| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Pathology and Laboratory
Medicine, Jonsson Comprehensive Cancer Center, and Molecular Biology
Institute, University of California Los Angeles, Los Angeles, CA.
A murine homologue of the epithelial membrane protein 2 (EMP2) gene was identified in a search for genes
associated with B-cell lymphoma tumorigenicity by using suppression
subtractive hybridization. Expression of EMP2 messenger RNA in primary
mouse tissues was limited to certain epithelial cell types and the
peritoneal lymphoid compartment. EMP2 was expressed in the
poorly tumorigenic DAC B-lymphoma cell line but was significantly
down-regulated in a subline selected for in vivo tumor formation in
Balb/c mice. Recombinant restoration of EMP2 expression in
the subline suppressed its tumorigenicity, suggesting that loss of
EMP2 was a causal factor in the malignant phenotype.
Recombinant overexpression of EMP2 was studied in B lymphoma and NIH3T3 cells. EMP2 in both cell types induced
cell death on serum deprivation. EMP2-induced cell death
correlated with the expression level of EMP2 protein and was prevented
by caspase inhibitors Z-VAD and Z-DEVD. These findings for the
first time describe an apoptotic effect of a GAS3
family gene in lymphocytes. They also suggest that EMP2 may
influence B-lymphoma tumorigenicity through a functional tumor
suppressor phenotype.
(Blood. 2001;97:3890-3895) B-cell lymphoma is among the more common classes of
human malignancies, with the number of cases doubling over the past 20 years. Lymphomas are generally multifocal at the time of diagnosis and
progress over time to more aggressive phenotypes, including invasion of
extranodal sites and resistance to therapy.1 A number of
molecular targets have been identified in natural B-cell lymphomagenesis (eg, c-myc, bcl-2,
bcl-6) with important roles in the molecular pathophysiology
of corresponding classes of lymphomas (Burkitt, follicular, and diffuse
large cell lymphomas, respectively).2,3 However, in vivo
and in vitro experimentation has shown that activation of these genes
individually is insufficient for a malignant phenotype. Relatively few
collaborating genes have been identified for the progression to
malignancy, notably those involving checkpoint control and genomic
stability.4-7
The malignant phenotype involves the roles of several biologic
traits in addition to growth control.8 For example, in
tumors arising in breast and prostate, invasion and metastasis are
associated with altered expression of molecules affecting tumor-stromal
and -endothelial interactions: matrix proteinases and proteinase
inhibitors, and the integrin receptors.9,10 In B-cell
lymphomagenesis, there is also evidence for host-tumor interactions
involving immune function either directly or through its action against
lymphomagenic microbial infection.11
To characterize host-tumor interaction in B-cell lymphomagenesis, our
laboratory previously established a murine model
system.12-14 The DAC cell line was generated from the
spontaneous in vitro outgrowth of splenic lymphocytes. Thus, DAC cells
were not selected for in vivo growth and generally failed to form
tumors in syngeneic immunocompetent mice. From the exceptional DAC
tumors that did occur, malignant variant sublines of DAC (termed MV)
were established with a highly tumorigenic phenotype. Both parent and
daughter cell lines harbored rearranged and activated forms of
c-myc, which presumably contributed to immortalization in
vitro. However, additional events must have occurred to account for the
tumorigenicity displayed by MV cells. We therefore hypothesized that MV
and DAC would be distinguished by differentially expressed genes that
either promoted or suppressed traits required in tumor formation.
In this study, we employed suppression subtractive hybridization (SSH)
to identify the differentially expressed genes in DAC and MV cells. We
isolated Emp2, a murine gene preferentially expressed in DAC
cells, and a member of the growth arrest specific 3 (GAS3) family.
Expression of Emp2 in the mouse is tissue restricted and is
generally absent in lymphoid cell types. Gene transfer of
EMP2 into MV cells inhibited tumor formation, indicating
that EMP2 acts as a functional tumor suppressor.
EMP2 gene transfer experiments demonstrated that
EMP2 rendered cells susceptible to cell death under stress
conditions. These findings implicate EMP2 as a new type of
gene capable of affecting tumorigenicity in B lymphoma.
Cell culture
Suppression subtractive hybridization
We isolated the full-length EMP2 cDNA from DAC1 cells by using the Marathon cDNA amplification kit (Clontech) according to the manufacturer's instructions. Two specific primers were designed, based on the sequence of a 246-base pair (bp) EMP2 fragment isolated from the subtracted DNA library. Polymerase chain reaction (PCR) was used to amplify the 5' and 3' termini of the cDNA that was then sequenced. Subsequently, the full-length cDNA was isolated by PCR. Analysis of RNA expression Total RNA was prepared by using an RNA purification kit (QIAGEN, Valencia, CA). Total RNA (10 µg) was fractionated by agarose-formaldehyde gel electrophoresis (1% agarose/formaldehyde). The RNA was transferred to a nylon membrane (Amersham-Pharmacia, Piscataway, NJ) by capillary action and cross-linked by UV irradiation (Stratalinker; Stratagene, San Diego, CA). The complete cDNA of EMP2 was used to generate a 32P-labeled probe using random primer synthesis (Amersham-Pharmacia). Membranes were pre-hybridized with Rapid-Hyb buffer (Amersham-Pharmacia) for 1 hour and then hybridized with labeled probe for 2 hours at 65°C. Blots were washed with a high stringency buffer (60°C, 0.1× sodium chloride/sodium citrate, and 0.5% sodium dodecyl sulfate [SDS]) and exposed to x-ray film. Murine tissue dot blots were obtained from Clontech and probed as above.For reverse transcriptase (RT)-PCR, total RNA was prepared using a RNA purification kit (QIAGEN, Valencia, CA). Resident peritoneal cells were isolated by peritoneal lavage as previously described16 and by flow cytometry; this population was 40% to 60% CD5+ B cells. RT-PCR was performed using One Step RT-PCR Beads (Amersham-Pharmacia). cDNA was prepared using 0.5 µg total RNA using a random poly(T)12-16 primer for 30 minutes at 42°C. The RT was inactivated at 95°C for 2 minutes at which point EMP2-specific primers were added. PCR was performed using 50 cycles as follows: denaturation for 30 seconds, annealing for 30 seconds, and extension for 1 minute. The primers used were EMP2 forward 185 (ATGTTGGTGATTCTTGCCTTC) and EMP2 reverse 699 (TTACGCTTCCTCAGGATCATGT). Hardy fraction B-cell subpopulations17 and flow cytometrically isolated native murine plasma cells18 were generously provided as mRNA extracts by Drs K. A. Dorshkind and M. G. McHeyzer-Williams, respectively. PCR was performed on the obtained cDNA as indicated above. EMP2 retrovirus expression vector The EMP2 open reading frame was constructed with the Flag peptide in frame at the 3' end using the following primers: CGGAATTCACTGCCCTGTGAACATGTTGG (Eco R1 and translational start underlined) and CCGGAATTCCACTTACTTGTCGTCATCGTCTTTGTAGTCTTTACGCTTCCTCAGGATCA (EcoRI and Flag peptide are underlined).The PCR products were EcoRI digested and subsequently cloned
into the retroviral expression vector pSR Glutathione-S-transferase-EMP2 fusion protein and anti-EMP2 polyclonal antibodies Rabbit antibodies were generated against the first extracellular region of the gene (from amino acid 16 to 64) constructed as a glutathione-S-transferase (GST)-EMP2 fusion protein. The EMP2 peptide was cloned by PCR using the following primers: CGCGGATCCTCTACCATTGACAATGCCTGG (forward; BamH1 underlined); CCGGAATTCTTACGCCTGCATCACAGAATAACC (reverse, EcoR1 underlined). The PCR product was directionally cloned into the BamHI and EcoRI sites of the pGEX-4T-1 vector that contains GST gene (Pharmacia). The EMP2 fragment was cloned in frame with the GST to create a fusion protein. The insert was confirmed by sequencing.The GST fusion protein was produced as previously
described.21 Bacteria in log phase (OD600 0.6 to 0.9) were induced for 2.5 to 3 hours at 37°C with 1 mM
isopropyl-1-thio- Western blot analysis Samples were normalized based on cell number and lysed by boiling for 5 minutes in Laemmli buffer (62.5 mM Tris-Cl, pH6.8, 10% glycerol, 2% SDS, 0.01% Bromophenol blue, 2% ME). The lysate was
separated on a 12% SDS-polyacrylamide gel and transferred to a
nitrocellulose membrane (Amersham Pharmacia). Membranes were stained
with Ponceau S (Sigma) to determine transfer efficiency. Membranes were
incubated with 5% low-fat milk in PBS containing 0.1% Tween-20. A
primary antibody (anti-Flag M2 mouse monoclonal antibody, 2 ng/µL
final concentration [Eastern Kodak] or anti-EMP2 rabbit serum,
1:10 000 dilution) was added and incubated for 1 hour. The membrane
was washed 3 times with PBS/Tween-20 and then incubated for 45 minutes
with a horseradish peroxidase-labeled secondary antibody (goat
anti-mouse immunoglobulin G [IgG] or goat anti-rabbit IgG, 1:2000
dilution; Jackson ImmunoResearch Laboratories, West Grove, PA).
Proteins were detected by chemiluminescence (Amersham Pharmacia).
Glycosylation treatment NIH3T3 cells were plated in 24-well plates. Two-fold serial dilutions of tunicamycin (0.15 to 10 µg/mL; Roche Molecular Biochemicals) were added to the cells the following day and incubated for 24 hours. Freshly diluted tunicamycin was then added again. Cells were harvested after an additional 4 hours for Western blot analysis. Alternatively, NIH3T3 cells and the B-cell lymphoma cell lines were lysed in Laemmli buffer and boiled as described above. Cell lysates were treated with PNGase (New England Biolabs) overnight at 37°C to remove all N-linked glycans as per manufacturer's instructions.Tumorigenicity and cell death analysis Exponentially growing MV cells infected with a vector control or with EMP2 were washed and resuspended in sterile PBS. Cells (5 × 105) were injected intraperitoneally into Balb/c mice (JAX Mice, Bar Harbor, ME) at 8 to 15 weeks of age. Animals were monitored daily for 2 months for signs of tumor development and morbidity. Mice were autopsied to confirm tumor formation.For cell death analysis, cells (1 × 105) were incubated in 24-well plates in 10% FCS medium. After 24 hours, cells were washed with serum-free medium 3 times. Medium containing 0.5% FCS was added to the cultures for 48 hours at 37°C; cell viability was determined by trypan blue exclusion. To determine the rate of apoptosis in NIH3T3 cells, cells were stained with annexin (Becton Dickinson Biosciences, Torrey Pines, CA) and propidium iodide. The cells were incubated at room temperature for 15 minutes and analyzed on a flow cytometer (Becton Dickinson Biosciences). Cells were harvested at 0, 20, or 40 hours after being placed in a low-serum environment. In some experiments, cells were prepared in media containing 0.5% FCS plus one of the following supplements: caspase inhibitor Z-VAD-FMK (30 µM; Enzyme Systems Products, Livermore, CA), caspase inhibitor Z-DEVD-FMK (30 µM; Pharmingen), or a dimethyl sulfoxide (DMSO)-negative control. Cells were incubated for 48 hours at 37°C and later harvested. Cell viability was quantitated using trypan blue exclusion.
Isolation of murine homologue of EMP2 in DAC B-cell line DAC1 and MV1 cells are parent and daughter cell lines distinguished by nontumorigenic and tumorigenic phenotypes, respectively. A molecular screen, SSH, was used to identify genes that may contribute to this phenotypic difference. Sequence analysis of the various clones was used to prioritize genes for further examination.22 The present study explores the role of one of the candidate genes from this panel. The full-length 915-nucleotide cDNA was amplified by rapid amplification of cDNA ends from a DAC cDNA library.23 The cDNA contained an open reading frame of 516 nucleotides, predicting a polypeptide of 172 amino acids with an estimated molecular weight of 20 kDa.A homology search by BLAST-P analysis showed that this clone had 100% amino acid identity with the murine Xmp gene24 and 78% amino acid identity with EMP2.25 Our analysis also includes 5' and 3'-untranslated sequences (184 and 214 nucleotides, respectively) not previously reported (GenBank accession no. pending). Accordingly, we construe the gene to be murine Emp2. EMP2 shared significant homology to other members of the murine GAS3 family26: murine Pmp22 (44%), Emp1 (44%), and Emp3 (39%) (data not shown). EMP2 exhibits a restricted tissue distribution The differential expression of EMP2 in DAC versus MV cells was confirmed by Northern analysis, showing that EMP2 mRNA was significantly down-regulated in MV cell (Figure 1A). We evaluated the expression of EMP2 in primary mouse tissues (Figure 1B,C). EMP2 mRNA was not detectable in spleen and thymus or in purified subpopulations of immature and mature B-cell populations (Hardy fractions of pre-B cells, splenic B cells, and plasma cells). However, it was expressed in peritoneal cells, a population highly enriched for the B1 subset of B lymphocytes. EMP2 was undetected in peritoneal macrophages, the other major component of this population (data not shown). EMP2 was most prominently expressed in murine lung, with intermediate expression in the uterus, eye, and prostate (Figure 1C).
Expression of EMP2 at the protein level To confirm that there was differential expression of EMP2 at the protein level between DAC and MV cells, an antibody against the first extracellular domain of EMP2 was generated using an EMP2-GST fusion protein. Polyclonal rabbit antisera verified that EMP2 is differentially expressed at the protein level (Figure 2A).
To further study the biological function of EMP2 protein in vitro, we
infected NIH3T3 cells with the pSR We postulated that the occurrence of multiple EMP2 bands was the result of glycosylation, as the protein contains 3 putative N-linked glycosylation sites. To assess this hypothesis, NIH3T3/EMP2 cells were treated with tunicamycin, an agent that interrupts an early stage in the assembly of N-linked oligosaccharides. NIH3T3/EMP2 cells treated with tunicamycin diminished their expression of the 3 major EMP2 bands and acquired a single 20-kDa protein by the anti-Flag antibody (Figure 2B, band IV). The size of this band is consistent with the predicted molecular weight of the minimally glycosylated 172-amino acid EMP2 protein. This finding indicates that EMP2 is glycosylated in vivo and that the EMP2 size heterogeneity is due to distinct EMP2 glycans. Overexpression of EMP2 suppresses tumor growth Using the retroviral EMP2 expression construct, we next sought to determine whether there was a causal relationship between elevated EMP2 expression and tumorigenicity in the B-cell lymphoma. EMP2MV cells were stably infected with the retrovirus bearing EMP2 or empty vector. Western analysis and anti-Flag antibody confirmed strong expression of recombinant EMP2 protein in infected cells (data not shown). Balb/c mice were injected intraperitoneally with 5 × 105 B-lymphoma cells and monitored for up to 50 days. Figure 3 demonstrates that recombinant restoration of EMP2 expression dramatically reduced tumor frequency in MV cells.
EMP2 promotes cell death in low serum The GAS3 family member PMP22 has been shown to induce cell death under low-serum conditions. To evaluate if the differential expression of EMP2 could also affect cell survival, viability of DAC and MV cells was determined using trypan blue exclusion under low-serum conditions. Indeed, DAC cell survival was reduced approximately 35% compared with MV cells in 0.5% FCS (Figure 4A).
This effect was further evaluated in NIH3T3 cells under the stress of low serum. Wild-type NIH3T3 cells (control vector infectants) are resistant to apoptosis in low serum.27 However, we observed striking cell death within 48 hours in NIH3T3/EMP2 cells. This phenotype was dose dependent: 100% cell death was observed with high EMP2, whereas there was only 55% and 4% cell death with intermediate and endogenous EMP2 levels, respectively (Figure 4B). Two independent methods were employed to verify that these cells
underwent programmed cell death. First, NIH3T3/EMP2 cells were
evaluated by flow cytometry with annexin V and propidium iodide (Figure
5A). After 20 hours, annexin V expression
was increased more than 8-fold in these EMP2 versus vector control
cells (16% and 1.5%, respectively). Increased total cell death
(propidium iodide, annexin V++ cells) was also observed and
predominated by 48 hours (41% and 4% double-positive cells,
respectively). Second, serum-deprivation apoptosis in fibroblasts is a
caspase-dependent process.27,28 Two caspase inhibitors
Z-VAD-FMK and Z-DEVD-FMK completely protected NIH3T3/EMP2 from serum
deprivation cell death (Figure 5B).
In this study, we report the isolation by SSH of a murine gene that appears to play a role in the malignant progression of the DAC B-lymphoma cell line. Expression of EMP2 was down-regulated in the fully malignant DAC subline, MV, at both the mRNA and protein levels. Recombinant reintroduction of EMP2 into MV cells reversed their tumorigenicity, suggesting that EMP2 acted as a tumor suppressor. EMP2 had a restricted tissue distribution in mice and was not expressed in most lymphoid cell types. In vitro, EMP2 overexpression resulted in a serum deprivation cell-death phenotype. Here, we discuss these findings and their possible functional relationship. EMP2 belongs to the GAS3 family of tetraspan proteins. All of the family members have similar primary and secondary structures, with 4 relatively conserved transmembrane regions and 2 significant extracellular loops.29,30 Although the endogenous functions of this family remain enigmatic, on disruption, many of the genes yield dramatic phenotypes. For example, EMP1 was initially isolated as a gene expressed in brain tumors but not in normal brain.31 PMP22, another GAS3 family member, has gained attention in recent years as alternations in PMP22 expression have been linked to human demyelinating heredity neuropathies, including Charcot-Marie Tooth-1A, hereditary neuropathy (with liability to) pressure palsies, and Dejerine Sottas syndrome, as well as the Trembler phenotype in mice.32-34 To our knowledge, this study provides the first experimental evidence for the role of a GAS3 family protein as a tumor suppressor. EMP2 exhibited a discrete tissue distribution that is consistent with that reported for human EMP2.25 The highest expression was observed in the lung, and EMP2 was also expressed throughout the female reproductive system, with expression in both the uterus and the ovary. In our laboratory, EMP2 was originally isolated from the DAC CD5+ B-cell line. CD5+ B cells (and related members of the B1 subset of B cells) are the predominant cell type in the peritoneal cavity, where they represent 30% to 60% of the total cells.35,36 Correspondingly, EMP2 expression was detected in B1 cells isolated from a peritoneal lavage but was not detected in major lymphoid tissues or in fractionated Hardy fraction or plasma cell-stage B cells. What biochemical functions are performed in these cell types by the GAS3 family? As previously noted, no studies have yet established the roles played by this protein family. The tetraspan superfamily includes the connexins, tetraspanins, and GAS3 families. Connexins are the central components of gap junctions, through their formation of hexameric membrane pores with distinctive intercellular-docking properties and regulated permeabilities.37 In this context, it is notable that certain connexins, notably CX32, are close structural homologues and display missense phenocopies of PMP22.34 Because connexons can form with heteromeric connexin subunits, it is conceivable that GAS3 family members may be included in the formation of connexons with distinctive properties. Alternatively, GAS3 proteins may have properties analogous to tetraspanins. Interestingly, many of the 4 transmembrane proteins, such as CD9, CD63, and CD82, were first cloned in screens relating to tumorigenesis, including correlative and experimental evidence for tumor suppressor phenotypes.38-41 Although the mechanistic basis for this relationship is unresolved, several tetraspanins have been shown to selectively associate with various integrin isoforms.39,42-45 Integrins are critical mediators of diverse cell functions, including cytoskeleton organization, cell growth, gene expression, survival, and migration. Accordingly, integrin function has been intensively studied for its roles in carcinogenesis and malignant progression,9,46 including a tumor suppressor phenotype for certain isoforms.47 The present study indicates that EMP2 modifies cell survival under serum deprivation conditions, as observed with altered expression or ligation of certain integrins.46 Overexpression of the related GAS3 protein, PMP22, also induces apoptosis of NIH3T3 cells in low serum.32 The mechanism of apoptosis in the PMP22 study has not been defined. In the present study, reversal of cell death by peptide inhibitors suggests that cell death involves a caspase-related pathway. This effect may be interpreted in 2 different contexts. First, ectopically expressed EMP2 may aberrantly act as a caspase inducer. Second, EMP2 under normal conditions may participate in a physiologic apoptotic growth regulatory pathway. We speculate that EMP2 acts in the latter fashion, facilitating signaling by integrin isoforms responsible for growth regulation by distal caspase activation. Validation of this idea will require further delineation of EMP2-integrin interaction, and the reciprocal action of subnormal EMP2 expression. Indeed, if EMP2 is an authentic tumor suppressor, formal demonstration will entail the observation of augmented lymphomagenesis in EMP2-deficient mice. CD5+ B cells are implicated in the pathogenesis of
chronic lymphocytic leukemia and certain autoimmune
diseases.35 Interestingly, the CD5+ population
of B cells has been found to be more susceptible to apoptosis than the
CD5
We thank Drs K. A. Dorshkind and M. G. McHeyzer-Williams for gifts of fractionated B-cell populations.
Submitted January 8, 2000; accepted February 9, 2001.
Supported by National Institutes of Health grants AI38545 and CA12800; the Lymphoma Research Foundation of America; the Jonsson Comprehensive Cancer Center; the Gustavus and Louise Pfeiffer Research Foundation; the John Lloyd Research Award; and a UCLA Dissertation Year Fellowship.
C.-X. W. and M. W. contributed equally to the study.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jonathan Braun, Dept of Pathology and Laboratory Medicine, UCLA School of Medicine, CHS 13-222, 10833 Le Conte Ave, Los Angeles, CA 90095-1732; e-mail: jbraun{at}mednet.ucla.edu.
1.
Jaffe ES, Harris NL, Diebold J, Muller-Hermelink HK.
World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues
2.
Kuppers R, Klein U, Hansmann M-L, Rajewsky K.
Cellular origin of human B-cell lymphomas.
N Engl J Med.
1999;341:1520-1529 3. Stevenson GT, Cragg MS. Molecular markers of B-cell lymphoma. Semin Cancer Biol. 1999;9:139-147[CrossRef][Medline] [Order article via Infotrieve]. 4. Jacobs JJL, Kieboom K, Marino S, DePinho RA, van Lohuizen M. The oncogene and polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature. 1999;397:164-168[CrossRef][Medline] [Order article via Infotrieve]. 5. Scheijen B, Jonkers J, Acton D, Berns A. Characterization of pal-1, a common proviral insertion site in murine leukemia virus-induced lymphomas of c-myc and Pim-1 transgenic mice. J Virol. 1997;71:9-16[Abstract]. 6. Blyth K, Terry A, O'Hara M, et al. Synergy between a human c-myc transgene and p53 null genotype in murine thymic lymphomas: contrasting effects of homozygous and heterozygous p53 loss. Oncogene. 1995;10:1717-1723[Medline] [Order article via Infotrieve].
7.
Felsher DW, Bishop JM.
Transient excess of MYC activity can elicit genomic instability and tumorigenesis.
Proc Natl Acad Sci U S A.
1999;96:3940-3944 8. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57-70[CrossRef][Medline] [Order article via Infotrieve]. 9. Keely P, Parise L, Juliano R. Integrins and GTPases in tumour cell growth, motility and invasion. Trends Cell Biol. 1998;8:101-106[CrossRef][Medline] [Order article via Infotrieve]. 10. Bergers G, Coussens LM. Extrinsic regulators of epithelial tumor progression: metalloproteinases. Curr Opin Genet Dev. 2000;10:120-127[CrossRef][Medline] [Order article via Infotrieve]. 11. Knowles DM, Chamulak GA, Subar M, et al. Lymphoid neoplasia associated with the acquired immunodeficiency syndrome (AIDS). Ann Int Med. 1988;108:744-753.
12.
Felsher DW, Rhim SH, Braun J.
A murine model for B-cell lymphomagenesis in immunocompromised hosts: natural killer cells are an important component of host resistance to premalignant B-cell lines.
Cancer Res.
1990;50:7050-7056
13.
Felsher DW, Denis KA, Weiss D, Ando DT, Braun J.
A murine model for B-cell lymphomagenesis in immunocompromised hosts: c-myc-rearranged B-cell lines with a premalignant phenotype.
Cancer Res.
1990;50:7042-7049 14. Felsher DW, Ando D, Braun J. Independent lambda light chain rearrangement in tissue culture-derived murine B cell lines. Int Immunol. 1991;3:171-178.
15.
Diatchenko L, Lau YF, Campbell AP, et al.
Suppression subtractive hybridization. A method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc Natl Acad Sci U S A.
1996;93:6025-6030 16. Goodglick L, Felsher DW, Neshat MS, Braun J. A novel octamer regulatory element in the VH11 leader exon of B-1 cells. J Immunol. 1995;154:4546-4556[Abstract]. 17. Li YS, Wasserman R, Hayakawa K, Hardy RR. Identification of the earliest B lineage stage in mouse bone marrow. Immunity. 1996;5:527-535[CrossRef][Medline] [Order article via Infotrieve]. 18. McHeyzer-Williams MG, Ahmed R. B cell memory and the long-lived plasma cell. Curr Opin Immunol. 1999;11:172-179[CrossRef][Medline] [Order article via Infotrieve].
19.
Takebe Y, Seiki M, Fujisawa J, et al.
SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol Cell Biol.
1988;8:466-472
20.
Landau NR, Littman DR.
Packaging system for rapid production of moloney leukemia virus vectors of variable tropism.
J Virol.
1992;66:5110-5113 21. Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli with glutathione S-transferase. Gene. 1988;67:31-40[CrossRef][Medline] [Order article via Infotrieve].
22.
Wang C-X, Fisk BC, Wadehra M, Su H, Braun J.
Overexpression of murine fizzy-related (fzr) increases natural killer cell-mediated cell death and suppresses tumor growth.
Blood.
2000;96:259-263 23. Chenchik A, Diachenko L, Mogadam F, Tarabykin V, Lukyanov S, Siebert PD. Full-length cDNA cloning and determination of mRNA 5' and 3' ends by amplification of adaptor-ligated cDNA. BioTechniques. 1996;21:526-534[Medline] [Order article via Infotrieve]. 24. Ben-Porath I, Kozak CA, Benvenisty N. Chromosomal mapping of TMP (EMP1), Xmp (Emp2), and Ymp (Emp3) genes encoding membrane proteins related to Pmp22. Genomics. 1998;49:443-447[CrossRef][Medline] [Order article via Infotrieve]. 25. Taylor V, Suter U. Epithelial membrane protein-2 and epithelial membrane protein-3. Two novel members of the peripheral myelin protein 22 gene family. Gene. 1996;175:115-120[CrossRef][Medline] [Order article via Infotrieve].
26.
Manfioletti G, Ruaro ME, Del Sal G, Philipson L, Schneider C.
A growth arrest-specific (gas) gene codes for a membrane protein.
Mol Cell Biol.
1990;10:2924-2930 27. Evan GI, Wyllie AH, Gilbert CS, et al. Induction of apoptosis in fibroblasts by c-myc protein. Cell. 1992;69:119-128[CrossRef][Medline] [Order article via Infotrieve].
28.
Hueber A-O, Zornig M, Lyon D, Suda T, Nagata S, Evan GI.
Requirement for the CD95 receptor-ligand pathway in c-myc-induced apoptosis.
Science.
1997;278:1305-1309
29.
Taylor V, Welcher AA, Program AE, Suter U.
Epithelial membrane protein-1, peripheral myelin protein 22, and lens membrane protein 20 define a novel gene family.
J Biol Chem.
1995;270:28824-28833
30.
D'Urso D, Prior R, Greiner-Petter R, Gabreels-Festen AAWM, Muller HW.
Overloaded endoplasmic reticulum-golgi compartments, a possible pathomechanism of peripheral neuropathies caused by mutations of the peripheral myelin protein PMP22.
J Neurosci.
1998;18:731-740 31. Ben-Porath I, Benvenisty N. Characterization of a tumor-associated gene, a member of a novel family of genes encoding membrane glycoproteins. Gene. 1996;183:69-75[CrossRef][Medline] [Order article via Infotrieve].
32.
Fabbretti E, Edomi P, Brancolini C, Schneider C.
Apoptotic phenotype induced by overexpression of wild-type gas3/pmp22: its relation to the demyelinating peripheral neuropathy CMT1A.
Genes Dev.
1995;9:1846-1856
33.
Tobler AR, Notterpek L, Naef R, Taylor V, Suter U, Shooter EM.
Transport of Trembler-J mutant peripheral myelin protein 22 is blocked in the intermediate compartment and affects the transport of the wild-type protein by direct interaction.
J Neurosci.
1999;19:2027-2036 34. Suter U, Snipes GJ. Biology and genetics of hereditary motor and sensory neuropathies. Annu Rev Neurosci. 1995;18:45-75[CrossRef][Medline] [Order article via Infotrieve]. 35. Lydyard PM, Jewell AP, Jamin C, Youinou PY. CD5 B cells and B-cell malignancies. Curr Opin Hematol. 1999;6:30-36[CrossRef][Medline] [Order article via Infotrieve]. 36. Hayakawa K, Hardy RR. Development and function of B-1 cells. Curr Opin Immunol. 2000;12:346-353[CrossRef][Medline] [Order article via Infotrieve]. 37. Perkins G, Goodenough D, Sosinsky G. Three-dimensional structure of the gap junction connexon. Biophys J. 1997;72:533-544[Medline] [Order article via Infotrieve].
38.
Dong JT, Lamb PW, Rinker-Schaeffer CW, et al.
KAI1, a metastasis suppressor gene for prostate cancer on human chromosome 11p11.2.
Science.
1995;268:884-886 39. Jankowski SA, Mitchell DS, Smith SH, Trent JM, Meltzer PS. SAS, a gene amplified in human sarcomas, encodes a new member of the transmembrane 4 superfamily of proteins. Oncogene. 1994;9:1205-1211[Medline] [Order article via Infotrieve].
40.
Marken JS, Schieven GL, Hellstrom I, Hellstrom KE, Aruffo A.
Cloning and expression of the tumor-associated antigen L6.
Proc Natl Acad Sci U S A.
1992;89:3503-3507
41.
Szala S, Kasai Y, Steplewski Z, Rodeck U, Koprowski H, Linnenbach AJ.
Molecular cloning of cDNA for the human tumor-associated antigen CO-029 and identification of related transmembrane antigens.
Proc Natl Acad Sci U S A.
1990;87:6833-6837 42. Levy S, Todd SC, Maecker HT. CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu Rev Immunol. 1998;16:89-109[CrossRef][Medline] [Order article via Infotrieve]. 43. Lagaudriere-Gesbert C, Le Naour F, Lebel-Binay S, et al. Functional analysis of four tetraspans, CD9, CD53, CD81, and CD82, suggests a common role in costimulation, cell adhesion, and migration: only CD9 upregulates HB-EGF activity. Cell Immunol. 1997;182:105-112[CrossRef][Medline] [Order article via Infotrieve].
44.
Sugiura T, Berditchevski F.
Function of alpha3beta1-tetraspanin protein complexes in tumor cell invasion. Evidence for the role of the complexes in production of matrix metalloproteinase 2 (MMP-2).
J Cell Biol.
1999;146:1375-1389
45.
Yanez-Mo M, Alfranca A, Cabanas C, et al.
Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and CD151/PETA-3 with alpha3beta1 integrin localized at endothelial lateral junctions.
J Cell Biol.
1998;141:791-804 46. Dedhar S. Cell-substrate interactions and signaling through ILK. Curr Opin Cell Biol. 2000;12:250-256[CrossRef][Medline] [Order article via Infotrieve]. 47. Fornaro M, Tallini G, Zheng DQ, Flanagan WM, Manzotti M, Languino LR. p27(kip1) acts as a downstream effector of and is coexpressed with the beta1C integrin in prostatic adenocarcinoma. J Clin Invest. 1999;103:321-329[Medline] [Order article via Infotrieve]. 48. Pers JO, Jamin C, Le Corre R, Lydyard PM, Youinou P. Ligation of CD5 on resting B cells, but not on resting T cells, results in apoptosis. Eur J Immunol. 1998;28:4170-4176[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S. A. Morales, S. Mareninov, M. Wadehra, L. Zhang, L. Goodglick, J. Braun, and L. K. Gordon FAK Activation and the Role of Epithelial Membrane Protein 2 (EMP2) in Collagen Gel Contraction Invest. Ophthalmol. Vis. Sci., January 1, 2009; 50(1): 462 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shimazaki, E. J. Lepin, B. Wei, A. K. Nagy, C. P. Coulam, S. Mareninov, M. Fu, A. M. Wu, J. D. Marks, J. Braun, et al. Diabodies Targeting Epithelial Membrane Protein 2 Reduce Tumorigenicity of Human Endometrial Cancer Cell Lines Clin. Cancer Res., November 15, 2008; 14(22): 7367 - 7377. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Forbes, M. Wadehra, S. Mareninov, S. Morales, K. Shimazaki, L. K. Gordon, and J. Braun The Tetraspan Protein EMP2 Regulates Expression of Caveolin-1 J. Biol. Chem., September 7, 2007; 282(36): 26542 - 26551. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, J. Kleeff, I. Esposito, H. Kayed, K. Felix, T. Giese, M. W. Buchler, and H. Friess Expression Analysis of PMP22/Gas3 in Premalignant and Malignant Pancreatic Lesions J. Histochem. Cytochem., July 1, 2005; 53(7): 885 - 893. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dahlin, E. M. Mager, L. Allen, Z. Tigue, L. Goodglick, M. Wadehra, and L. Dobbs Identification of Genes Differentially Expressed in Rat Alveolar Type I Cells Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 309 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wadehra, L. Goodglick, and J. Braun The Tetraspan Protein EMP2 Modulates the Surface Expression of Caveolins and Glycosylphosphatidyl Inositol-linked Proteins Mol. Biol. Cell, May 1, 2004; 15(5): 2073 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alaminos, J. Mora, N.-K. V. Cheung, A. Smith, J. Qin, L. Chen, and W. L. Gerald Genome-wide Analysis of Gene Expression Associated with MYCN in Human Neuroblastoma Cancer Res., August 1, 2003; 63(15): 4538 - 4546. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wadehra, R. Iyer, L. Goodglick, and J. Braun The Tetraspan Protein Epithelial Membrane Protein-2 Interacts with beta 1 Integrins and Regulates Adhesion J. Biol. Chem., October 18, 2002; 277(43): 41094 - 41100. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Wilson, S. A. Wilson, A. Surprenant, and R. A. North Epithelial Membrane Proteins Induce Membrane Blebbing and Interact with the P2X7 Receptor C Terminus J. Biol. Chem., September 6, 2002; 277(37): 34017 - 34023. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nagarajan, N. Le, H. Mahoney, T. Araki, and J. Milbrandt Deciphering peripheral nerve myelination by using Schwann cell expression profiling PNAS, June 25, 2002; 99(13): 8998 - 9003. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||