechanisms
by releasing reactive oxygen intermediates and cytoplasmic lytic
enzymes. Therefore, they were not considered to produce significant
protein levels.
A large body of new findings has highlighted that resting or stimulated
human purified PMNs make a variety of messenger RNA (mRNA) and
translate their relative proteins. PMNs stimulated with
lipopolysaccharide (LPS) synthesize interleukin-1 CD44 surface receptors are heavily expressed on progenitors and on
terminally differentiated myeloid cells12 and on a variety of cell types, including lymphocytes, macrophages, erythrocytes, fibroblasts, and epithelial cells. Alternative splicing of CD44 gene
provides at least 12 isoforms, which are reported to be involved in
cancer metastasis and cellular activation.13 The major
ligand for CD44 receptor is hyaluronic acid (HA), a main
glycosaminoglycan component of the extracellular matrix. HA is a
polysaccharide found in all tissue and is synthesized in the cellular
plasma membrane. It is expressed on the cell surface and is bound to the extracellular matrix. HA binds a group of molecules termed hyaladherins that include cartilage link protein, aggrecan, and P-32.14 Osteopontin has been found to bind CD44 as
well.15 Ligation of CD44 with mAb or HA results in the
stimulation of several myeloid and lymphoid functions, including normal
and leukemic cellular differentiation,16 PMNs, and natural
killer (NK) cellular cytotoxicity.17,18 In addition, CD44
plays a major role in the regulation of cell migration through the
vascular wall and inflammation.19,20 Thus, PMNs could be a
potential target for studying the CD44-immunoregulatory role in myeloid cells.
In this study we assessed the ability of anti-CD44 mAbs or polyclonal
antibodies or CD44 natural ligand HA to induce IL-6 production in
freshly isolated PMNs. We found that, on CD44 cross-linking, PMNs
efficiently promoted IL-6-RNA transcription and translation. Because
IL-6 affects the processes of inflammation and cell-mediated immune
response, these findings provide new information about the role of CD44
in the management of innate and adaptive immune response.
Antibodies and reagents
Cell isolation
CD44, Fc  Rs (anti-FcRI or
anti-FcRII) in complete medium at 37°C, whereas, for HA
immobilization, 96-well plates (Becton Dickinson) were incubated
overnight at room temperature with 200 µL distilled water containing
HA (range, 5 mg to 50 µg/mL). Unbound HA was removed and replaced
with complete media at 37°C. Three hours later, freshly purified PMNs
(2.5 × 106/mL) were added to each well, and the plates
were incubated at 37°C in 5% CO2. At the desired time
point (range between 3 and 48 hours), PMN culture supernatants were
collected and stored at  80°C until a human IL-6 ELISA assay was
performed, whereas PMNs were harvested and total RNA was isolated by
using Trizol reagent (Life Technologies).
Reverse transcriptase-polymerase chain reaction Total RNA was extracted from 4 × 106 PMNs using Trizol reagent; complementary DNA (cDNA) first strand was produced using Moloney murine leukemia virus reverse transcriptase (Life Technologies) with an oligo(dt)12-18 antisense primer (Life Technologies). IL-6 cDNA was amplified for 30 cycles using ATGAACTCCTTCTCCACAAGCGC sense primer and GAAGAGCCCTCAGGCTGGACTG antisense primer, amplifying a transcript of 628 bases. FcRI cDNA
was amplified for 28 cycles using AGATCTATGTGGTTCTTGACAACTCTG sense
primer and CCATGGCCAGTGGAAAAACTTAAAGGC antisense primer. Finally,
FcRII was amplified for 30 cycles using CATTCAGTGGTTCCACAATGGGAA
sense primer and GAAATCCGCTTTTTCCTGCAGTAG antisense primer. Amplified
fragments were analyzed in 1% agarose gel electrophoresis in the
presence of ethidium bromide (Sigma).
IL-6 protein measurement Peripheral blood PMNs (2 × 106/mL) were incubated in complete media for 24 to 48 hours (the percentage of nonapoptotic cells was 70% at 24 hours and 30% at 48 hours) in the presence or absence of rabbit or mouse anti-CD44 F(ab)2 or HA. Cell supernatants were collected at the desired times and stored at80°C
until the assays were performed. IL-6 content in supernatants was
measured by a standard quantitative commercially available ELISA kit
(Endogen, Woburn, MA). The minimum detectable IL-6 level using this
assay was less than 1 pg/mL.
Flow-cytometry analysis of HA-binding and PMN cell cycle Freshly isolated PMNs (1 × 106) were incubated in ice for 30 minutes with FITC-conjugated HA and washed twice. The cells were then analyzed by using a Becton Dickinson FACScan flow cytometer. To assess the specificity of HA-binding on PMNs, in some experiments, unlabeled HA was successfully used to saturate the FITC-labeled HA. For the assessment of apoptosis, 0.5 × 106 PMNs were harvested in FACS tubes and fixed for 15 minutes in 1% formaldehyde and washed once. The cell pellet was resuspended in 1 mL permeabilizing buffer (0.1% sodium citrate, 0.1% triton-X) and incubated overnight at 4°C in the presence of 25 µL of 1 mg/mL propidium iodide stock and 10 µg/mL RNAse. PMN red fluorescence was analyzed by flow cytometry. Apoptotic PMNs were easily distinguished from the normal PMNs on the basis of the lower binding of propidium iodide to apoptotic cells (these cells show as a distinct peak at the left of the G0/G1 peak).
Fc RI
and FcRII mRNA analyzed the purity of human peripheral PMNs used in
this study. Figure 1 (left panel) shows
that unstimulated PMNs were FcRI mRNA (lane 2)
and FcRII mRNA+ (lane3). In contrast, the addition of
IFN to PMN cultures induced the expression of FcRI (lane 5)
without affecting FcRII gene expression (lane 6). Figure 1 (middle
and right panels) shows that NK cells and monocytes had a different
profile of FcR expression. In fact, NK cells did not express FcRI
and FcRII genes (lanes 8 and 9), whereas monocytes expressed both
genes (lanes 11 and 12). The presence of  -actin gene transcripts
confirmed the quality and the purity of DNA on the agarose gels (lanes
1, 4, 7, and 10). Flow cytometry analysis of unstimulated PMNs showed
that 97% of the cells expressed FcRII and FcRIII but not FcRI
or CD56, suggesting that we were working with highly purified
PMNs.
Ligation of CD44 on freshly purified PMNs induced IL-6 gene expression Because PMNs constitutively express high levels of the hyaluronate receptor, CD44,17 we first assessed IL-6 gene expression in PMNs stimulated with an anti-CD44 F(ab)2. Resting PMNs do not express IL-6 (Figure 2, lane 1). By contrast, PMNs treated with NIH44.1 F(ab)2 produced detectable amounts of IL-6 gene transcript (Figure 2, lane 4). Resting PMNs are FcRII+ and FcRI. As expected,
the stimulation of PMNs with an anti-FcRII mAb, IV-3, resulted in
IL-6 gene transcription (Figure 2, lane 3), whereas an anti-FcRI,
32.2, was fully ineffective (Figure 2, lane 2). In these experiments
the amplification of the -actin gene transcript confirmed the
integrity of the experimental procedures analyzed. These data suggest
that CD44 can control IL-6 transcription in resting PMNs of normal
donors. Figure 2 shows a representative experiment of 10 performed with
similar results.
Ligation of CD44 with HA induced IL-6 gene transcription in resting PMNs Although some mouse and human tumor cell lines bind HA, resting human T and NK cells do not. To investigate whether a soluble HA binds CD44 on human PMNs, we first analyzed the binding of a FITC-conjugated HA to PMNs by flow cytometry analysis. Figure 3A shows that freshly isolated human PMNs bound a perceptible amount of FITC-conjugated HA. Subsequently, we did competition experiments in which unlabeled HA and a PE-conjugated anti-CD44 mAb competed for CD44 binding on human PMNs. Figure 3B shows that unlabeled HA inhibited the anti-CD44 binding. However, the inhibition was not complete, suggesting that HA other than CD44 may recognize other molecules on PMNs. We evaluated also the effects of HA on IL-6 gene expression by the addition of a logarithmic dose concentration of soluble HA (0 to 100 µg/mL) or immobilized HA (0 to 1000 µg/mL) to resting peripheral blood PMNs. Unstimulated PMNs did not show evidence of IL-6 gene expression (Figure 3C, lane 1). In contrast, PMNs stimulated overnight with 10 (Figure 3C, lane 3) to 100 µg/mL (Figure 3C, lane 4) of soluble HA transcribed IL-6 gene, but a lower dose concentration did not (Figure 3C, lane 2). Similar results were obtained when we used immobilized HA (Figure 3C, lanes 5, 6, and 7). These data suggest that CD44 on PMNs could be physiologically involved in the regulation of IL-6 gene transcription.
Kinetics of IL-6 gene expression and protein production in PMNs stimulated with an anti-CD44 or HA We were interested in the kinetics of IL-6 gene expression during anti-CD44 or HA stimulation. Thus, we stimulated PMNs obtained from buffy coats of normal donors with NIH44.1 F(ab)2 or HA. Aging PMNs easily undergo spontaneous apoptosis associated with the impairment of PMN functions. Therefore, we have also assessed the percentage of apoptotic PMNs used in these studies. Table 1 shows that most of the PMNs with or without stimulation are apoptotic 48 hours after in vitro incubation. Figure 4A shows that IL-6 transcripts were undetectable in unstimulated PMNs (lane 1). However, they started to be visible 3 hours after CD44 stimulation with NIH44.1 F(ab)2 (lane 2) or HA (lane 3), remained detectable at 6 hours (lanes 6 and 7), at 12 hours (lanes 10 and 11), and at 24 hours (lanes 14 and 15), and disappeared completely at 48 hours of stimulation (lanes 18 and 19). Notably, as shown in Table 1, the absence of IL-6 transcripts 48 hours after PMN incubations could be due to the reduction of vital PMNs. However, the presence of-actin
transcripts suggested that the surviving PMNs could resolve IL-6 gene
transcription. The next question was whether IL-6 protein production
accompanied the IL-6 gene transcription. IL-6 was detectable in the
supernatant of PMNs stimulated with NIH44.1 or HA 10 hours after
stimulation. Around 24 hours after stimulation, we observed the highest
concentration of IL-6, rapidly decreasing thereafter (Figure 4B, left
side). On CD44 ligation, PMNs released an amount of IL-6 similar to
that induced on LPS stimulation. In addition, PMNs stimulated overnight
with immobilized HA induced a significant secretion of IL-6 in a
dose-dependent manner (Figure 4B, right side). These data suggest that
CD44 could play a major role in the regulation of PMNs
proinflammatory mechanisms.
Gene transcription and tyrosine kinase activity are required for CD44-dependent IL-6 production To determine whether CD44-dependent IL-6 production required protein synthesis, PMNs were incubated for 18 hours either in the absence or in the presence of the transcription inhibitor, actinomycin D (Figure 5A). Without actinomycin D, PMN stimulation with NIH44.1 F(ab)2 or HA promptly induced IL-6 gene transcription and protein secretion (Figure 5A, white bars), whereas, in the presence of actinomycin D, such expression was completely suppressed (Figure 5A, black bars), suggesting that IL-6 production requires de novo protein synthesis. To test which early signaling pathway is required for the regulation of IL-6 production, after CD44 ligation, we incubated PMNs in the absence or in the presence of genistein,21 a potent tyrosine kinase inhibitor, or staurosporine,22 a broad serine-threonine kinase inhibitor. PMNs stimulation with anti-CD44, HA, and anti-FcRII induced a significant level of IL-6 release (Figure 5B-C,
white bars). In the presence of genistein (Figure 5B, black bars) at
the concentration equal to or higher than its reported 50% inhibitory
concentration, IL-6 production was completely inhibited. Surprisingly,
staurosporine only partially blocked IL-6 secretion (Figure 5C, black
bars), suggesting that protein tyrosine kinase activity was the major
requirement for CD44-dependent IL-6 production in human peripheral
blood PMNs.
Synergistic effect of IFN and
chain of IL-2 receptors and their IL-2 stimulation results in
cytokine production and apoptosis inhibition, we included IL-223 among the cytokines used in these types of
experiments. Figure 6 shows that IFN,
IL-2, and G-CSF did not trigger IL-6 secretion. However, the ligation
of CD44 by a polyclonal anti-CD44 F(ab)2 induced PMNs to
release a significant amount of IL-6 in the supernatants (similar
results were obtained using NIH44.1 F(ab)2). Notably, the
addition of IFN enhanced IL-6 production induced by anti-CD44, but
the addition of IL-2 or G-CSF did not. To characterize the mechanism by
which IFN potentiated CD44-dependent IL-6 production, we analyzed
CD44 expression in untreated or IFN-treated human peripheral PMNs by
a flow-cytometry analysis of a direct immunofluorescence staining. We
did not observe any changes in CD44 expression (data not shown),
suggesting that IFN may rather potentiate intracellular signaling
pathways arising from CD44 stimulation that lead to IL-6 transcription
and translation.
In the past decade, several studies have shown that, following
cross-linking of specific signaling molecules expressed on the cell
surface of freshly purified PMNs, a number of cytokines are induced and
secreted. The major molecule that regulates IL-6 production in resting
PMNs is CD14.24,25 However, Ericson et al11
showed that cross-linking of Fc Although it is definitively accepted that activated PMNs release several cytokines, there are conflicting reports about IL-6 production.26,27 Lloyd and Oppenheim26 reported that PMNs treated with different stimuli secrete IL-6. However, Bazzoni et al28 could not confirm these data, suggesting that the presence of IL-6 mRNA could be a marker for monocytes contaminating PMN population. Because of this controversy, we have carefully evaluated PMN purity used in this study. Resting human PMNs constitutively express Fc In comparison to our results, Ericson et al11 found that
unstimulated PMNs constitutively expressed Fc We did not observe constitutive expression of IL-6 at gene and protein level in PMNs, but we noted that it was constitutively expressed in unstimulated PBMCs isolated by Ficoll-Hypaque gradient separation from each buffy coat assessed (data not shown). These data are different from those obtained by Melani et al35 and Palma et al36 who found constitutive expression of IL-6 mRNA in human venous blood PMNs. The data suggest that differences in PMN manipulation may affect IL-6 expression. Because Fc During the local tissue phase of tissue inflammation, monocytes and resident macrophages are the major contributors to the immune response. They release proinflammatory cytokines and chemokines, which can induce leukocyte adhesion to the endothelial cells through sialyl Lewis X (SleX)/E-selectin and LFA/intercellular adhesion molecule (ICAM) interaction with subsequent migration to the extralymphoid tissues.37,38 A recent study has shown that a second pathway for lymphocyte adhesion and migration may exist. This pathway is CD44/HA dependent and is controlled by proinflammatory cytokines released from mononuclear cells during the local phase of infection. These cytokines induce HA expression on endothelial cells, exposing a docking site to CD44+ circulating leukocytes.19,39 Therefore, we propose that CD44 on PMNs interacts with HA on activated endothelium, inducing IL-6 secretion locally or into the blood flow. Local release of IL-6 may influence cell-cell and cell-endothelium interactions possibly by enhancing PMN adhesiveness through ICAM and CD18 upregulation.40 Increasing levels of circulating IL-6 in the blood may result in systemic inflammatory effects mainly by the stimulation of acute-phase protein production. After having crossed the endothelial wall and migrated to the source of the infection, PMNs meet an intercellular microenvironment rich in the extracellular matrix (ECM). ECM is composed of collagen proteins and glycosaminoglycans that bind with different affinities to CD44. Therefore, CD44 on PMNs could bind such molecules and secrete IL-6 locally at the site of inflammation. Increasing levels of local IL-6 could stimulate the proliferation of nonlymphoid cells involved in tissue damage and repair. Ericson et al11 showed that IL-6 secretion resulting from
Fc The relationship between cytokines affecting PMN functions and CD44
ligation was studied by stimulating PMN cultures in the presence of an
anti-CD44 with IFN In conclusion, we have identified a novel mechanism by which PMNs may, in part, regulate the inflammatory response and other leukocyte functions by releasing IL-6 proinflammatory cytokine.
We thank Giulio C Spagnoli (Research Division, Department of Surgery, University of Basel) and Daruka Mahadevan (Hematology/Oncology, University of Arizona) for their critical review of the manuscript.
Submitted July 31, 2000; accepted February 6, 2001.
Supported by a grant from the Italian National Council Research.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Giuseppe Sconocchia, Institute of Tissue Typing and Dialysis, S. Eugenio Hospital-Clinical Surgery, Ple dell'Umanesimo, 10, 00144, Roma, Italy; e-mail: g.sconocchia{at}rm.cnr.it.
1. Unkeless JC. Function and heterogeneity of human Fc receptors for immunoglobulin G. J Clin Invest. 1989;83:355-361. 2. Lord PC, Wilmoth LM, Mizel SB, McCall CE. Expression of interleukin-1 alpha and beta genes by human blood polymorphonuclear leukocytes. J Clin Invest. 1991;87:1312-1321. 3. Jenkins JK, Malyak M, Arend WP. The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 beta production in human monocytes and neutrophils. Lymphokine Cytokine Res. 1994;13:47-54[Medline] [Order article via Infotrieve]. 4. Cassatella MA, Bazzoni F, Ceska M, Ferro I, Baggiolini M, Berton G. IL-8 production by human polymorphonuclear leukocytes: the chemoattractant formyl-methionyl-leucyl-phenylalanine induces the gene expression and release of IL-8 through a pertussis toxin-sensitive pathway. J Immunol. 1992;148:3216-3220[Abstract].
5.
Dubravec DB, Spriggs DR, Mannick JA, Rodrick ML.
Circulating human peripheral blood granulocytes synthesize and secrete tumor necrosis factor alpha.
Proc Natl Acad Sci U S A.
1990;87:6758-6761 6. Grotendorst GR, Smale G, Pencev D. Production of transforming growth factor beta by human peripheral blood monocytes and neutrophils. J Cell Physiol. 1989;140:396-402[CrossRef][Medline] [Order article via Infotrieve]. 7. Cassatella MA, Meda L, Gasperini S, D'Andrea A, Ma X, Trinchieri G. Interleukin-12 production by human polymorphonuclear leukocytes. Eur J Immunol. 1995;25:1-5[Medline] [Order article via Infotrieve].
8.
Shirafuji N, Matsuda S, Ogura H, et al.
Granulocyte colony-stimulating factor stimulates human mature neutrophilic granulocytes to produce interferon-alpha.
Blood.
1990;75:17-19
9.
Takahashi GW, Andrews DF, Lilly MB, Singer JW, Alderson MR.
Effects of granulocyte-macrophage colony-stimulating factor and interleukin-3 on interleukin-8 production by human neutrophils and monocytes.
Blood.
1993;81:357-364 10. Kita H, Ohnishi T, Okubo Y, Weiler D, Abrams JS, Gleich GJ. Granulocyte/macrophage colony-stimulating factor and interleukin-3 release from human peripheral blood eosinophils and neutrophils. J Exp Med. 1991;974:745-748.
11.
Ericson SG, Zhao Y, Gao H, et al.
Interleukin-6 production by human neutrophils after Fc-receptor cross-linking or exposure to granulocyte colony-stimulating factor.
Blood.
1998;91:2099-2107
12.
Kansas GS, Muirhead MJ, Dailey MO.
Expression of the CD11/CD18, leukocyte adhesion molecule 1, and CD44 adhesion molecules during normal myeloid and erythroid differentiation in humans.
Blood.
1990;76:2483-2492
13.
Screaton GR, Bell MV, Jackson DG, Cornelis FB, Gerth U, Bell JI.
Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons.
Proc Natl Acad Sci U S A.
1992;89:12160-12164 14. Aruffo A, Stamenkovic I, Melnick M, Underhill CB, Seed B. CD44 Is the principal cell surface receptor for hyaluronate. Cell. 1990;61:1303-1313[CrossRef][Medline] [Order article via Infotrieve]. 15. Weber GF, Ashkar S, Glimcher MJ, Cantor H. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science. 1996;271:509-512[Abstract]. 16. Charrad RS, Li Y, Delpech B, et al. Ligation of the CD44 adhesion molecules reverses blockage of differentiation in human acute myeloid leukemia. Nat Med. 1999;5:669-676[CrossRef][Medline] [Order article via Infotrieve]. 17. Pericle F, Sconocchia G, Titus JA, Segal DM. CD44 is a cytotoxic triggering molecule on human polymorphonuclear cells. J Immunol. 1996;157:4567-4663. 18. Sconocchia G, Titus JA, Segal DM. CD44 is a cytotoxic triggering molecule in peripheral blood NK cells. J Immunol. 1994;153:5473-5481[Abstract].
19.
DeGrendele HC, Estess P, Siegelman MH.
Requirement for CD44 in activated T cell extravasation into an inflammatory site.
J Immunol.
1999;163:1619-1627 20. Lesley J, Hyman R, English N, Catterall JB, Turner GA. CD44 in inflammation and metastasis. Glycoconj J. 1997;14:611-622[CrossRef][Medline] [Order article via Infotrieve]. 21. O'Shea JJ, McVicar DW, Kuhns DB, Ortaldo JR. A role for protein tyrosine kinase activity in natural cytotoxicity as well as antibody-dependent cellular cytotoxicity. J Immunol. 1992;148:2497-2502[Abstract]. 22. Tamaoki T, Nomoto H, Takahashi I, Kato Y, Morimoto M, Tomita F. Staurosporine, a potent inhibitor of phospholipid/Ca++ dependent protein kinase. Biochem Biophys Res Commun. 1986;135:397-402[CrossRef][Medline] [Order article via Infotrieve].
23.
Djeu JY, Liu JH, Wei S, et al.
Function associated with interleukin-2 receptor-
24.
Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC.
CD14 serves as the cellular receptor for complexes of lipopolysaccharide (LPS) and LPS-binding protein.
Science.
1990;249:1431-1433 25. Ulevitch RJ, Tobias PS. Receptor-dependent mechanism of cell stimulation by bacterial endotoxin. Ann Rev Immunol. 1995;13:437-457[CrossRef][Medline] [Order article via Infotrieve]. 26. Lloyd AR, Oppenheim JJ. Poly's lament: the neglected role of the polymorphonuclear neutrophil in the afferent limb of the immune response. Immunol Today. 1992;13:169-172[CrossRef][Medline] [Order article via Infotrieve]. 27. Cassatella MA. The production of cytokines by polymorphonuclear neutrophils. Immunol Today. 1995;16:21-26[CrossRef][Medline] [Order article via Infotrieve]. 28. Bazzoni F, Cassatella MA, Laudanna C, Rossi F. Phagocytosis of opsonized yeast induces tumor necrosis factor-alpha mRNA accumulation and protein release by human polymorphonuclear leukocytes. J Leukocyte Biol. 1991;50:223-228[Abstract]. 29. Ravetch JV, Kinet JP. Fc Receptors. Annu Rev Immunol. 1991;9:457-492[Medline] [Order article via Infotrieve].
30.
Perussia B, Dayton ET, Lazarus R, Fanning V, Trinchieri G.
Immune interferon induces the receptor for monomeric IgG1 on human monocytic and myeloid cells.
J Exp Med.
1983;158:1092-1113
31.
Davis BH, Bigelow NC, Cutnutte JT, Ornvold K.
Neutrophils CD64 expression: potential diagnostic indicator of acute inflammation and therapeutic monitor of interferon- 32. Guyre PM, Campbell AS, Kniffin WD, Fanger MV. Monocytes and polymorphonuclear neutrophils of patients with streptococcal pharyngitis express increased numbers of type I IgG Fc receptors. J Clin Invest. 1990;86:1892-1896. 33. Majima T, Minegishi N, Nagatomi R, et al. Unusual expression of IgG Fc receptor on peripheral granulocytes from patients with leukocyte adhesion deficiency (CD11/CD18 deficiency). J Immunol. 1990;145:1694-1699[Abstract].
34.
Repp R, Valerius T, Sendler A, et al.
Neutrophils express the high affinity receptor for IgG (Fc
35.
Melani C, Mattia GF, Silvani A, et al.
Interleukin-6 expression by human neutrophil and eosinophil peripheral blood granulocytes.
Blood.
1993;81:2744-2749
36.
Palma C, Cassone A, Serbousek D, Pearson CA, Djeu J.
Lactoferrin release and interleukin-1, interleukin-6, and tumor necrosis factor production by human polymorphonuclear cells stimulated by various lipopolysaccharides: relationship to growth inhibition of candida albicans.
Infect Immun.
1992;60:4604-4611 37. Holland SM, Gallin JI. Neutrophils. In Crystal G, West JB, eds. The Lung. Philadelphia, PA: Lippincott, Raven; 1997:877-890. 38. Sastry K, Ezekowitz RA. Collectins: pattern recognition molecules involved in first-line host defense. Curr Opin Immunol. 1993;5:59-66[CrossRef][Medline] [Order article via Infotrieve]. 39. Estess P, Nandi A, Mohamadzadeh M, Siegelman M. Interleukin 15 induces endothelial hyaluronan expression in vitro and promotes |
Top
Abstract
Introduction
,
