| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From Academic Transfusion Medicine Unit, Department of
Medicine, Royal Infirmary, Glasgow, United Kingdom; the Terry Fox
Laboratory, British Columbia Cancer Agency, Vancouver, Canada; and the
Departments of Medicine, Pathology, and Laboratory Medicine and Medical
Genetics, University of British Columbia, Vancouver, Canada.
It was previously shown that patients with chronic myeloid leukemia
(CML) have a rare but consistently detectable population of
quiescent (G0) leukemic (Philadelphia chromosome-positive
and BCR-ABL-positive [BCR-ABL+])
CD34+ cells. In the study described here, most such cells
expressed a primitive phenotype (CD38 Chronic myeloid leukemia (CML) is a clonal
multilineage myeloproliferative disorder1 in which there is
a generalized expansion of many types of intermediate hematopoietic
progenitors that leads to an excessive output of mature
granulocytes.2 The strong association of this disease with
the presence of a BCR-ABL fusion gene in the leukemic
cells,3-5 coupled with independent experimental evidence
that the protein it encodes has oncogenic properties,6-9 suggests the primary involvement of BCR-ABL in the
pathogenesis of early-stage CML. However, in spite of much information
about how the BCR-ABL fusion-gene product can alter
intracellular signaling,10-13 the relative importance of
these molecular perturbations in the natural course of human CML is
not clear.
Several studies have found that primitive CML cells isolated from
patients can survive and proliferate in vitro in the absence of added
growth factors, both with and without serum.14-16 We
previously observed that such autonomous growth appears greatest in the
most primitive, phenotypically defined subsets of CML cells. In these, it is consistently associated with and at least partly dependent on an
abnormal activation of interleukin-3 (IL-3) and granulocyte colony-stimulating factor (G-CSF) production.17,18
An autocrine mechanism involving IL-3 (and G-CSF) would provide
an attractive explanation for both the increased proliferative
activity2,19,20 and the decreased self-renewal
capacity21,22 characteristic of primitive CML cells,
because previous studies found that normal cells show both these
responses when exposed to excess concentrations of IL-3 in
vitro.23 However, more recent studies revealed a rare but
consistently detectable population of primitive Philadelphia chromosome-positive (Ph+) and
BCR-ABL-positive (BCR-ABL+)
progenitor cells in CML patients that are quiescent.24 The current experiments were designed to investigate whether quiescent and
cycling subsets of leukemic CML progenitors in the CD34+
compartment differ in their potential for growth factor-independent proliferation in vitro and, if so, whether this activity correlates with constitutive expression of IL-3 and G-CSF. Our results support a
model of clonal expansion of
Ph+/BCR-ABL+ cells in which abnormal
activation of IL-3 gene expression contributes to an autonomous
proliferation of the most primitive neoplastic cells. In addition, our
findings suggest that this may be dependent on but not exclusively
regulated by the BCR-ABL oncoprotein.
Cell samples
Routine isolation of CD34+ subpopulations and
CD34 Isolation of cells after Hoechst 33342 and pyronin Y staining Cryopreserved lin cells were thawed and, to allow
reactivation of RNA synthesis, the cells were then incubated overnight
in Iscoves medium (Stemcell Technologies) supplemented with a serum substitute (BIT; Stemcell Technologies), 40 µg/mL low-density lipoproteins (Sigma Chemical, St Louis, MO) and 10 4 M
2-mercaptoethanol (complete SFM) supplemented with 300 ng/mL each of
recombinant human Flt3-ligand (FL; Immunex, Seattle, WA) and Steel
factor (SF; Terry Fox Laboratory, Vancouver, BC, Canada), and 60 ng/mL
each of recombinant human IL-3 (Novartis, Basel, Switzerland), IL-6
(Cangene, Mississauga, ON, Canada), and G-CSF (Stemcell Technologies).
The next day, the cells were washed once and stained in Hanks balanced
salt solution supplemented with 2% fetal-calf serum (HF/2), 10 µM
Hoechst 33342 (Hst; Molecular Probes, Eugene, OR), 2.5 µg/mL pyronin
Y (Py; Sigma Chemical) and anti-CD34-fluorescein isothiocyanate,
conjugated (FITC; 8G12-FITC29; provided by P. Lansdorp,
Terry Fox Laboratory), and 1 µg/mL propidium iodide (PI; Sigma
Chemical). Cells were then sorted with gates set to collect
HstloPylo (G0) and
Hstlo/+Py+ (G1/S/G2/M)
cells as separate fractions in the PI-negative (PI )
CD34+ populations.24,30
Isolation of cells labeled with carboxyfluorescein diacetate succinimidyl ester Cells were incubated with carboxyfluorescein diacetate succinimidyl ester (CFSE) (Molecular Probes) and cultured overnight in SFM supplemented with 50 ng/mL thrombopoietin (TPO; Genentech, San Francisco, CA) before being washed and labeled with anti-CD34-phycoerythrin (PE; Becton Dickinson) and 1 µg/mL PI as described previously.24,31 A relatively homogeneous subset of CFSE-positive PI CD34+ cells
(105 to 3 × 106, depending on the sample)
was sorted by using a narrow fluorescence gate (36-40 channels wide
with a 1024-channel log amplifier). These cells were then cultured for
another 4 days in SFM containing 50 ng/mL TPO, both with and without
100 ng/mL colcemid (Gibco BRL, Burlington, ON, Canada). All the cells
present (105 to 4 × 106) were then
harvested, washed, and stained with PI (1 µg/mL). Cells cultured in
the presence of colcemid were used to establish the range of
fluorescence shown by cells that had not divided during the 4-day
postlabeling incubation and, hence, their separation by FACS from cells
that had divided (in the cultures to which no colcemid was
added).24,31
Serum-free cultures Single cells were cultured individually in 100-µL aliquots of SFM with or without added growth factors. Cultures with growth factors contained the same mixture of 5 growth factors described above for incubating cells overnight before Py and Hst staining. The number of viable (refractile) cells in each well was assessed after 4, 10, 20, and 35 days of incubation at 37°C. A clone was defined as the presence of at least 2 refractile cells. In this study, any cell capable of forming such a clone in liquid medium was described as "proliferating" and the proportion of any given population producing clones represented the cloning efficiency of that population. (This term should not be confused with the term "colony-forming cell" [CFC], which is commonly used to refer to cells that can proliferate and generate at least 20 mature myeloid or erythroid progeny when stimulated by appropriate growth factors in semisolid media.) Bulk populations of cells were cultured in 2.5-mL volumes of SFM with and without growth factors in 35-mm suspension dishes.Isolation of viable cells from serum-free cultures for RT-PCR analyses Cells were cultured in SFM for various periods, washed to remove any residual growth factors, and labeled with annexin-V-FITC (Pharmingen, San Diego, CA) and PI. The viable (annexin-V-negative [annexin-V ]/[PI ]) cells were then
isolated by FACS and subjected to RT-PCR analyses.
RT-PCR analyses Cells were sorted directly into a guanidinium isothiocyanate (GIT) lysis buffer (5 M GIT, 20 mM 1,4-diothioerythritol, 25 mM sodium citrate [pH 7.0], and 0.05% sarcosyl). A 2-step (nested) RT-PCR procedure using an initial oligo (dT)-based primer and poly (A) tailing strategy32,33 was then done. After electrophoresis of the amplified products, BCR-ABL-, actin-, IL-3-, and G-CSF-specific fragments were detected with Southern blotting using complementary DNA probes for BCR-ABL (provided by J. Griffin, Dana Farber Cancer Institute, Boston, MA) actin, IL-3, and G-CSF (provided by R. Kay and K. Humphries, Terry Fox Laboratory).17,32,33 Primers sets included ABL 1 and 2, 5'TTCAGCGGCCAGTAGCATCTGACTT3' and 5'GGTACCAGGAGTGTTTCTCCAGACTG3'; BCR-ABL 1 and 2, 5'CAGGGTGCACAGCCGCAACGGCAA3' and 5'GTCCAGCGAGAAGGTTTTCCTTGGA3'; actin 1 and 2, 5'GTGCGTGACATTAAGGAGAA3' and 5'GGAGGGGCCGGACTCGTCA3'; IL-3 1 and 2, 5'GCTCCCATGACCCAGACAACGTCC3' and 5'CAGATAGAACGTCAGTTTCCTCCG3'; G-CSF 1 and 2, 5'CTCTGGACAGTGCAGGAAGCCACC3' and 5'GCTGGGCAAGGTGGCGTAGAACGC3'; CD34 1 and 2; 5'GGAATTCGAGGCCACAACAAACATCAC3' and 5'GGAATTCGCAGATGCCCTGAGTCAATT3'; cdc25 1 and 2, 5'GGAAGTGCATTTAGCTGGGATGAA3' and 5'CCACCTGCTTCAGTCTTGGCCTGT3'; Ki-67 1 and 2, 5'GCAAGAGGCAAATCATCCGAACCC3' and 5'GAGAA- CCTTCGCACTCTTCTGCCC3'; p21 1 and 2, 5'CCTCACCTCCTCTAAGGTTGG3' and 5'-CCCTTCCAGTCCATTGAGC3'; and cyclin D2 1 and 2, 5'CTGGCCATGAACTACCTGGA3' and 5'CATGGCAA- ACTTAAAGTCGG3'.Statistical analyses Statistical analyses were done with the Student t test.
Various highly purified subpopulations of lin
Proliferating activity of CD34+CD38 cells were isolated from the
first 6 patients' samples and examined for their ability to
proliferate (produce at least 2 progeny by day 10) when cultured
as single cells in a serum-free liquid-suspension culture with or
without added growth factors (FL, SF, IL-3, IL-6, and G-CSF).
Preliminary time-course studies with cells from 3 of these samples
showed that almost all single CD34+CD38 cells
able to divide once did so within the first 4 days and that those able
to divide at least 5 times did so within 10 days, whether or not growth
factors were added (data not shown). As show in Table
2, the frequency of proliferating
CD34+CD38 cells (in the presence of growth
factors) in the samples from all 6 patients with CML studied was high
(range, 39%-90%). In fact, these frequencies were several times
higher than the usual frequency of either CFCs (ie, cells able to
proliferate in semisolid medium) or LTC-IC in the
CD34+CD38 subpopulation of cells from
patients with CML.22,26 This discrepancy between the
frequency of either CFCs or LTC-IC and the frequency of
CD34+CD38 cells able to proliferate in liquid
medium was previously observed in normal marrow.34 Single
CD34+CD38 cells from the same 6 samples from
patients with CML also proliferated at high frequency in serum-free
liquid cultures in the absence of added growth factors (range,
27%-68%; Table 2). Under the assumption that these growth
factor-independent proliferating cells represented a subset of those
that proliferate in the presence of growth factors, the frequency of
growth factor-independent proliferating cells in each sample of
CD34+CD38 cells was calculated. Values ranged
from 54% to 96% (Table 2).
Because 2 of the 6 patients with CML were known to have predominantly
normal LTC-IC (Table 1), it was important to determine the proportion
of CD34+CD38 As expected,17,18 both the total frequency of cells that
proliferated in single-cell cultures with growth factors (Table 2) and
their proliferative potential, as indicated by the sizes of clones
(number of cells) generated (Figure 2),
were reduced in later compartments (CD34+CD38+
and CD34
Quiescent CD34+ CML cells have features of primitive cells Because we previously identified a rare subset of quiescent CD34+ Ph+/BCR-ABL+ cells in CML patients that included some CFCs and LTC-IC,24 it was of interest to determine whether such cells could proliferate in serum-free single-cell cultures in the presence of added growth factors. Accordingly, quiescent CD34+ cells were isolated either on the basis of their low content of DNA and RNA (CD34+ G0 cells detected by Hst and Py staining, respectively; Figure 1B) or by using CFSE staining to isolate those that had not yet divided after being cultured for 4 days in SFM with TPO as the only added growth factor (ie, CD34+ TPO-resistant cells; Figure 1C). Quiescent CD34+ cells isolated with use of either method represented a small fraction of the total CD34+ subset, in agreement with our previous findings.24 For the 9 CML patients studied, the CD34+ content of the samples ranged from 0.5% to 18% (mean ± SE, 6.4% ± 2.4%), but only between 0.8% and 31% (8.7% ± 3.4%) of the CD34+ cells were in G0; the remainder were in G1/S/G2/M. Likewise, the TPO-resistant CD34+ cells comprised only 2% to 6% of the entire CD34+ population and, by the end of the 4 days in culture with TPO, they constituted only 0.4% to 1.9% of those present at that time.Single G0, G1/S/G2/M,
and TPO-resistant cells were then cultured for 10 days in the presence
or absence of FL, SL, IL-3, IL-6, and G-CSF. In addition,
TPO-responsive cells were cultured under the same conditions in bulk
cultures. In the presence of growth factors, the average frequency of
proliferating G0,
G1/S/G2/M, and TPO-resistant cells from the
patients with CML ranged from 28% to 41%. These frequencies were
somewhat lower than those measured by using analogous populations
isolated from the marrow of normal persons (range of average values for
normal cells, 51%-68%; Table 2). Genotyping analyses were again
performed on the individual CML clones or bulk cultures. These analyses
showed that all the cells derived from the cycling
(G1/S/G2/M or TPO-responsive) CML cells were
Ph+ (124/124). Most of the clones produced by quiescent
(G0 or initially TPO-resistant) CML cells were also
Ph+ (181/213), with the small number of normal
(Ph When the kinetics of growth factor-stimulated clone formation by quiescent cells (G0) was compared with that of cycling (G1/S/G2/M) CD34+ cells, more of the cycling cells (from both CML and normal marrow populations) were found to have completed at least 5 divisions by day 4. However, by day 20, the clones derived from the G0 cells (of either CML or normal marrow origin) were still expanding. In contrast, clones derived from cells that were already cycling initially had reached their maximum size by day 10. Moreover, by day 20, many of the cells in these clones were no longer viable (data not shown). In 2 experiments (with cells from patients 4 and 5), the growth factor-supplemented single-cell cultures were incubated for an additional 15 days (with the addition of fresh medium plus growth factors on days 20 and 27). By this time, about 10% of cultures initiated with G0 cells had produced large clones of more than 103 cells, all of which were Ph+ on cytogenetic analysis. In contrast, only about 1% of the G1/S/G2/M cells from the same samples produced clones of equivalent size. Thus, in the leukemic clone, as in normal marrow, quiescence appears to be a more common feature of CD34+ cells that have greater proliferative potential (measured in response to growth factor stimulation in vitro). We next examined whether the greater proliferative potential of
initially quiescent leukemic cells was reflected in their possession of a surface phenotype characteristic of very primitive hematopoietic cells.26-28,35 Accordingly,
CD34+ G0 or G1/S/G2/M
cells were isolated with use of FACS and then labeled with antibodies
to CD45RA, CD71, HLA-DR, and CD38. Flow cytometric analyses of the
final patterns of antigen expression on the cells from the 2 patients'
samples examined in this way were similar (Figure
3). A much higher proportion of
CD34+ G0 cells than of the corresponding
CD34+ G1/S/G2/M cells were negative
for CD71, CD45RA, and CD38. In contrast, most of the G0
cells and the G1/S/G2/M cells were positive for
HLA-DR, although the average level of its expression on the G0 cells was approximately 10-fold lower.
Quiescent CD34+ CML cells are spontaneously activated in vitro As expected, single-cycling CD34+ cells from all the samples from patients with CML studied produced growth factor-independent clones, whereas no normal cells (either initially quiescent or already cycling) were found to execute even a single division in SFM without growth factors (Table 2). Interestingly, some of the initially quiescent cells in all the CML samples also generated clones within 10 days in the absence of added growth factors, thereby demonstrating the spontaneous reversibility of their quiescent status in vitro. Indeed, for each patient studied, the frequency of growth factor-independent proliferating cells was almost 2-fold higher in the quiescent population than in the corresponding cycling population. The exclusively leukemic (Ph+/BCR-ABL+) origin of all the growth factor-independent clones obtained from CML patients' cells, regardless of their origin (initially quiescent or cycling cells), was again established by using genotyping studies of individual clones (55/55 and 110/110 clones, respectively; Table 2). Figure 4 shows representative RT-PCR data demonstrating the BCR-ABL positivity of 20 of 20 randomly selected clones generated in the absence of growth factors by single G0 cells obtained from patients 1 and 2. Because these samples also produced Ph clones when growth factors were
added, it is clear that culture in the absence of cytokines is
selective for Ph+/BCR-ABL+ cells.
Interestingly, the size attained by the leukemic clones after 10 days
in the absence of added growth factors, though highly variable (up to
50 cells on day 10 and up to 100 cells on day 35), was, on average,
consistently smaller than the size attained by cells cultured with
growth factors (Figure 5).
Quiescent CML cells express BCR-ABL but not IL-3 or G-CSF Using RT-PCR analyses of single cells, we previously found that more than 80% of all CD34+ BCR-ABL+ cells from patients with CML contain transcripts for IL-3 and that more than 50% contain transcripts for G-CSF.17 Because only a rare subset of the CD34+ cells are quiescent,24 we wondered whether such cells also contain transcripts for these growth factor genes. To address this issue, G0 and G1/S/G2/M subpopulations of CD34+ cells were isolated from 6 samples from patients with CML (patients 3-5 and 7-9) and RT-PCR analysis was done on separate aliquots of at least 10 cells from each fraction. In addition, single G0 cells from patients 3 to 5 and single G1/S/G2/M cells from patient 3 were analyzed individually. The results for the bulk populations are shown in Figure 6A; those for single cells are shown in Figure 6B and 6C. All bulk populations (consisting of at least 10 cells) but only a proportion of the single G0 cells (8/12, 6/12, and 6/12 from patients 3, 4, and 5, respectively) contained detectable BCR-ABL transcripts, in spite of the fact that all previously examined CD34+ subpopulations from all 3 of these patients (ie, the growth factor-responsive CD34+CD38 cells,
CFCs, and LTC-IC) were exclusively
Ph+/BCR-ABL+. None of the
CD34+ G0 cells that were BCR-ABL
negative (BCR-ABL ) contained detectable
IL-3 or G-CSF transcripts (data not shown).
More recently, fluorescent in situ hybridization (FISH) was performed
in parallel with RT-PCR on quiescent CD34+ cells purified
from samples from patients with CML. These studies suggested that cells
lacking BCR-ABL transcripts on RT-PCR are also
BCR-ABL Quiescent CML cells up-regulate expression of IL-3 on entry into the cell cycle To determine whether cytokine gene expression becomes activated coincident with or before entry into the cell cycle, initially quiescent (G0) and cycling (G1/S/G2/M) CD34+ cells from 3 patients with CML (patients 7-9) were cultured in SFM with and without growth factors for up to 4 days. On days 1 and 4, single-cell cultures of CD34+ G0 cells were examined to determine the rate of entry of the cells into division. Gene-expression analysis using RT-PCR was done on the initially FACS-sorted cells and on viable (annexin V /PI ) cells cultured in bulk for 4 days. As shown in Figure 7A, between day
0 and day 4, the quiescent cells became activated and divided in both
the presence (cloning efficiency, 55% ± 7%) and absence of
added growth factors (20% ± 8%). Initially (Figure 7B), the quiescent BCR-ABL+ cells expressed high levels
of CD34, p21, and cyclin D2 and low levels of Ki-67 and cdc25 and IL-3
transcripts were almost undetectable. In comparison, initially cycling
(G1/S/G2/M) BCR-ABL+
cells expressed similar levels of CD34 and cyclin D2, less p21, and
higher levels of Ki-67 and cdc25, and IL-3 transcripts were readily
detectable. After 4 days of culture of initially quiescent cells in the
absence of added growth factors, 20% of the cells had divided at least
once and expression of Ki-67 and cdc25 was up-regulated. In addition,
IL-3 transcripts were greatly increased (Figure 7B). Interestingly, in
the presence of added growth factors, this was not the case: IL-3
expression remained almost undetectable under these conditions.
However, for the initially cycling cells, IL-3 expression remained high
regardless of whether growth factors were added. Thus, we found that in
patients with CML, quiescence is accompanied by a lack of constitutive
IL-3 expression in spite of the continued presence of
BCR-ABL and CD34 messenger RNA (mRNA) and that it is
spontaneously reversible in the absence of growth factors, in
association with an up-regulation of IL-3 expression.
Human leukemia, like other malignancies, is likely to have a
multistep pathogenesis in which several genes that normally regulate the proliferation, survival, and differentiation of normal
hematopoietic cells are mutated.1 Autocrine mechanisms
contribute to the uncontrolled proliferation of many malignant cell
types, including several BCR-ABL+ cell
lines.36-39 We previously showed that very primitive
(CD34+CD45RA In this study, we examined the relation between growth factor
independence and progenitor cell-cycle status, genotype, and expression
of BCR-ABL, IL-3 and G-CSF. Factor-independent clones were
obtained in serum-free single-cell cultures from 9 of 9 CML samples
studied. Some of these factor-independent clones contained up to 100 cells and all were derived from BCR-ABL+ cells,
even those in samples that, in serum-free single-cell cultures, also
contained growth factor-responsive Ph It was previously suggested that BCR-ABL transcript levels
may be lower in the CD34+ population of CML
cells40 and when Ph+ cells terminally
differentiate.41 We are confident that the quiescent
leukemic cell populations isolated in this study included very
primitive CD34+ cells, because we found previously that as
few as 105 G0 CML cells isolated by using the
same protocol consistently produced detectable numbers of leukemic
(BCR-ABL+) progeny within 6 weeks in
immunodeficient mice.24 In the current study, we also
showed that quiescent CD34+ leukemic cells were markedly
enriched in their content of CD38 The transient dissociation of BCR-ABL gene expression (present) and factor production (absent) in a small subset of freshly isolated primitive quiescent CML cells, as well as the loss of growth factor independence and IL-3 and G-CSF production during the differentiation of CML cells in vivo, raises many new questions about the precise relation between the 2 phenotypes and the underlying molecular mechanisms. The observation that some quiescent CML progenitor cells that did not initially express IL-3 or G-CSF subsequently reentered the cell cycle and proliferated in the absence of added growth factors provided an opportunity to determine whether IL-3 expression would be reactivated and, if so, to assess the conditions and timing of this change relative to the exit of the cells from G0 and other molecular events known to regulate this phase of cell-cycle control. Because G-CSF is known to be up-regulated in normal cells cultured in vitro, it was not included in the current analysis. The results of the time-course experiments confirmed the existence of a temporal relation between IL-3 transcription in primitive CML cells and quiescence compared with proliferation. However, in the absence of fully quantitative RT-PCR analyses, it is impossible to say whether a threshold level of BCR-ABL mRNA expression is required before IL-3 or G-CSF mRNA is induced and that it may not be reached by most quiescent leukemic cells until they enter the cell cycle. Our findings confirm that the quiescent status of some CML progenitors
is reversible and show that this can occur even in the absence of
exogenous growth factors. However, it is not yet clear what causes
these cells to enter a quiescent state in vivo. Some types of primitive
CML CFCs are known to be unresponsive to the inhibitory activities that
certain chemokines exert on their normal
counterparts.42,43 However, these primitive CFCs also show
a normal sensitivity to transforming growth factor
We thank our colleagues in the Division of Hematology of the University of British Columbia, the Stem Cell Assay Service of the BC Cancer Agency, and the Department of Haematology, Glasgow Royal Infirmary, for assistance in procuring and processing specimens; Gloria Shaw and Elaine Allan for cytogenetic and FISH analyses; Giovanna Cameron, Gayle Thornbury, and Charlie Pearson for FACS operation; Dianne Reid, Margaret Hale, and Linda Richmond for technical assistance, and Tara Palmater for typing the manuscript. We also thank K. Humphries, R. Kay, and P. Lansdorp (Terry Fox Laboratory); J. Griffin (Dana Farber Cancer Institute, Boston, MA); and Cangene, Genentech, Immunex, Novartis, and Stem Cell for generous gifts of reagents.
Submitted March 27, 2000; accepted September 27, 2000.
Supported by grants from the National Cancer Institute of Canada (NCIC) with funds from the Canadian Cancer Society and the Terry Fox Run. T.L.H. and H.G.J. are funded by the United Kingdom Leukaemia Research Fund and S.G. by the Glasgow Royal Infirmary Endowment Fund. C.J.E. is a Terry Fox Cancer Research Scientist of the NCIC.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Tessa Holyoake, ATMU, Department of Medicine, Royal Infirmary, 10 Alexandra Parade, Glasgow G31 2ER, United Kingdom; e-mail: tlh1g{at}clinmed.gla.ac.uk.
1. Raskind WH, Fialkow PJ. The use of cell markers in the study of human hematopoietic neoplasia. Adv Cancer Res. 1987;49:127-167[Medline] [Order article via Infotrieve]. 2. Eaves CJ, Eaves AC. Cell culture studies in CML. In: Hinton K, ed. Bailliere's Clinical Haematology. London United Kingdom: Bailliere Tindall; 1987:931-961. 3. Groffen J, Stephenson JR, Heisterkamp N, De Klein A, Bartram CR, Grosveld G. Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell. 1984;36:93-99[CrossRef][Medline] [Order article via Infotrieve]. 4. Shtivelman E, Lifshitz B, Gale RP, Roe BA, Canaani E. Alternative splicing of RNAs transcribed from the human abl gene and from the bcr-abl fused gene. Cell. 1986;47:277-284[CrossRef][Medline] [Order article via Infotrieve]. 5. Kurzrock R, Gutterman JU, Talpaz M. The molecular genetics of Philadelphia chromosome-positive leukemias. N Engl J Med. 1988;319:990-998[Medline] [Order article via Infotrieve].
6.
Lugo TG, Pendergast AM, Muller AJ, Witte ON.
Tyrosine kinase activity and transformation potency of bcr-abl oncogene products.
Science.
1990;247:1079-1082
7.
Daley GQ, Van Etten RA, Baltimore D.
Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome.
Science.
1990;247:824-830 8. Heisterkamp N, Jenster G, ten Hoeve J, Zovich D, Pattengale PK, Groffen J. Acute leukemia in bcr/abl transgenic mice. Nature. 1990;344:251-253[CrossRef][Medline] [Order article via Infotrieve].
9.
Voncken JW, Morris C, Pattengale P, et al.
Clonal development and karyotype evolution during leukemogenesis of BCR/ABL transgenic mice.
Blood.
1992;79:1029-1036 10. Shuai K, Halpern J, ten Hoeve J, Rao X, Sawyers CL. Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene. 1996;13:247-254[Medline] [Order article via Infotrieve].
11.
Carlesso N, Frank D, Griffin J.
Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr-Abl.
J Exp Med.
1996;183:811-820 12. Chai SK, Nichols GL, Rothman P. Constitutive activation of JAKS and STATS in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients. J Immunol. 1997;159:4720-4728[Abstract]. 13. Sattler M, Salgia R. Activation of hematopoietic growth factor signal transduction pathways by the human oncogene BCR/ABL. Cytokine Growth Factor Rev. 1997;8:63-79[CrossRef][Medline] [Order article via Infotrieve].
14.
Strife A, Lambek C, Wisniewski D, Wachter M, Gulati SC, Clarkson BD.
Discordant maturation as the primary biological defect in chronic myelogenous leukemia.
Cancer Res.
1988;48:1035-1041
15.
Bedi A, Zehnbauer BA, Barber J, Sharkis S, Jones R.
Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia.
Blood.
1994;83:2038-2044 16. Maguer-Satta V, Burl S, Liu L, et al. BCR-ABL accelerates C2-ceramide-induced apoptosis. Oncogene. 1998;16:237-248[CrossRef][Medline] [Order article via Infotrieve].
17.
Jiang X, Lopez A, Holyoake T, Eaves A, Eaves C.
Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukemia.
Proc Natl Acad Sci U S A.
1999;96:12804-12809 18. Jiang X, Fujisaki T, Nicolini F, et al. Autonomous multi-lineage differentiation in vitro of primitive CD34+ cells from patients with chronic myeloid leukemia. Leukemia. 2000;14:1112-1121[CrossRef][Medline] [Order article via Infotrieve]. 19. Eaves AC, Barnett MJ, Ponchio L, Cashman JD, Petzer A, Eaves CJ. Differences between normal and CML stem cells: potential targets for clinical exploitation. Stem Cells. 1998;16:77-83. 20. Traycoff CM, Halstead B, Rice S, McMahel J, Srour EF, Cornetta K. Chronic myelogenous leukaemia CD34+ cells exit G0/G1 phases of cell cycle more rapidly than normal marrow CD34+ cells. Br J Haematol. 1998;102:759-767[CrossRef][Medline] [Order article via Infotrieve].
21.
Udomsakdi C, Eaves CJ, Swolin B, Reid DS, Barnett MJ, Eaves AC.
Rapid decline of chronic myeloid leukemic cells in long-term culture due to a defect at the leukemic stem cell level.
Proc Natl Acad Sci U S A.
1992;89:6192-6196
22.
Petzer AL, Eaves CJ, Barnett MJ, Eaves AC.
Selective expansion of primitive normal hematopoietic cells in cytokine-supplemented cultures of purified cells from patients with chronic myeloid leukemia.
Blood.
1997;90:64-69
23.
Zandstra PW, Conneally E, Petzer AL, Piret JM, Eaves CJ.
Cytokine manipulation of primitive human hematopoietic cell self-renewal.
Proc Natl Acad Sci U S A.
1997;94:4698-4703
24.
Holyoake T, Jiang X, Eaves C, Eaves A.
Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia.
Blood.
1999;94:2056-2064 25. Thomas TE, Miller CL, Eaves CJ. Purification of hematopoietic stem cells for further biological study. Methods. 1999;17:202-218[CrossRef][Medline] [Order article via Infotrieve].
26.
Petzer AL, Eaves CJ, Lansdorp PM, Ponchio L, Barnett MJ, Eaves AC.
Characterization of primitive subpopulations of normal and leukemic cells present in the blood of patients with newly diagnosed as well as established chronic myeloid leukemia.
Blood.
1996;88:2162-2171
27.
Sutherland HJ, Eaves CJ, Eaves AC, Dragowska W, Lansdorp PM.
Characterization and partial purification of human marrow cells capable of initiating long-term hematopoiesis in vitro.
Blood.
1989;74:1563-1570
28.
Lansdorp PM, Dragowska W.
Long-term erythropoiesis from constant numbers of CD34+ cells in serum-free cultures initiated with highly purified progenitor cells from human bone marrow.
J Exp Med.
1992;175:1501-1509 29. Schmitt C, Eaves CJ, Lansdorp PM. Expression of CD34 on human B cell precursors. Clin Exp Immunol. 1991;85:168-173[Medline] [Order article via Infotrieve]. 30. Shapiro HM. Flow cytometric estimation of DNA and RNA content in intact cells stained with Hoechst 33342 and Pyronin Y. Cytometry. 1981;2:143-150[CrossRef][Medline] [Order article via Infotrieve].
31.
Nordon RE, Ginsberg SS, Eaves CJ.
High resolution cell division tracking demonstrates the Flt3-ligand-dependence of human marrow CD34+CD38
32.
Sauvageau G, Lansdorp PM, Eaves CJ, et al.
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci U S A.
1994;91:12223-12227
33.
Maguer-Satta V, Petzer AL, Eaves AC, Eaves CJ.
BCR-ABL expression in different subpopulations of functionally characterized Ph+ CD34+ cells from patients with chronic myeloid leukemia.
Blood.
1996;88:1796-1804
34.
Petzer AL, Hogge DE, Lansdorp PM, Reid DS, Eaves CJ.
Self-renewal of primitive human hematopoietic cells (long-term-culture-initiating cells) in vitro and their expansion in defined medium.
Proc Natl Acad Sci U S A.
1996;93:1470-1474
35.
Conneally E, Cashman J, Petzer A, Eaves C.
Expansion in vitro of transplantable human cord blood stem cells demonstrated using a quantitative assay of their lympho-myeloid repopulating activity in nonobese diabetic-scid/scid mice.
Proc Natl Acad Sci U S A.
1997;94:9836-9841 36. Hariharan IK, Adams JM, Cory S. BCR-ABL oncogene renders myeloid cell line factor independent: potential autocrine mechanism in chronic myeloid leukemia. Oncogene Res. 1988;3:387-399[Medline] [Order article via Infotrieve]. 37. Laneuville P, Heisterkamp N, Groffen J. Expression of the chronic myelogenous leukemia-associated p210bcr/abl oncoprotein in a murine IL-3 dependent myeloid cell line. Oncogene. 1991;6:275-282[Medline] [Order article via Infotrieve].
38.
Sirard C, Laneuville P, Dick J.
Expression of bcr-abl abrogates factor-dependent growth of human hematopoietic M07E cells by an autocrine mechanism.
Blood.
1994;83:1575-1585
39.
Anderson SM, Mladenovic J.
The BCR-ABL oncogene requires both kinase activity and src-homology 2 domain to induce cytokine secretion.
Blood.
1996;87:238-244
40.
Bedi A, Zehnbauer BA, Collector MI, et al.
BCR-ABL gene rearrangement and expression of primitive hematopoietic progenitors in chronic myeloid leukemia.
Blood.
1993;81:2898-2902 41. Wetzler M, Talpaz M, Van Etten RA, HirschGinsberg C, Beran M, Kurzrock R. Subcellular localization of BCR, ABL and BCR-ABL proteins in normal and leukemic cells and correlation of expression with myeloid differentiation. J Clin Invest. 1993;92:1925-1939.
42.
Eaves CJ, Cashman JD, Wolpe SD, Eaves AC.
Unresponsiveness of primitive chronic myeloid leukemia cells to macrophage inflammatory protein 1
43.
Cashman JD, Eaves CJ, Sarris AH, Eaves AC.
MCP-1, not MIP-1
44.
Sing GK, Keller JR, Ellingsworth LR, Ruscetti FW.
Transforming growth factor-
45.
Cashman JD, Eaves AC, Eaves CJ.
Granulocyte-macrophage colony-stimulating factor modulation of the inhibitory effect of transforming growth factor-
46.
Cashman JD, Clark-Lewis I, Eaves AC, Eaves CJ.
Differentiation stage-specific regulation of primitive human hematopoietic progenitor cycling by exogenous and endogenous inhibitors in an in vivo model.
Blood.
1999;94:3722-3729 47. Druker BJ, Tamura S, Buchdunger E, et al. Ef-fects of a selective inhibitor of the ABL tyrosine kinase on the growth of BCR-ABL positive cells. Nat Med. 1996;2:561-566[CrossRef][Medline] [Order article via Infotrieve].
48.
Wang JCY, Lapidot T, Cashman JD, et al.
High level engraftment of NOD/SCID mice by primitive normal and leukemic hematopoietic cells from patients with chronic myeloid leukemia in chronic phase.
Blood.
1998;91:2406-2414
49.
Lewis ID, McDiarmid LA, Samels LM, To LB, Hughes TP.
Establishment of a reproducible model of chronic-phase chronic myeloid leukemia in NOD/SCID mice using blood-derived mononuclear or CD34+ cells.
Blood.
1998;91:630-640
50.
Dazzi F, Capelli D, Hasserjian R, et al.
The kinetics and extent of engraftment of chronic myelogenous leukemia cells in non-obese diabetic/severe combined immunodeficiency mice reflect the phase of the donor's disease: an in vivo model of chronic myelogenous leukemia biology.
Blood.
1998;92:1390-1396
51.
Pear WS, Miller JP, Xu L, et al.
Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow.
Blood.
1998;92:3780-3792
52.
Zhang X, Ren R.
BCR-ABL efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukemia.
Blood.
1998;92:3829-3840
53.
Li S, Ilaria RL, Million RP, Daley GQ, Van Etten RA.
The p190, p210, and p230 forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like syndrome in mice but have different lymphoid leukemogenic activity.
J Exp Med.
1999;189:1399-1412
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
D. Wodarz Use of oncolytic viruses for the eradication of drug-resistant cancer cells J R Soc Interface, February 6, 2009; 6(31): 179 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Konig, M. Copland, S. Chu, R. Jove, T. L. Holyoake, and R. Bhatia Effects of Dasatinib on Src Kinase Activity and Downstream Intracellular Signaling in Primitive Chronic Myelogenous Leukemia Hematopoietic Cells Cancer Res., December 1, 2008; 68(23): 9624 - 9633. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Copland, F. Pellicano, L. Richmond, E. K. Allan, A. Hamilton, F. Y. Lee, R. Weinmann, and T. L. Holyoake BMS-214662 potently induces apoptosis of chronic myeloid leukemia stem and progenitor cells and synergizes with tyrosine kinase inhibitors Blood, March 1, 2008; 111(5): 2843 - 2853. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang, K. M. Saw, A. Eaves, and C. Eaves Instability of BCR-ABL Gene in Primary and Cultured Chronic Myeloid Leukemia Stem Cells J Natl Cancer Inst, May 2, 2007; 99(9): 680 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Aichberger, M. Mayerhofer, A. Vales, M.-T. Krauth, K. V. Gleixner, M. Bilban, H. Esterbauer, K. Sonneck, S. Florian, S. Derdak, et al. The CML-related oncoprotein BCR/ABL induces expression of histidine decarboxylase (HDC) and the synthesis of histamine in leukemic cells Blood, November 15, 2006; 108(10): 3538 - 3547. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Copland, A. Hamilton, L. J. Elrick, J. W. Baird, E. K. Allan, N. Jordanides, M. Barow, J. C. Mountford, and T. L. Holyoake Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction Blood, June 1, 2006; 107(11): 4532 - 4539. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Metcalf, A. Dakic, S. Mifsud, L. Di Rago, L. Wu, and S. Nutt Inactivation of PU.1 in adult mice leads to the development of myeloid leukemia PNAS, January 31, 2006; 103(5): 1486 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tavor, I. Petit, S. Porozov, P. Goichberg, A. Avigdor, S. Sagiv, A. Nagler, E. Naparstek, and T. Lapidot Motility, proliferation, and egress to the circulation of human AML cells are elastase dependent in NOD/SCID chimeric mice Blood, September 15, 2005; 106(6): 2120 - 2127. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Deininger, E. Buchdunger, and B. J. Druker The development of imatinib as a therapeutic agent for chronic myeloid leukemia Blood, April 1, 2005; 105(7): 2640 - 2653. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Elrick, H. G. Jorgensen, J. C. Mountford, and T. L. Holyoake Punish the parent not the progeny Blood, March 1, 2005; 105(5): 1862 - 1866. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang, Y. Zhao, W.-Y. Chan, S. Vercauteren, E. Pang, S. Kennedy, F. Nicolini, A. Eaves, and C. Eaves Deregulated expression in Ph+ human leukemias of AHI-1, a gene activated by insertional mutagenesis in mouse models of leukemia Blood, May 15, 2004; 103(10): 3897 - 3904. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Donato, J. Y. Wu, J. Stapley, H. Lin, R. Arlinghaus, B. Aggarwal, S. Shishodin, M. Albitar, K. Hayes, H. Kantarjian, et al. Imatinib Mesylate Resistance Through BCR-ABL Independence in Chronic Myelogenous Leukemia Cancer Res., January 15, 2004; 64(2): 672 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Gilliland, C. T. Jordan, and C. A. Felix The Molecular Basis of Leukemia Hematology, January 1, 2004; 2004(1): 80 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. E. Ouriaghli, E. Sloand, L. Mainwaring, H. Fujiwara, K. Keyvanfar, J. J. Melenhorst, K. Rezvani, G. Sconocchia, S. Solomon, N. Hensel, et al. Clonal dominance of chronic myelogenous leukemia is associated with diminished sensitivity to the antiproliferative effects of neutrophil elastase Blood, November 15, 2003; 102(10): 3786 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang, M. Stuible, Y. Chalandon, A. Li, W. Y. Chan, W. Eisterer, G. Krystal, A. Eaves, and C. Eaves Evidence for a positive role of SHIP in the BCR-ABL-mediated transformation of primitive murine hematopoietic cells and in human chronic myeloid leukemia Blood, October 15, 2003; 102(8): 2976 - 2984. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Goldman and J. V. Melo Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment N. Engl. J. Med., October 9, 2003; 349(15): 1451 - 1464. [Full Text] [PDF] |
||||
![]() |
S. Wong, J. McLaughlin, D. Cheng, K. Shannon, L. Robb, and O. N. Witte IL-3 receptor signaling is dispensable for BCR-ABL-induced myeloproliferative disease PNAS, September 30, 2003; 100(20): 11630 - 11635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wong, J. McLaughlin, D. Cheng, and O. N. Witte Cell context-specific effects of the BCR-ABL oncogene monitored in hematopoietic progenitors Blood, May 15, 2003; 101(10): 4088 - 4097. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Chiorean, S. J. Dylla, K. Olsen, T. Lenvik, Y. Soignier, and J. S. Miller BCR/ABL alters the function of NK cells and the acquisition of killer immunoglobulin-like receptors (KIRs) Blood, May 1, 2003; 101(9): 3527 - 3533. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Graham, H. G. Jorgensen, E. Allan, C. Pearson, M. J. Alcorn, L. Richmond, and T. L. Holyoake Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro Blood, January 1, 2002; 99(1): 319 - 325. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||