Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carter, T. L.
Right arrow Articles by Kees, U. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carter, T. L.
Right arrow Articles by Kees, U. R.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Brief Reports
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 January 2001, Vol. 97, No. 2, pp. 572-574

BRIEF REPORT

Hemizygous p16INK4A deletion in pediatric acute lymphoblastic leukemia predicts independent risk of relapse

Tina L. Carter, Paul M. Watt, Rolee Kumar, Paul R. Burton, Gregory H. Reaman, Harland N. Sather, David L. Baker, and Ursula R. Kees

From the Division of Children's Leukaemia and Cancer Research and the Division of Biostatistics and Genetic Epidemiology, TVWT Institute for Child Health Research, Centre for Child Health Research, Faculty of Medicine and Dentistry, University of Western Australia; the Department of Haematology-Oncology, Princess Margaret Hospital, Perth, Australia; the Children's National Medical Center, The George Washington University, Washington, DC; the Children's Cancer Group, Arcadia, CA; and the Genetic Epidemiology Unit, Department of Epidemiology and Public Health, University of Leicester, Leicester, United Kingdom.


    Abstract
Top
Abstract
Introduction
Study design
Results and discussion
References

The genes at the INK4A/ARF locus at 9p21 are frequently involved in human cancer. Virtually all p16INK4A exon 2 (henceforth called p16) inactivation in pediatric acute lymphoblastic leukemia (ALL) occurs by gene deletion. The results of this study illustrate that real-time quantitative polymerase chain reaction is capable of detecting gene deletion in primary patient specimens with a precision not previously achieved by conventional methods. Importantly, this assay includes the detection of hemizygous deletions. The study revealed, strikingly, that the risk ratio for relapse for hemizygous deletion compared with no deletion was 6.558 (P = .00687) and for homozygous deletion was 11.558 (P = .000539). These results confirm and extend the authors' previous findings that homozygous deletion of p16 in pediatric ALL patients is an independent prognostic indicator of outcome from therapy. (Blood. 2001;97:572-574)

© 2001 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Study design
Results and discussion
References

The assessment of deletion of certain genes requires the detection of hemizygosity in primary patient specimens contaminated with normal cells. Meeting this challenge in cancer screening is becoming increasingly critical with the recent identification of several tumor suppressor genes that are haplo-insufficient rather than classically recessive.1 The genes at the INK4A/ARF locus2 act as tumor suppressors via 2 proteins, p16INK4A and p14ARF (p19ARF in the mouse), while the role of p15 in leukemogenesis remains unresolved. The p16INK4A is a cyclin-dependent kinase inhibitor that acts upstream of the retinoblastoma (RB) protein to control cell cycle arrest.3 The p19ARF is translated in an alternative reading frame from p16INK4A and activates p53 by interfering with its negative regulator, MDM2.4 Hence, mutations at the INK4A/ARF locus can disrupt both the RB1 and the p53 tumor suppressor pathways.3,4 Essentially all p16INK4A inactivation in pediatric acute lymphoblastic leukemia (ALL) occurs by gene deletion (reviewed in Kees et al5 and Drexler6). The evidence for an independent prognostic role of p16INK4A, exon 2 (henceforth called p16) deletion in pediatric ALL, is inconclusive (reviewed in Drexler6 and Tsihlias et al7). All of these studies were based on detecting p16 deletion by either Southern blotting or conventional polymerase chain reaction (PCR) analysis. Bone marrow specimens from leukemia patients at diagnosis invariably contain some normal cells that cause problems with accurate quantitation of deletion of any gene. This prompted us to examine whether gene deletions can be detected by real-time quantitative PCR and whether p16 zygosity presents a simple and reliable test for leukemia prognosis.


    Study design
Top
Abstract
Introduction
Study design
Results and discussion
References

Patients

Diagnosis bone marrow specimens were studied from 45 ALL patients, on the basis of the availability of cryopreserved specimens (Table 1). The Princess Margaret Hospital, Perth, Australia, provided 30 patients, and the Children's National Medical Center, Washington, DC, provided 15. There was no selection on the basis of either p16 genotype or time-to-relapse. Informed consent was obtained from all patients or their guardians to use specimens for research. Specimens were collected between 1981 and 1997. The leukemia immunophenotype (B-lineage or T-cell ALL) was determined with the use of a panel of monoclonal antibodies.5 Cytogenetic results revealed that none of the patients were known to have either t(4;11) or t(9;22). For all but 2 patients studied, therapy was administered according to risk-adjusted protocols of the Children's Cancer Group,8 most of which were based upon modifications of the Berlin-Frankfurt-Munster trials; the exception consisted of 2 patients treated on a previously reported intensive therapy protocol for high-risk patients.8

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics and p16 status of study group

Real-time PCR analysis in multiplex format

Genomic DNA was isolated from cryopreserved specimens and control cell lines by standard methodology.5 All primers and probes were designed by means of Perkin-Elmer Primer Express software (Perkin-Elmer, Foster City, CA), and primers were supplied by Geneworks (Adelaide, Australia). The sequences were as follows: p16 exon 2 forward (F): ggctctacacaagcttcctttcc; p16 exon 2 reverse (R): tcatgacctgccagagagaaca; beta -actin F: agcgcggctacagcttca; and beta -actin R: cgtagcacagcttctccttaatgtc. The probe for p16 had the sequence cccccaccctggctctgacca and was labeled with FAM, whereas the probe for beta -actin, atttcccgctcggccgtggt, was labeled with VIC (both probes manufactured by Perkin-Elmer). The reactions were optimized first individually and then for multiplexing. The reaction was performed in a final volume of 50 µL. The final concentrations of primers and probes were as follows: p16 F 50 ng/µL, p16 R 50 ng/µL, p16 probe 200 nM, beta -actin F 50 ng/µL, beta -actin R 200 ng/µL, and beta -actin probe 200 nM. Each reaction contained 50 ng DNA as template, and the Taqman Universal Master Mix (Perkin-Elmer) was used. The standard thermal cycling conditions of the ABI PRISM 7700 Sequence Detection instrument were applied. A standard calibration curve was included with each experiment with the use of a range of concentrations of DNA extracted from Raji B cells (range, 1.56-100 ng DNA).

P16 gene deletion analysis in specimens containing normal cells

We simulated normal cell contamination by using mixtures of DNA from Raji B cells, which are wild type for p16 (G/G), and K562 cells, which show homozygous deletion of p16 (D/D). The experimentally determined ratio for p16/beta -actin was expressed as a function of the input ratio of Raji B/K562 cells. The test yielded a linear graph with a correlation coefficient of 0.9687, indicating that normal cell contamination (here simulated by Raji B cells) in a p16 D/D sample can be accurately measured by this technique. On the basis of this result, the bone marrow specimens were interpreted as follows. Ratio for p16/beta -actin less than 0.4: p16 deletion (D/D); ratio 0.4 to 0.8: hemizygous p16 (G/D); ratio exceeding 0.8: germline p16 (G/G). The method was compared with Southern blot analysis, and the 2 methods agreed in all 11 cases tested, including G/D specimens. All but one of the 45 specimens contained fewer than 25% normal cells, according to an independent review by a hematologist, and the experimentally determined ratio for p16/beta -actin was used to determine the genotype directly. The remaining specimen contained more than 50% normal cells, a factor that was taken into account.

Statistical analysis

The main analysis was based on methods appropriate for censored failure times. The primary time scale was calendar time from diagnosis; the primary response was relapse. Univariate analysis was based upon Kaplan-Meier survival functions9 and the Mantel-Cox (log-rank) test statistic.9 Multivariate analysis was based on the Cox proportional hazards regression model9 and the likelihood-ratio test.10 Covariates known to modulate the risk of relapse were included in the primary model whether they were statistically significant or not. Secondary modeling demonstrated that removal of the nonsignificant covariates did not modify substantive conclusions. Final models were subjected to (and passed) standard tests of goodness of fit.10 Analysis was undertaken in SAS version 6.12 (Cary, NC) for Unix.


    Results and discussion
Top
Abstract
Introduction
Study design
Results and discussion
References

Deletion analysis of p16 was performed on 45 pediatric ALL patients at diagnosis, and the results are summarized in Table 1. Of the 45 patients, 11 (25%) demonstrated a homozygous deletion; 6 (13%) were hemizygous; and 28 (62%) were wild type for the p16 gene. In a previous study using Southern blot analysis performed in this laboratory, the incidence of homozygous p16 deletions at diagnosis was 18.3% (9/48).5 These findings for homozygous deletions are in agreement with the frequency of homozygous deletion reported for pediatric ALL patients: 23% for B-lineage and 64% for T-lineage ALL (T-ALL) (reviewed by Drexler6). The combined frequency for hemizygous and homozygous deletions determined here is 38%. When the distribution of T-ALL versus B-lineage ALL cases in our study is taken into account, the observed frequency is higher than expected, most likely owing to the higher sensitivity of the PCR technique.

Hemizygous and homozygous p16 deletions are independent prognostic indicators for poor outcome

Figure 1 illustrates the Kaplan-Meier curves for relapse-free survival stratified by p16 status. Among those patients who were "censored" (ie, had not relapsed at the end of follow-up), the minimum follow-up time was 3 years, and all but 3 such patients were followed for at least 8 years. With the use of the log-rank test for any differences between the 3 groups, the P value was .0021. Multivariate analysis was performed by means of Cox proportional hazards regression, including the known risk factors for pediatric ALL patients: gender, immunophenotype, age, and white cell count at diagnosis. When we adjusted simultaneously for the influence of these risk factors, both hemizygous and homozygous deletions remained highly statistically significant predictors of poor outcome; compared with G/G patients, the risk ratio was 11.558 (P = .000539) for patients with homozygous deletions and 6.558 (P = .00687) for hemizygous deletions (Table 2). This comprehensive adjustment for potential confounding variables showed that any p16 deletion (D/D or G/D) is a major independent risk factor for relapse. These results confirm and extend previous findings from our laboratory and others5,11 regarding the prognostic significance of p16 deletion in pediatric ALL patients. Of the patients in this analysis, 11 were also included in our earlier study.5 If these are excluded, the estimated adjusted-risk ratios for G/D versus G/G and D/D versus G/G are 5.325 (P = .0462) and 9.856 (P = .0027), respectively. This represents a completely independent test of the hypothesis that the p16 deletion is associated with prognosis in childhood ALL. Nevertheless, a prospective study on a larger number of uniformly treated patients should be conducted to confirm the prognostic significance of the p16 deletion, and such a study should include a test for loss of p14.


View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Kaplan-Meier survivor function. Kaplan-Meier survivor function for G/G (_ . _ . _ . _ .), G/D (· · · · ·) and D/D (----) patients.


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Hemizygous and homozygous p16 deletions are independent prognostic indicators for poor outcome

Hemizygous status as determined in this study could be due to a mixture of leukemia cells (D/D, G/D, and G/G) or true hemizygosity in all leukemia cells. Owing to lack of material, it was not possible to study the G/D specimens by means of the fluorescence in situ hybridization technique. However, the clonality could be assessed by analyzing the rearrangement of the T-cell receptor and immunoglobulin heavy chain genes.12,13 Examination of the 5 G/D specimens from patients who relapsed revealed that in 3 cases there was clear evidence for clonal disease as only one rearranged band was detected whereas the 2 remaining cases showed 2 bands suggesting biclonal disease (data not shown). This test does not exclude the possibility that leukemia cells in these specimens were also hemizygous for p16. Clearly, 3 patients were diagnosed with a monoclonal disease showing hemizygous deletion of p16, excluding the potential for false hemizygous readout due to a mixture of G/G with D/D leukemic cells in the specimens.

In the current study, we identify hemizygous and homozygous loss of p16 as a major independent negative prognostic indicator in pediatric ALL. These results are consistent with the reported general sensitivity of pediatric ALL to current chemotherapy. Unlike the majority of good-prognosis pediatric ALL patients, who appear to have an intact apoptosis pathway, the subpopulation that is refractory to treatment with apoptosis-inducing drugs may have bypassed normal regulation by mutation of key regulators such as p16.14 Independent evidence that INK4A/ARF mutations promote resistance to chemotherapeutic drugs has recently been reported in a transgenic lymphoma model.15 The findings from this animal model provide direct evidence that mutations at the INK4A/ARF locus have a negative impact on the outcome of cancer therapy. The quantitative PCR method used in our study is suitable for high-throughput screening of patient specimens and has many clinical applications as it can be adapted to the deletion analysis of other tumor suppressor genes and other cancers.


    Footnotes

Submitted May 22, 2000; accepted September 15, 2000.

Supported by the Children's Leukaemia and Cancer Research Foundation, Western Australia; the National Childhood Cancer Foundation; and the Children's Cancer Group, Arcadia, CA.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Ursula R. Kees, Division of Children's Leukaemia and Cancer Research, TVWT Institute for Child Health Research, PO Box 855, West Perth WA 6872, Australia; e-mail: ursula{at}ichr.uwa.edu.au.


    References
Top
Abstract
Introduction
Study design
Results and discussion
References

1. Cook W, McCaw B. Accommodating haploinsufficient tumour suppressor genes in Knudson's model. Oncogene. 2000;19:3434-3438[CrossRef][Medline] [Order article via Infotrieve].

2. Cairns P, Polascik TJ, Eby Y, et al. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat Genet. 1995;11:210-212[CrossRef][Medline] [Order article via Infotrieve].

3. Roussel MF. The INK4 family of cell cycle inhibitors in cancer. Oncogene. 1999;18:5311-5317[CrossRef][Medline] [Order article via Infotrieve].

4. Sharpless NE, DePinho RA. The INK4A/ARF locus and its two gene products. Curr Opin Genet Dev. 1999;9:22-30[CrossRef][Medline] [Order article via Infotrieve].

5. Kees UR, Burton PR, Lu C, Baker DL. Homozygous deletion of the p16/MTS1 gene in pediatric acute lymphoblastic leukemia is associated with unfavorable clinical outcome. Blood. 1997;89:4161-4166[Abstract/Free Full Text].

6. Drexler HG. Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells. Leukemia. 1998;12:845-859[CrossRef][Medline] [Order article via Infotrieve].

7. Tsihlias J, Kapusta L, Slingerland J. The prognostic significance of altered cyclin-dependent kinase inhibitors in human cancer. Annu Rev Med. 1999;50:401-423[CrossRef][Medline] [Order article via Infotrieve].

8. Gaynon PS, Bostrom BC, Reaman GH, et al. Children's Cancer Group (CCG) Initiatives in Childhood Acute Lymphoblastic Leukemia. Int J Pediatr Hematol Oncol. 1998;5:99-114.

9. Kalbfleisch JD, Prentice RL. The Statistical Analysis of Failure Time Data. New York, NY: John Wiley; 1980.

10. McCullagh P, Nelder JA. Generalized Linear Models. London United Kingdom: Chapman and Hall; 1983.

11. Heyman M, Rasool O, Borgonovo Brandter L, et al. Prognostic importance of p15INK4B and p16INK4 gene inactivation in childhood acute lymphocytic leukemia. J Clin Oncol. 1996;14:1512-1520[Abstract/Free Full Text].

12. Yamada M, Hudson S, Tournay O, et al. Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDR-III)-specific probes. Proc Natl Acad Sci U S A. 1989;86:5123-5127[Abstract/Free Full Text].

13. Veelken H, Tycko B, Sklar J. Sensitive detection of clonal antigen receptor gene rearrangements for the diagnosis and monitoring of lymphoid neoplasms by a polymerase chain reaction-mediated ribonuclease protection assay. Blood. 1991;78:1318-1326[Abstract/Free Full Text].

14. Greaves M. Molecular genetics, natural history and the demise of childhood leukaemia. Eur J Cancer. 1999;35:1941-1953.

15. Schmitt CA, McCurrach ME, de Stanchina E, Wallace-Brodeur RR, Lowe SW. INK4a/ARF mutations accelerate lymphomagenesis and promote chemoresistance by disabling p53. Genes Dev. 1999;13:2670-2677[Abstract/Free Full Text].

© 2001 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Letter in Blood Online:

Prognostic value of p16INK4a gene deletions in pediatric acute lymphoblastic leukemia
Hagen Graf Einsiedel, Tillmann Taube, Reinhard Hartmann, Cornelia Eckert, Georg Seifert, Sven Wellmann, Günter Henze, Karl Seeger, Ursula R. Kees, Tina L. Carter, Paul M. Watt, Rolee Kumar, David L. Baker, Gregory H. Reaman, Harland N. Sather, and Paul R. Burton
Blood 2001 97: 4002-4004. [Full Text] [PDF]



This article has been cited by other articles:


Home page
BloodHome page
S. Sulong, A. V. Moorman, J. A. E. Irving, J. C. Strefford, Z. J. Konn, M. C. Case, L. Minto, K. E. Barber, H. Parker, S. L. Wright, et al.
A comprehensive analysis of the CDKN2A gene in childhood acute lymphoblastic leukemia reveals genomic deletion, copy number neutral loss of heterozygosity, and association with specific cytogenetic subgroups
Blood, January 1, 2009; 113(1): 100 - 107.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles
Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype
Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
Section on Hematology/Oncology
Guidelines for Pediatric Cancer Centers
Pediatrics, June 1, 2004; 113(6): 1833 - 1835.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Li, C. M. Weghorst, M. Tsutsumi, M. J. Poi, T. J. Knobloch, B. C. Casto, W. S. Melvin, M.-D. Tsai, and P. Muscarella
Frequent p16INK4A/CDKN2A alterations in chemically induced Syrian golden hamster pancreatic tumors
Carcinogenesis, February 1, 2004; 25(2): 263 - 268.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Tort, S. Hernandez, S. Bea, A. Martinez, M. Esteller, J. G. Herman, X. Puig, E. Camacho, M. Sanchez, I. Nayach, et al.
CHK2-decreased protein expression and infrequent genetic alterations mainly occur in aggressive types of non-Hodgkin lymphomas
Blood, December 15, 2002; 100(13): 4602 - 4608.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Ballerini, A. Blaise, M. Busson-Le Coniat, X. Y. Su, J. Zucman-Rossi, M. Adam, J. van den Akker, C. Perot, B. Pellegrino, J. Landman-Parker, et al.
HOX11L2 expression defines a clinical subtype of pediatric T-ALL associated with poor prognosis
Blood, July 18, 2002; 100(3): 991 - 997.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Graf Einsiedel, T. Taube, R. Hartmann, S. Wellmann, G. Seifert, G. Henze, and K. Seeger
Deletion analysis of p16INKa and p15INKb in relapsed childhood acute lymphoblastic leukemia
Blood, May 29, 2002; 99(12): 4629 - 4631.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. H. Dalle, M. Fournier, B. Nelken, F. Mazingue, J.-L. Lai, F. Bauters, P. Fenaux, and B. Quesnel
p16INK4a immunocytochemical analysis is an independent prognostic factor in childhood acute lymphoblastic leukemia
Blood, April 1, 2002; 99(7): 2620 - 2623.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. G. Einsiedel, T. Taube, R. Hartmann, C. Eckert, G. Seifert, S. Wellmann, G. Henze, K. Seeger, U. R. Kees, T. L. Carter, et al.
Prognostic value of p16INK4a gene deletions in pediatric acute lymphoblastic leukemia
Blood, June 15, 2001; 97(12): 4002 - 4004.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carter, T. L.
Right arrow Articles by Kees, U. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carter, T. L.
Right arrow Articles by Kees, U. R.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Brief Reports
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020