|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Division of Immunology, Beth Israel Deaconess
Medical Center, Harvard Medical School, Boston, MA; the Immunology
Unit, Department of Cellular Biology and Pathology, IDIBAPS, Medical
School, University of Barcelona, Spain.
X-linked lymphoproliferative disease (XLP) is a rare immune
disorder commonly triggered by infection with Epstein-Barr virus. Major
disease manifestations include fatal acute infectious mononucleosis, B-cell lymphoma, and progressive dys-gammaglobulinemia.
SAP/SH2D1A, the product of the gene mutated in XLP, is a small
protein that comprises a single SH2 domain and a short tail of 26 amino
acids. SAP binds to a specific motif in the cytoplasmic tails of the cell surface receptors SLAM and 2B4, where it blocks recruitment of the
phosphatase SHP-2. Here it is reported that Ly-9 and CD84, 2 related
glycoproteins differentially expressed on hematopoietic cells, also
recruit SAP. Interactions between SAP and Ly-9 or CD84 were analyzed
using a novel yeast 2-hybrid system, by COS cell transfections and in
lymphoid cells. Recruitment of SAP is most efficient when the specific
tyrosine residues in the cytoplasmic tails of Ly-9 or CD84 are
phosphorylated. It is concluded that in activated T cells, the SAP
protein binds to and regulates signal transduction events initiated
through the engagement of SLAM, 2B4, CD84, and Ly-9. This suggests that
combinations of dysfunctional signaling pathways initiated by these 4 cell surface receptors may cause the complex phenotypes of XLP.
(Blood. 2001;97:3867-3874) After infection with Epstein-Barr virus
(EBV), patients with X-linked lymphoproliferative disease (XLP) mount a
vigorous, uncontrolled polyclonal expansion of both T and B cells. The
primary cause of death is hepatic necrosis and bone marrow failure,
which appears to stem from uncontrolled T-cell responses. However, 2 other major manifestations of the XLP syndrome, B-cell lymphomas of the gastrointestinal tract and dys-gammaglobulinemia, can
develop in the absence of EBV infection.1
Collectively, genetic and functional studies of patients with XLP
suggest that a mutation in SAP causes an intrinsic T or natural killer
(NK) cell defect that becomes particularly life threatening with
EBV infection.
The XLP gene SAP (or SH2D1A)2-4
encodes a 15-kd single SH2 domain that can function as a natural
inhibitor of signal transduction events initiated by the cell surface
receptors SLAM (CD150) and 2B4.1,2,5-10 In fact, on
phosphorylation, both receptors recruit the tyrosine phosphatase SHP-2,
which is blocked by SAP. SAP binds to the cytoplasmic tail of SLAM in
the absence of phosphorylation in yeast, COS cells, and T
lymphocytes.2
SLAM (CD150), a member of the immunoglobulin superfamily, is a
glycosylated transmembrane protein expressed on all activated T, B, and
dendritic cells.11-16 Engagement of SLAM by specific monoclonal antibodies induces interferon SAP also associates with 2B4 (CD244), a membrane protein that has
sequence homologies with SLAM in its ectodomain and its cytoplasmic
tail and that is expressed constitutively on the surfaces of NK
cells.17 In addition, 2B4 is expressed on the surfaces of
a subset of human and mouse CD8+ T cells and human
monocytes. Engagement of 2B4 induces cytokine secretion (IFN- To identify other proteins that interact with SAP, a novel yeast
2-hybrid system was used in which tyrosine residues of the bait-protein
could be phosphorylated. This altered yeast 2-hybrid system uses a
mutated form of the src-family kinase c-fyn to phosphorylate proteins in the yeast cell. The mutations are designed to eliminate toxicity for the yeast cell. Using this method, 2 cell surface proteins, Ly-9 (CD299) and CD84, were found to interact with
phosphorylated SAP. Further analyses indicate that the binding
properties of SAP and the cytoplasmic tails of Ly-9, CD84, and 2B4 are
slightly different from those of SAP and SLAM. Nevertheless, the
current study shows that SAP can be recruited to the cytoplasmic tail of at least 4 cell surface molecules on the surfaces of hematopoietic cells.
Plasmid construction
DNA sequences encoding mutants of human c-fyn SLAM-, 2B4-, and CD84-GAL4 DNA activation domain chimeric proteins were
obtained by cloning cDNA encoding for the cytoplasmic tail of these
proteins in the vector pGAD424. SLAM cDNA fragment was obtained from
the pGBT9/SLAM construct2 by cutting with EcoRI
and BamHI and cloned in the
EcoRI/BamHI sites. 2B4 was amplified by PCR using
as a template m2B4 in plasmid pC1-Neo and cloned in the
EcoRI/BglII sites (2B4 5' sense primer,
5'-CCGGAATTCAAGAAGAGGAAGCAGTTACAG TTC-3'; and 2B4 3' antisense primer
5'-GGAAGATCTCTAGGAGTAGACATCAAAGTTCTC-3'). CD84 was amplified by PCR
using as a template hCD84 in plasmid pC1-Neo22 and cloned
in the EcoRI/BamH1 sites. (CD84 5' sense primer,
5'-ATCGAATTCTTCCGTTTGTTCAAGAGAAGA-3'; and CD84 3' antisense primer,
5'-ATCGGATCCCTAGATCACAATTTCATAGCT-3'.)
Three mutated DNA sequences encoding for the last 107 amino acids of
human Ly-9 cytoplasmic domain (mutants Ly-9 558 Y-F, Ly-9
581 Y-F, and Ly-9558, 581 Y-F)
were subcloned in the GAL4 DNA activation domain vector pGAD424 using
the EcoRI/BamH1 sites. For the construction of
mutant Ly-9 558 Y-F, 2 Ly-9 cDNA fragments were amplified
using human pGAD424/Ly-9 (clone 4-1) as a template, then
annealed at overlapping ends containing the 558 Y-F substitution,
filled in, and further amplified to produce the mutant. (First fragment
was generated using the Ly-9 5' sense primer, 5'
GATGATGAAGATACCCCACCAAA 3'; and primer Ly-9 558 F 3'
antisense, 5' CACTTGTGCAAACACGGTGTTCTCTCCAAC 3'; and the second cDNA
fragment using primers Ly-9 558 F 5' sense, 5'
GAGAACACCGTGTTTGCACAAGTGTTCAAC 3' and Ly-9 3' antisense primer,
5' ATCGGATCCCTGAGGTGCTTCTGTCCTGCGAGC.) Mutant Ly-9
581 Y-F was generated in a similar way using the
primers Ly-9 581 F 5' sense, 5'
TCAGCCACAATCTTCTGCTCCATACGGAAACCT 3'; and Ly-9 581 F 3'
antisense, 5' CCGTATGGAGCAGAAGATTGTGGCTGAGCTCTC 3'. Mutant Ly-9
558, 581 Y-F was obtained in the same way as Ly-9 581 F but using Ly-9 558 F as a template for the PCR reactions.
An altered yeast 2-hybrid system
For the 2-hybrid screen in the presence of Fyn420, 531 Y-F, the yeast strain CG1945 was cotransformed with the vector (pBRIDGE), containing both SAP and the c-fyn mutant. These transformants were selected on SD media lacking tryptophan for 3 days. Next, these transformants were transformed for a second time with 1 mg cDNA library derived from the human T-cell line KT3 in pGAD424. Double transformants were then plated in SD media lacking Trp, Leu, His, and Met in the presence of 5 mM 3-amino triazole. Yeast clones that grew under these restrictive conditions were
then tested by the The Cells and antibodies EL-4/SLAM4,2 Jurkat cells, Jurkat stably transfected with human CD84 cells, and Raji cells were grown in RPMI 1640 medium supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. COS cell transfections were carried out as previously described.2,8An antihuman 2B4 monoclonal antibody (C1.7) was purchased from Immunotech, and monoclonal antimouse Ly-9 (clone 30C7) hybridoma from ATTC (Manassas, VA).23 Antihuman Ly-9 (clone HLy-9.1.84) and CD84 (clone CD84.1.21 and CD84.1.7) were produced by immunizing BALB/c mice with 300.19 murine cells stably transfected with full-length cDNA. The antihuman SLAM antibody (A12) was a gift from DNA-X (Palo Alto, CA).2 Monoclonal antihuman SAP was obtained by standard procedures by immunizing BALB/c mice with the synthetic peptide CQGTTGIREDPDV coupled to KLH (Pierce, Rockford, IL). Phosphotyrosine monoclonal antibody cocktail horseradish peroxidase-conjugated (PY-7E1, PY-1B2, PY20) and horseradish peroxidase-conjugated streptavidin were from Zymed (San Francisco, CA). Cell activation, immunoprecipitation, and immunoblotting Mouse thymocytes (BALB/c), Jurkat, Jurkat/CD84, Raji, and EL-4/SLAM4 cells (50 × 106/mL) were activated with 1 mM pervanadate for 20 minutes at 37°C. Lysis was carried out with 2% Triton X-100 as described before.2 Cell lysates were centrifuged at 14 000g for 15 minutes at 4°C, and the crude lysate was precleared for 1 hour with 50 µL protein G-agarose beads (Gibco BRL, Rockville, MD) and 5 µL normal mouse serum. Immunoprecipitations used 1µg indicated antibody and 30 µL protein G-agarose beads for 3 hours at 4°C. Beads were then washed as described.2 Crude lysates and immunoprecipitates were subjected to SDS-PAGE and transferred onto nitrocellulose filters (Millipore, Bedford, MA). Filters were blocked for 1 hour with 5% skim milk (or 3% bovine serum albumin) and then probed with the indicated antibodies. Bound antibody was detected using horseradish peroxide-conjugated secondary antibodies and enhanced chemiluminescence (Supersignal; Pierce).Immunofluorescence microscopy COS-7 cells were transfected with human Ly-9 or human CD84 cDNA using the lipofectamine method (Roche, Pleasanton, CA). After 48 hours, cells were labeled with biotinylated antihuman mAb Ly-9 or (HLy-9.1.84), biotinylated antihuman mAb CD84 (CD84.1.7), or biotinylated anti-SLAM (A12) (5 µg/mL) at 4°C for 30 minutes. After 2 washes with ice-cold PBS, cells were incubated with streptavidin-fluorescein isothiocyanate (FITC) (Dako, Carpinteria, CA) or streptavidin-Cy3 (Dako). Cells were then washed twice with ice-cold PBS, immobilized in poly-L-lysine-treated coverslips at 4°C for 15 minutes, and fixed in 20°C methanol for 15 minutes. After 2 washes,
cells were incubated for 30 minutes at room temperature with
blocking buffer (PBS containing 0.2% skim milk, 2% fetal bovine
serum, 1% bovine serum albumin, 0.1 mM Gly) and then with
Cy3-conjugated anti-SAP antibody (10C4.2) or FITC-conjugated anti-SAP
antibody for 30 minutes at room temperature. Controls used an
isotypic IgG1 conjugated with Cy3 or FITC. Cells were washed twice with PBS and mounted in Fluoromount-G (Southern Biotechnology, Birmingham, AL). Fluorescence images were obtained using a confocal microscope (TCS
NT; Leica, Heidelberg, Germany).
Jurkat cells were stained with biotinylated antihuman CD84 (CD84.1.7), biotinylated antihuman Ly9 (HLy-9.1.84), or mouse IgG1 isotype control (5 µg/mL) at 4°C for 30 minutes as described above.
A novel yeast 2-hybrid system for binding studies between SAP and other proteins To study binding of the SAP SH2 domain to phosphorylated and nonphosphorylated proteins, a novel yeast 2-hybrid system was set up using c-fyn. Efficiency of the method was first tested using the cytoplasmic tail of 2B4 and full-length SAP (see "Materials and methods"). Only when a yeast cell coexpressed SAP, 2B4, and Fyn420, 531 Y-F was an interaction detected in the -galactosidase assay (Figure 1A,
hatched bars). Cotransfection of SAP with 2B4 in the presence of
Fyn420, 531 Y-F, 176 R-Q resulted in higher values in the
-galactosidase assay (Figure 1A, dotted bars), implying a stronger
interaction between SAP and 2B4 than that detected in the presence of
Fyn420, 531 Y-F, which had an intact SH2 domain. This
demonstrated that 2B4 and SAP interact in yeast, but only when 2B4 is
phosphorylated. The experiment suggests that the c-fyn SH2
domain might interfere with the binding of SAP to the cytoplasmic tail
of 2B4 (see below).
In contrast to 2B4, SLAM interacted with SAP in a
phosphotyrosine-independent fashion. To confirm that SAP bound to phospho-2B4 preferentially, cells of the NK line YT were used for coimmunoprecipitation of SAP and 2B4. Only when 2B4 was phosphorylated by pervanadate treatment of the cells did this surface receptor bind to SAP (Figure 1B). By contrast, SAP binds to both phospho- and nonphospho-SLAM in the T-cell line EL4 (Figure 1C). Thus, the binding experiments in yeast truthfully represented interactions found in hematopoietic cells. SAP binds specifically to the cytoplasmic tail of the hematopoietic cell surface receptor Ly-9 When 1 × 106 clones of a yeast T-cell library (KT3) were screened using SAP as bait in the presence of Fyn 420, 531 Y-F, 5 clones were isolated. These were all positive, as judged by their ability to grow in media lacking histidine and by their-galactosidase activity. Each clone encoded a fragment with the exact nucleotide sequence of the cytoplasmic tail of human Ly-9. Ly-9
is a glycoprotein whose extracellular domain belongs to the same subfamily of the immunoglobulin superfamily of proteins as SLAM
and 2B4. When Ly-9 was subsequently cotransfected in yeast with SAP
alone, no -galactosidase activity was detected. However, in the
presence of Fyn420, 531 Y-F, the interaction between phospho-Ly-9 and SAP resulted in detectable -galactosidase activity (Figure 2A).
To refine the specificity of the interaction and to determine which of the 3 phosphotyrosines in the cytoplasmic tail of Ly-9 were involved in SAP binding, Ly-9 mutants were tested in the yeast 2-hybrid system. Because the 2 (T V/I pY x x V/I)-motifs (see Figure 4), in the cytoplasmic tail of Ly-9 were the most logical candidates for SAP binding, 3 mutants were made. Tyrosine 558 (Ly9-558-YF), tyrosine 581 (Ly9-581-YF), or both tyrosine residues (Ly9-558581-YF) were substituted by phenylalanine. The Ly-9 mutants were then subcloned in the GAL4-binding domain of pGAD424, and these constructs were cotransfected in yeast with SAP alone or with SAP and Fyn 420, 531 Y-F. As shown in Figure 2B, the phosphorylated form of each single mutant (Ly9-558-YF or Ly9-581-YF) binds SAP, in fact better than the wt Ly9 segment. However, no interaction was detected when both tyrosine residues were absent in the cytoplasmic tail of Ly-9 (Ly9-558581-YF). We conclude that each of the 2 phosphotyrosine motifs binds SAP specifically and that no other binding sites are involved. To verify the interaction between SAP and Ly-9, mouse thymocytes, which express large amounts of both Ly9 and SAP, were activated with pervanadate and subjected to immunoprecipitation using an anti-Ly-9 antibody. As predicted by the yeast data, SAP interacted with Ly-9, but only after the cells were treated with pervanadate and Ly-9 became tyrosine-phosphorylated (Figure 2C). No interaction was detected in untreated cells. We conclude that Ly-9, like 2B4 and SLAM, recruits SAP but that, unlike SLAM, this binding appears to be dependent on the phosphorylation status of the tyrosine motif in the cytoplasmic tail of Ly-9. SAP binds to the cytoplasmic tail of the cell surface receptor CD84 CD84, a member of the SLAM family expressed on the surface of B and T lymphocytes and monocytes, contains 3 potential SAP-binding motifs in its cytoplasmic tail (Figure 4). That prompted us to examine the interaction of CD84 with SAP in yeast and in lymphocytes. CD84 was transfected into yeast together with SAP or with SAP and Fyn 420531 Y-F. As judged by the-galactosidase assay, CD84 interacted with SAP (Figure 3A). Again
this interaction could be detected only when c-fyn was
cotransfected and no binding was detected in the absence of the
tyrosine kinase.
SAP and the cytoplasmic tail of CD84 interact in a variant of the human B-cell line Raji, but only when the cells were treated with pervanadate (Figure 3B). Pervanadate treatment results in a strong phosphorylation of CD84, which permits association with SAP. No SAP binding was observed on untreated cells. Because SAP is primarily a T-cell protein, the CD84-SAP interaction was also examined in JURKAT cells, which had been stably transfected with human CD84. Once again, SAP coprecipitated with the phosphorylated form of CD84 (Figure 3C). Taken together, the observations demonstrate that the cell surface
receptor CD84 interacts with SAP. The results also indicate that the
mode of interaction between SAP and SLAM differs from interactions
between SAP and Ly-9 or CD84. This suggests that the apparent affinity
between the SH2 domain of SAP and its recognition sites in the
cytoplasmic tail of Ly-9 or CD84 must be lower. Because the minimal
binding motifs (Figure 4), however, are
similar if not identical, interactions with other segments might play a
role.
SAP inhibits the association of SHP-2 with phosphorylated Ly-9 and CD84 The cytoplasmic tail of SLAM contains 2 binding sites for SAP one
is in a peptide segment that includes Y281, and one includes Y327.
Optimal binding of SAP occurs when each site is phosphorylated, but SAP
also binds strongly to the Y281 site in the absence of phosphorylation.
For activation of the tyrosine phosphatase SHP-2, both of its
SH2-domains are required to bind to their docking sites. In the
cytoplasmic tail of SLAM, the SHP-2 docking sites are the same as the
SAP docking sites (the pY281 and the pY327 motif) (D.H., unpublished
data, February 2000). As expected, SHP-2 does not bind to
nonphosphorylated SLAM.2,10
As reported previously, SAP blocks recruitment of SHP-2 to the phosphorylated cytoplasmic tail of SLAM.2 The structure of SAP is consistent with this role as a natural inhibitor, and the affinity of SAP for a phosphorylated tyrosine pY281-peptide (binding constant, approximately 120 nM) is higher than the affinity of other SH2 domains for their phosphotyrosine-binding motifs.10 Because Ly-9 and CD84 each contain 2 SAP-binding motifs (Figure 4), the
ability of SAP to block recruitment of SHP-2 to these receptors was
tested in COS cells.2 As expected, SHP-2 binds to
phosphorylated Ly-9 only (Figure 5A), and
SAP interferes with that binding. Similarly, SHP-2 binds to CD84, if
c-fyn is cotransfected into the same COS cells (Figure 5B),
and this binding is blocked by the presence of SAP.
In the COS cell experiments, SAP was found to bind frequently to Ly-9 or CD84 after transfection with SAP but in the absence of transfection with c-fyn. This could be explained by the small percentage of Ly-9 or CD84 molecules phosphorylated in COS cells in the presence of SAP, probably by an endogenous COS cell tyrosine kinase; SAP may bind to those phosphorylated forms exclusively. Induction of phosphorylation of SLAM in COS cells transfected with SAP had been observed previously.2 In addition, the high levels of SAP and receptor in the COS cell expression system could be favorable to an interaction between SAP and nonphospho Ly9 or CD84. Collectively, these results support a model in which SAP acts as a natural inhibitor of the docking sites for SH2-containing enzymes and adapters in the cytoplasmic tail of Ly-9 or CD84. SAP is recruited to the cell surface on phosphorylation of Ly-9 and CD84 To examine whether the associations between Ly-9 or CD84 and SAP took place on the cell surfaces, COS cell transfectants were analyzed by immunofluorescence techniques. As shown in Figure 6, SAP is evenly distributed throughout the cytoplasm of COS cells. By contrast, most Ly-9 and CD84 molecules are expressed in the plasma membrane. In double transfectants, a large proportion of the immunofluorescence developed with -SAP colocalizes
with -Ly-9 or -CD84 staining (Figure 6). The selected pictures
are representative of observations made in 3 independent COS cell
experiments.
To test whether SAP was recruited to the plasma membrane in T cells,
cocapping experiments were done in Jurkat cells with
Identical results were obtained when Jurkat cells were treated with an anti-Ly-9 monoclonal antibody in a similar set of experiments. Under capping conditions, SAP colocalized with Ly-9 (Figure 7E-H). We conclude from the immunofluorescence studies that on triggering of Ly-9 and CD84 with their respective monoclonal antibodies, SAP colocalizes with the receptors at the plasma membrane.
Ly-9 and CD84 are both members of the immunoglobulin superfamily,
and their ectodomains are related to the other 2 SAP-binding proteins
SLAM and 2B4 (Figure 8).2,5-10,23,24 All 4 molecules comprise 2 immunoglobulin-like domains (V and C2 domains)
with the exception of Ly-9, which contains a tandem repeat of V-C2 domains (Figure 8). By contrast, CD48 does not have a
cytoplasmic tail and has been shown to be attached to the plasma
membrane by a conventional phosphoinositol lipid tail.25
CD48 serves as the ligand for 2B4,19 and a weak but
measurable homophilic interaction between SLAM has been
reported.16
The interaction between SAP and the Y281 motif of the cytoplasmic tail of SLAM appears to be unique in that it does not require tyrosine phosphorylation. Understanding the physicochemical parameters of the interactions between SAP and SLAM has been facilitated by the 3-dimensional structure of SAP associated with a peptide that included the binding motif in the cytoplasmic tail of SLAM.10 This peptide binds to SAP regardless of whether its essential tyrosine residue Y281 is phosphorylated. However, the apparent binding constant, as determined by fluorescence polarization, was different with the phosphophorylated peptide (120 nM) than with the nonphosphorylated peptide (830 nM),10 indicating a higher affinity for the phosphorylated peptide. Thus, the structure of SAP and physicochemical studies support the notion that SAP can act as a natural inhibitor. The physicochemical parameters, which determine the differences in affinity of binding between SAP and the 4 members of the SLAM family, are unknown. However, it is likely that segments of their cytoplasmic tails located outside the binding motif areas could affect the binding affinity. It is an attractive speculation that the observed dependence on phosphorylation of the interaction of SAP and 2B4, Ly9, or CD84 may indicate differences in the way SAP governs signal transduction pathways initiated by these receptors. Although the function of Ly-9 and CD84 is unknown, it has been
suggested that they may participate in adhesion between T lymphocytes and antigen-presenting cells by homophilic interactions.24
CD84 is expressed on macrophages and T and B lymphocytes, whereas Ly-9 expression is restricted to T and B cells.22 Thus, 3 known
SAP-binding cell surface structures As expansion of CD8 and CD4 cells has been observed in XLP patients infected with EBV and because NK cell functions are impaired in a subset of XLP patients, the 4 SAP-binding cell surface molecules are likely to have a cumulative effect on the pathogenesis of the disease. Based on their tissue distribution, we speculate that all 4 receptors are engaged on the surface of a T cell (CD8 cell in the case of 2B4) that recognizes an EBV-infected B cell. Moreover, in the absence of SAP, the CD48/2B4 pair induces abnormal signaling in NK cells. This might happen in concordance with aberrant SLAM signaling in NK cells. Taken together, our observations are consistent with a model in which T
and NK cells, through a group of signaling pathways generated by
different receptors, control EBV-transformed B-cell proliferation. The
absence of SAP in XLP patients produces a functional impairment of
these pathways and results in a deficient or unbalanced production of
cytokines (IFN-
We thank Charles Gullo, Ype de Jong, and Kareem Clarke for a critical review of the manuscript, and Martin Sickler for editorial assistance.
Submitted December 6, 2000; accepted February 16, 2001.
Supported by National Institutes of Health grant PO1-AI-35714 (C.T.), the National Foundation March of Dimes (C.T.), and Comision Interministerial de Ciencia y Tecnologia grants SAF97-0136 and SAF00-37 (P.E.). M.M. and M.S. are supported by a Fellowship from Ministerio de Educacion y Cultura, and D.H. is supported by a Postdoctoral Fellowship from the Leukemia and Lymphoma Society.
J.S. and M.M. contributed equally to this project.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Cox Terhorst, Division of Immunology, RE-204, Beth Israel Deaconess Medical Center, Harvard Medical School, Brookline Ave, Boston, MA 02215; e-mail: terhorst{at}caregroup.harvard.edu.
1. Purtilo D-T, Cassel C-K, Yang J-P, Harper R. X-linked recessive progressive combined variable immunodeficiency. Lancet. 1975;1:935-940[Medline] [Order article via Infotrieve]. 2. Sayos J, Wu C, Morra M. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature. 1998;395:462-469[CrossRef][Medline] [Order article via Infotrieve]. 3. Coffey A-J, Brooksbank R-A, Brandau O. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH2-domain encoding gene. Nat Genet. 1998;20:129-135[CrossRef][Medline] [Order article via Infotrieve].
4.
Nichols K-E, Harkin D-P, Levitz S.
Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome.
Proc Natl Acad Sci U S A.
1998;95:13765-13770
5.
Tangye S-G, Lazetic S, Woollatt E, Sutherland G-R, Lanier L-L, Phillips J-H.
Human 2B4, an activating NK cell receptor, recruits the protein tyrosine phosphatase SHP-2 and the adaptor signaling protein SAP.
J Immunol.
1999;162:6981-6985
6.
Tangye S-G, Phillips J-H, Lanier L-L, Nichols K-E.
Functional requirement for SAP in 2B4-mediated activation of human natural killer cells as revealed by the X-linked lymphoproliferative syndrome.
J Immunol.
2000;165:2932-2936
7.
Parolini S, Bottino C, Falco M, et al.
X-linked lymphoproliferative disease: 2B4 molecules displaying inhibitory rather than activating function are responsible for the inability of natural killer cells to kill Epstein-Barr virus-infected cells.
J Exp Med.
2000;192:337-346
8.
Sayos J, Nguyen K, Wu C, et al.
Potential pathways for regulation of NK and T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4.
Int Immunol.
2000;12:1749-1757 9. Benoit L, Wang X, Tan R. Defective natural killer cell activation in X-linked lymphoproliferative disease. J Immunol. 2000;7:3549-3553. 10. Poy F, Yaffe M-B, Sayos J, et al. Crystal structures of the XLP protein SAP reveal a class of SH2 domains with extended, phosphotyrosine-independent sequence recognition. Mol Cell. 1999;4:555-561[CrossRef][Medline] [Order article via Infotrieve]. 11. Cocks B-G, Chang C-C, Carballido J-M, Yssel H, de Vries J-E, Aversa G. A novel receptor involved in T-cell activation. Nature. 1995;376:260-263[CrossRef][Medline] [Order article via Infotrieve]. 12. Aversa G, Chang C-C, Carballido J-M, Cocks B-G, de Vries J-E. Engagement of the signaling lymphocytic activation molecule (SLAM) on activated T cells results in IL-2-independent, cyclosporin A-sensitive T cell proliferation and IFN-gamma production. J Immunol. 1997;158:4036-4044[Abstract]. 13. Aversa G, Carballido J, Punnonen J, et al. SLAM and its role in T cell activation and Th responses. Immunol Cell Biol. 1997;75:202-205[Medline] [Order article via Infotrieve]. 14. Carballido J-M, Aversa G, Kaltoft K, et al. Reversal of human allergic T helper 2 responses by engagement of signaling lymphocytic activation molecule. J Immunol. 1997;159:4316-4321[Abstract].
15.
Punnonen J, Cocks B, Carballido J, et al.
Soluble and membrane-bound forms of signaling lymphocytic activation molecule (SLAM) induce proliferation and Ig synthesis by activated human B lymphocytes.
J Exp Med.
1997;185:993-1004 16. Mavaddat N, Mason D-W, Atkinson P-D, et al. Signaling lymphocytic activation molecule (SLAM, CD150) is homophilic but self-associates with very low affinity. J Biol Chem. 2000. 17. Mathew P-A, Garni-Wagner B-A, Land K, et al. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHCrestricted killing mediated by activated natural killer cells and T cells. J Immunol. 1993;151:5328-5337[Abstract]. 18. Garni-Wagner B-A, Purohit A, Mathew P-A, Bennett M, Kumar V. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer cells and T cells. J Immunol. 1993;151:60-70[Abstract].
19.
Brown M-H, Boles K, Anton van der Merwe P, Kumar V, Mathew P-A, Barclay A-N.
2B4, the natural killer and T cell immunoglobulin superfamily surface protein, is a ligand for CD48.
J Exp Med.
1998;188:2083-2090
20.
Peritt D, Sesok-Pizzini D-A, Schretzenmair R.
C1.7 antigen expression on CD8+ T cells in HIV-1-infected patients with progressing disease.
J Immunol.
1997;162:7563-7568 21. Nakajima H, Colonna M. 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol. 2000;61:39-43[CrossRef][Medline] [Order article via Infotrieve].
22.
Staunton D-E, Fisher R-C, Le Beau M-M.
Blast-1 possesses a glycosyl-phosphatidylinositol (GPI) membrane anchor, is related to LFA3 and OX-45, maps to chromosome 1q21-23.
J Exp Med.
2000;169:1087-1099
23.
de la Fuente M-A, Pizcueta P, Nadal M, Bosch J, Engel P.
CD84 leukocyte antigen is a new member of the Ig superfamily.
Blood.
1997;90:2398-2405 24. Howie D, Sayos J, Terhorst C, Morra M. The gene defective in X-linked lymphoproliferative disease controls T cell dependent immune surveillance against Epstein-Barr virus. Curr Opin Immunol. 2000;12:474-478[CrossRef][Medline] [Order article via Infotrieve]. 25. Tangye SG, Phillips JH, Lanier LL. The CD2subset of the Ig superfamily of cell surface molecules: receptor-ligand pairs expressed by NK cells and other immune cells. Semin Immunol 2000;12:149-157[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  J. K. Lee, S. O. Mathew, S. V. Vaidya, P. R. Kumaresan, and P. A. Mathew CS1 (CRACC, CD319) Induces Proliferation and Autocrine Cytokine Expression on Human B Lymphocytes J. Immunol., October 1, 2007; 179(7): 4672 - 4678. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase J. Immunol., January 15, 2007; 178(2): 817 - 828. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease Blood, November 1, 2006; 108(9): 3085 - 3093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Martinez-Barriocanal and J. Sayos Molecular and Functional Characterization of CD300b, a New Activating Immunoglobulin Receptor Able to Transduce Signals through Two Different Pathways. J. Immunol., September 1, 2006; 177(5): 2819 - 2830. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Eissmann and C. Watzl Molecular Analysis of NTB-A Signaling: A Role for EAT-2 in NTB-A-Mediated Activation of Human NK Cells. J. Immunol., September 1, 2006; 177(5): 3170 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Williams and D. H. Crawford Epstein-Barr virus: the impact of scientific advances on clinical practice Blood, February 1, 2006; 107(3): 862 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Graham, M. P. Bell, M. M. McCausland, C. J. Huntoon, J. van Deursen, W. A. Faubion, S. Crotty, and D. J. McKean Ly9 (CD229)-Deficient Mice Exhibit T Cell Defects yet Do Not Share Several Phenotypic Characteristics Associated with SLAM- and SAP-Deficient Mice J. Immunol., January 1, 2006; 176(1): 291 - 300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Komori, H. Furukawa, S. Mori, M. R. Ito, M. Terada, M.-C. Zhang, N. Ishii, N. Sakuma, M. Nose, and M. Ono A Signal Adaptor SLAM-Associated Protein Regulates Spontaneous Autoimmunity and Fas-Dependent Lymphoproliferation in MRL-Faslpr Lupus Mice J. Immunol., January 1, 2006; 176(1): 395 - 400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Saborit-Villarroya, J. M. Del Valle, X. Romero, E. Esplugues, P. Lauzurica, P. Engel, and M. Martin The Adaptor Protein 3BP2 Binds Human CD244 and Links this Receptor to Vav Signaling, ERK Activation, and NK Cell Killing J. Immunol., October 1, 2005; 175(7): 4226 - 4235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Al-Alem, C. Li, N. Forey, F. Relouzat, M.-C. Fondaneche, S. V. Tavtigian, Z.-Q. Wang, S. Latour, and L. Yin Impaired Ig class switch in mice deficient for the X-linked lymphoproliferative disease gene Sap Blood, September 15, 2005; 106(6): 2069 - 2075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Romero, N. Zapater, M. Calvo, S. G. Kalko, M. A. de la Fuente, V. Tovar, C. Ockeloen, P. Pizcueta, and P. Engel CD229 (Ly9) Lymphocyte Cell Surface Receptor Interacts Homophilically through Its N-Terminal Domain and Relocalizes to the Immunological Synapse J. Immunol., June 1, 2005; 174(11): 7033 - 7042. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Dupre, G. Andolfi, S. G. Tangye, R. Clementi, F. Locatelli, M. Arico, A. Aiuti, and M.-G. Roncarolo SAP controls the cytolytic activity of CD8+ T cells against EBV-infected cells Blood, June 1, 2005; 105(11): 4383 - 4389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, J. M. Del Valle, I. Saborit, and P. Engel Identification of Grb2 As a Novel Binding Partner of the Signaling Lymphocytic Activation Molecule-Associated Protein Binding Receptor CD229 J. Immunol., May 15, 2005; 174(10): 5977 - 5986. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Chemnitz, R. V. Parry, K. E. Nichols, C. H. June, and J. L. Riley SHP-1 and SHP-2 Associate with Immunoreceptor Tyrosine-Based Switch Motif of Programmed Death 1 upon Primary Human T Cell Stimulation, but Only Receptor Ligation Prevents T Cell Activation J. Immunol., July 15, 2004; 173(2): 945 - 954. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chtanova, S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Th1/Th2 Effector Cells That Provide Help for B Cells J. Immunol., July 1, 2004; 173(1): 68 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-i. Yusa, T. L. Catina, and K. S. Campbell KIR2DL5 Can Inhibit Human NK Cell Activation Via Recruitment of Src Homology Region 2-Containing Protein Tyrosine Phosphatase-2 (SHP-2) J. Immunol., June 15, 2004; 172(12): 7385 - 7392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Sharifi, J. C. Sinclair, K. C. Gilmour, P. D. Arkwright, C. Kinnon, A. J. Thrasher, and H. B. Gaspar SAP mediates specific cytotoxic T-cell functions in X-linked lymphoproliferative disease Blood, May 15, 2004; 103(10): 3821 - 3827. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Simarro, A. Lanyi, D. Howie, F. Poy, J. Bruggeman, M. Choi, J. Sumegi, M. J. Eck, and C. Terhorst SAP increases FynT kinase activity and is required for phosphorylation of SLAM and Ly9 Int. Immunol., May 1, 2004; 16(5): 727 - 736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Tangye, K. E. Nichols, N. J. Hare, and B. C. M. van de Weerdt Functional Requirements for Interactions Between CD84 and Src Homology 2 Domain-Containing Proteins and Their Contribution to Human T Cell Activation J. Immunol., September 1, 2003; 171(5): 2485 - 2495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sanzone, M. Zeyda, M. D. Saemann, M. Soncini, W. Holter, G. Fritsch, W. Knapp, F. Candotti, T. M. Stulnig, and O. Parolini SLAM-associated Protein Deficiency Causes Imbalanced Early Signal Transduction and Blocks Downstream Activation in T Cells from X-linked Lymphoproliferative Disease Patients J. Biol. Chem., August 8, 2003; 278(32): 29593 - 29599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Del Valle, P. Engel, and M. Martin The Cell Surface Expression of SAP-binding Receptor CD229 Is Regulated via Its Interaction with Clathrin-associated Adaptor Complex 2 (AP-2) J. Biol. Chem., May 2, 2003; 278(19): 17430 - 17437. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Li, C. Iosef, C. Y. H. Jia, V. K. M. Han, and S. S.-C. Li Dual Functional Roles for the X-linked Lymphoproliferative Syndrome Gene Product SAP/SH2D1A in Signaling through the Signaling Lymphocyte Activation Molecule (SLAM) Family of Immune Receptors J. Biol. Chem., January 31, 2003; 278(6): 3852 - 3859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Baker and L. Manuelidis Unique inflammatory RNA profiles of microglia in Creutzfeldt-Jakob disease PNAS, January 21, 2003; 100(2): 675 - 679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shinozaki, H. Kanegane, H. Matsukura, R. Sumazaki, M. Tsuchida, M. Makita, Y. Kimoto, R. Kanai, K. Tsumura, T. Kondoh, et al. Activation-dependent T cell expression of the X-linked lymphoproliferative disease gene product SLAM-associated protein and its assessment for patient detection Int. Immunol., October 1, 2002; 14(10): 1215 - 1223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Bellon, F. Kitzig, J. Sayos, and M. Lopez-Botet Mutational Analysis of Immunoreceptor Tyrosine-Based Inhibition Motifs of the Ig-Like Transcript 2 (CD85j) Leukocyte Receptor J. Immunol., April 1, 2002; 168(7): 3351 - 3359. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Veillette The SAP Family: A New Class of Adaptor-Like Molecules That Regulates Immune Cell Functions Sci. Signal., February 19, 2002; 2002(120): pe8 - pe8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Howie, M. Simarro, J. Sayos, M. Guirado, J. Sancho, and C. Terhorst Molecular dissection of the signaling and costimulatory functions of CD150 (SLAM): CD150/SAP binding and CD150-mediated costimulation Blood, February 1, 2002; 99(3): 957 - 965. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Martin, X. Romero, M. A. de la Fuente, V. Tovar, N. Zapater, E. Esplugues, P. Pizcueta, J. Bosch, and P. Engel CD84 Functions as a Homophilic Adhesion Molecule and Enhances IFN-{gamma} Secretion: Adhesion Is Mediated by Ig-Like Domain 1 J. Immunol., October 1, 2001; 167(7): 3668 - 3676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Morra, O. Silander, S. Calpe, M. Choi, H. Oettgen, L. Myers, A. Etzioni, R. Buckley, and C. Terhorst Alterations of the X-linked lymphoproliferative disease gene SH2D1A in common variable immunodeficiency syndrome Blood, September 1, 2001; 98(5): 1321 - 1325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Morra, M. Simarro-Grande, M. Martin, A. S.-I. Chen, A. Lanyi, O. Silander, S. Calpe, J. Davis, T. Pawson, M. J. Eck, et al. Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients J. Biol. Chem., September 21, 2001; 276(39): 36809 - 36816. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
(IFN-
, macrophage; NH2,
amino-terminus; M, SAP-binding motif; -, N-linked carbohydrate
side chain.