|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Hematology Section, Department of Medicine, VA
Boston Healthcare System, Harvard Medical School, Boston, MA; the
Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, IRCCS Maggiore
Hospital, and the University of Milan, Italy; the Hemophilia Centre and
Hemostasis Unit, Department of Hematology, and the Department of
Biochemistry and Molecular Biology, The Royal Free and University
College Medical School, London, England; and the Department of
Hematology, College of Medicine, Sultan Qaboos University
Al-Khod, Sultanate of Oman.
A case of a novel mutation in the F7
gene that results in factor VII coagulant activity (VII:c) of less than
1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis
revealed a homozygous 15-base pair (bp) in-frame insertion-type
mutation at nucleotide 10554. This insertion consisted of a duplication
of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine,
glutamic acid, histidine, and aspartic acid), probably arising by
slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC)
separated by 4 bp. Molecular graphic analyses showed that the insertion
is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at
which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium
binding. In vitro expression studies demonstrated that the levels of
VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of
secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies
with inhibitors of protein degradation showed that recombinant VIIMT
was partially degraded in the pre-Golgi compartment. Accordingly, only
small amounts of VIIMT with undetectable procoagulant activity were
secreted into conditioned media. These results demonstrate that a
combination of secretion and functional defects is the mechanism
whereby this insertion causes VII deficiency.
(Blood. 2001;97:960-965) Factor VII (VII) has a central role in the
initiation of blood coagulation. This glycoprotein circulates in blood
as a single-chain zymogen composed of 406 amino acid
residues1 with a molecular weight of 50 kd. After the
formation of a one-to-one stoichiometric complex with its cell surface
receptor and cofactor tissue factor (TF) and in the presence of calcium
ions, VII is rapidly cleaved to its active form, VIIa. This activation
occurs through proteolytic cleavage at a single site (arginine
(R)152-isoleucine (I)153).2,3 VIIa converts zymogen
factors X and IX to the corresponding active enzymes.2
VIIa is composed of an N-terminal light chain (152 amino acids) and a
C-terminal heavy chain (254 amino acids) linked by a disulfide
bond. The light chain contains an amino terminal VII deficiency is a rare recessive bleeding disorder with a relatively
poor correlation between VII coagulant activity and hemorrhagic
symptoms.5 Several missense mutations and a few small
deletions and insertions in the human F7 gene have been reported,6,7 but no insertion-type mutation or mutations affecting the VII calcium site in the catalytic domain have yet been
documented (see the VII mutation database at
http://europium.csc.mrc.ac.uk). Here, using expression studies, we
describe and characterize the first case of VII deficiency caused by a
homozygous insertion-type mutation consisting of a duplication of a
15-bp segment within exon 8 (leucine [L]213-aspartic acid
[D]217) in the catalytic domain {73-77} (Figure
1). (Chymotrypsinogen numbering
is denoted throughout by curved brackets.) Crystal and solution
scattering structures are available for VIIa and its complex with
TF.8-11 We show, using molecular graphic analysis, that
the insertion is proximate to the calcium binding site of the catalytic
domain and propose that this is responsible for the complete loss of VIIa activity. In vitro transient and stable expression studies demonstrated reduced levels of VII:Ag (antigen) in conditioned media,
supporting the hypothesis of a secretion defect caused by the insertion
mutation. This mutation probably does not interfere with VII synthesis,
but it is associated with various defects including abnormal folding,
intracellular degradation, secretion failure, and lack of coagulant
activity. To our knowledge this is the first instance of a VII
deficiency caused by a perturbation at its calcium binding site in the
catalytic domain.
Patient
Collection and processing of blood samples
VII assays Plasma factor VII coagulant activity (VII:c) was measured by a one-stage prothrombin time-based assay using rhTF (RecombiPlastin; Ortho Diagnostic Systems, Raritan, NJ) and VII-deficient plasma (Dade International, Miami, FL). Plasma VII:Ag was measured with an enzyme-linked immunoabsorbent assay (ELISA) with murine monoclonal antibodies (mAbs) against VII.12 A normal plasma pool was constructed by mixing equal volumes of plasma from 40 healthy subjects, 20 men and 20 women (not pregnant and not taking oral contraceptives). In the expression studies, levels of recombinant VII:c and VII:Ag were determined using the functional assay described above and ELISA (American Bioproducts Co, Parsippany, NJ) using a polyclonal (pAb) rabbit antiserum against human VII, respectively.DNA isolation and in vitro amplification using polymerase chain reaction Genomic DNA was isolated from peripheral blood leukocytes by established techniques.13 The coding regions, intron/exon boundaries, and 490 bp of 5' flanking region of the F7 gene were amplified by polymerase chain reaction (PCR) and analyzed for mutations by single-strand conformational polymorphism (SSCP).14 PCR amplifications were carried out in 100-µL volumes comprising 100-500 ng DNA, 100 pmoles of each oligonucleotide primer, 200 mM of each dNTP (deoxynucleoside 5'-triphosphate), 1.5 mM MgCl2, 50 mM potassium (KCl), 10 mM Tris-HCl (tris[hydroxymethyl] aminomethane-hydrochloride) (pH 8.3), and 2 units Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). Reactions were denatured at 94°C for 5 minutes, then 40 cycles of amplification were performed, with a 10-minute extension time in the last cycle. For SSCP analysis, 1 µL of each final PCR product was mixed with 5 µL denaturation buffer (95% formamide, 0.05% xylene cyanol, and 0.05% bromphenol blue), which was denatured for 10 minutes at 94°C and then placed on ice for 2 minutes. We loaded 3-4 µL of each denatured sample onto a 10% polyacrylamide gel (acrylamide:bisacrylamide, 99:1) in Tris-borate ethylenediamine tetraacetic acid (EDTA) buffer (0.09 M Tris-borate and 2 mM EDTA) supplemented with 7.5% urea. Following electrophoresis DNA fragments were visualized by silver staining (Promega Corp, Southampton, England). PCR fragments showing abnormal SSCP migration were purified by Bioline PCRapid Purification kit (Bioline, London, England) and directly sequenced using an ABI 377 automated DNA sequencer (Perkin-Elmer Applied Biosciences, Warrington, England).Antibodies The production and purification of mAb1476, a murine mAb that recognizes an epitope in the amino terminal region of VII, has been described.15 This antibody was used to detect VII in pulse chase experiments.Structural analysis of the mutant protein The crystal coordinates of the TF-VIIa complex and unbound VIIa at resolutions of 0.2-0.28 nm (2.0-2.8 Å)9-11 were obtained from the Protein Databank (PDB codes, 1dan, 1qfx, and 1cvw). Protein structures were visualized using INSIGHT II software (MSI, San Diego, CA) on Silicon Graphics INDY Workstations (Silicon Graphics, Mountain View, CA) in conjunction with stereo glasses. The VIIa secondary structures and side-chain solvent accessibilities are as reported previously.7 The rigid body fragment assembly method in the HOMOLOGY and DISCOVER modules (MSI) was used to model the insertion. For reason of their positions in the exposed surface loop, histidine (H)216 {76} and D219 {79} were fixed and used to define the insertion point, and D217 {77} and glycine (G)218 {78} were deleted. The 7-residue fragment DLSEHDG was inserted by standard homology modeling methods.16 A precalculated C distance matrix identified known loops in the Protein Databank that
best fitted the corresponding C distance matrix based on the
positions of H216 {76} and D219 {79} and other flanking
residues in VIIa. Side-chain atoms were automatically generated for the inserted region using template structures and general rules for residue
exchanges. The final inserted loop structure showed no steric overlap
with the remaining VIIa structure and was refined using 300 steps of
steepest descent energy minimization.
Cloning of the insertion mutation The 15-bp insertion mutation identified at the very beginning of exon 8 was inserted into the VIIWT (wild type) complementary DNA (cDNA) by overlapping PCR. For the first PCR reaction, the VIIWT cDNA was used as a template. The upstream primer extended from positions 8906 to 8937 in exon 6, including the following underlined XbaI restriction site (5'-CCATGTGGAAAAATACCTATTCTAGAAAAAAG-3'). The downstream primer began at position 9726, the junction of exons 7 and 8 (5'-CCAGCACCG CGATCAAATTTCTCCAGTTC-3'), and included silent mutations (underlined) in codons 202 to 204, which introduced an ApoI restriction site (AGGAACCTG to AGAAATTTG). For the second PCR reaction, the template was the PCR product of exon 8 from the patient's genomic DNA. The upstream primer for this reaction included a 5' extension of 29 bases of exon 7 sequence (positions 9698 to 9726) containing the silent mutations as well as the first 30 bases of exon 8 sequence (positions 10543 to 10572) and 15 bp of insertion (lower case): (5'-GAACTGGAGAAATTTGATCGCGGTGCTGGGCGAGCACGACCTCAGCGAGCACGACC TCAGCGAGCACGACGGGG-3'). The downstream primer extended from position 10927 to 10905 within exon 8 (5'-GGTTGCGCAGCCCTGGCCCCAGC-3'). For the third PCR reaction, the products of the first and second reactions and the upstream primer from reaction 1 and downstream primer from reaction 2 were used to generate the overlapping PCR fragment containing the insertion. The presence of the mutation was confirmed by ApoI digestion.The construction of plasmid pT7SalIVIIWTEcoRI was described previously.17 The product of the third PCR reaction was purified, digested with XbaI and KpnI, and then ligated into this vector, which had been digested with the same enzymes, to make the clone pT7SalIVIIMTEcoRI. Cloned inserts were sequenced, which confirmed the correct sequence including the insertion mutation. Construction of expression vectors SalIVIIWTEcoRI and SalIVIIMTEcoRI fragments were prepared from the corresponding pT7 vectors and ligated into the expression plasmid pED-mtxr, which was provided by Dr Randal J. Kaufman. The resulting plasmids, pEDVIIWT and pEDVIIMT, are dicistronic messenger RNA (mRNA) mammalian expression vectors carrying the WT or MT VII cDNAs at the 5' open reading frame and the dihydrofolate reductase (DHFR) cDNA at the 3' open reading frame.17Cell culture and transfection assays For transient transfection experiments, African green monkey COS-1 cells (ATCC CRL1650) were maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS), 2 mM L-glutamine, 10 mM HEPES (4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid) (pH 7.2), 100 U/mL penicillin G, 100 µg/mL streptomycin, and 5 µg/mL vitamin K1 (Phytonadione; Abbott Laboratories, North Chicago, IL) in a 5% carbon dioxide (CO2) atmosphere at 37°C. Twenty hours prior to transfection, COS-1 cells were plated on 100-mm culture dishes at a density of 3 × 106 cells per dish. We transfected 15 µg of the pEDVIIWT or pEDVIIMT constructs into cells by lipofectamine (Gibco-BRL, Gaithersburg, MD) according to the manufacturer's instructions. After 16 hours, medium was changed, and 36 hours later, supernatants and cell lysates were harvested and assayed for VII:c and VII:Ag.To obtain stable cell lines expressing recombinant VIIWT and pEDVIIMT, DHFR-deficient CHO cells (CHO-DUKX-B11)18 (gift of Dr Barbara C. Furie, Boston, MA) were transfected with the pED expression vectors. These cells were grown in alpha modified essential medium (AMEM) supplemented with 10% FBS, 2 mM L-glutamine, 10 mM HEPES (pH 7.2), 100 U/mL penicillin G, 100 µg/mL streptomycin, 5 µg/mL vitamin K1, 10 µg/mL adenosine, 10 µg/mL deoxyadenosine, and 10 µg/mL thymidine. CHO-DUKX-B11 cells were plated on 100-mm culture dishes at a density of 3 × 106 cells per dish. Transfections were performed as described above with 15 µg of either pEDVIIWT or pEDVIIMT plasmid and 45 µL lipofectamine. Two days after transfection, cells were divided at a 1:8 ratio and selected for DHFR expression using medium deficient in ribonucleosides and deoxyribonucleosides. Twelve days after transfection, 14 colonies were picked at random and cultured in 12-well (24-mm) plates. At day 20, when the cells achieved confluence, each well was split into 2 35-mm dishes. At 90% confluence, cell lysates were prepared and assayed for VII:Ag by ELISA. Metabolic labeling studies Nearly confluent 100-mm dishes of transiently transfected COS-1 cells or stably transfected CHO cells expressing recombinant VII were used for pulse chase experiments. Fresh media with FBS was added 4 hours before cells were deprived of methionine for 30 minutes and labeled for 15 minutes with 2 mL methionine-free AMEM (Gibco) containing 1.48 MBq (400 µCi) Expre35S (sulfur 35) Protein Labeling Mix (approximately 73% L-35S-methionine and approximately 22% L-35S-cysteine) (DuPont NEN Research Products, Billerica, MA) in a 5% CO2 atmosphere at 37°C. A chase was then performed in 2 mL medium containing an excess of unlabeled L-methionine (Gibco) for various time periods. At each time-point, medium was harvested and PMSF added to a final concentration of 1 mM. Cell extracts were prepared in 600 µL ice-cold NP-40 lysis buffer 50 mM
sodium chloride (NaCl), 50 mM Tris (pH 8.0), and 1% (wt/vol)
NP-40supplemented with 1 mM PMSF. The cell lysates were precleared
overnight at 4°C with 100 µL 20% (vol/vol) fixed
Staphylococcus aureus Cowan I (SAC) coupled with a rabbit
antimouse immunoglobulin G (IgG) (Sigma Chemical Co, St Louis, MO) in
NP-40 lysis buffer.
Immunoprecipitation of VII was accomplished by incubating precleared cell lysates and conditioned media with 25 µg mAb MC1476 for 4 hours at 4°C. The resulting immune complexes were adsorbed with 70 µL 20% (vol/vol) Protein A Sepharose (Sigma) coupled 5:1 (vol/vol) with rabbit antimouse IgG antiserum in NP-40 lysis buffer. Pellets were washed 4 times in NP-40 lysis buffer, resuspended either in buffer for further enzymatic digestion (see below) or in polyacrylamide gel electrophoresis (PAGE) sample buffer with or without reducing agents, and denatured by heating to 95°C for 5 minutes. The immunoprecipitated proteins were resolved by sodium dodecyl sulfate (SDS)-PAGE in 8% (wt/vol) gels, and the radioactivity incorporated into VII bands was analyzed using a Bio-Rad model 501 PhosphorImager (Bio-Rad Laboratories) and radiography on X-OMAT-AR film (Eastman-Kodak Co, Rochester, NY). In vitro transcription/translation of VIIWT and VIIMT We linearized 1 µg pT7-VIIWT and pT7-VIIMT by EcoRI digestion and incubated the plasmids in rabbit reticulocyte-coupled transcription/translation reactions (Promega Company, Madison, WI) for 90 minutes at 30°C. We included 0.74 MBq (20 µCi) of translation-grade methionine (DuPont-New England Nuclear, Billerica, MA) in the reactions to label the synthesized VII protein, and a control reaction to which no plasmid DNA had been added was run in parallel. Aliquots of the reactions were electrophoresed on a 12% polyacrylamide gel under denaturing conditions.Effect of protein degradation inhibitors on VIIWT and VIIMT levels To study the effect of protein degradation inhibitors on VII biosynthesis, confluent stably transfected CHO cells grown in 100-mm dishes were incubated with media containing 50 mM ammonium chloride, 100 µM leupeptin, 50 µg/mL N-acetyl-leucine (L)-L-Norleucinal, or 10 µg/mL Brefeldin A (Sigma) dissolved according to the manufacturer's recommendations and used at previously published concentrations.19-23 After 4 hours, cell lysates were harvested and assayed for VII:Ag.
Coagulation assays and genomic studies A 5-year-old female patient from Oman exhibited moderately severe bleeding episodes. Coagulation assays revealed a severe VII deficiency with less than 1% VII:c and 10% VII:Ag. The asymptomatic parents had VII:c levels of 50% (mother) and 60% (father). To determine the molecular abnormality causing the VII deficiency in the patient, the entire coding region and 490 bp of promoter region of the F7 gene were amplified and screened by SSCP and heteroduplex analysis. An abnormally migrating fragment was detected in exon 8 by SSCP analysis. Sequence analysis of this fragment demonstrated a homozygous insertion-type mutation located at nucleotide 10554. This insertion was an in-frame 15-bp (5-codon) duplication from L213 {73} to D217 {77} inclusive (CTC AGC GAG CAC GAC) and was located between codons 217 and 218.Structural analysis of the mutant VIIa The importance of the 5-residue insertion for VIIa function was revealed by the superimposition and viewing of the crystal structure for the VIIa-TF complex and 2 structures for unbound VIIa (PDB codes, 1dan, 1qfx, and 1cvw). All 3 structures showed that the L213-D217 {73-77} sequence had identical conformations at a surface loop in the first subdomain of the catalytic serine protease domain. They occur within a sequence 210-EHDLSEHDGDEQSRR-224, in which 10 residues possess charged side chains, and half are buried from solvent. A network of buried hydrogen bonds and salt bridges occur within this loop, which is highly exposed to solvent and is adjacent to the active site cleft between the 2 subdomains of the catalytic domain. The loop is followed by the long -strand G with many buried side chains that pass over
the top of the domain surface and end at A242 {102} of the H-D-S
(serine) catalytic triad.7 The insertion of 5 residues at
this location is therefore expected to disrupt the correct formation of
the loop and the insertion of -strand G into the protein surface,
and the insertion may lead to misfolded protein that may be degraded or
not secreted.
In addition to the possibility of misfolding, the insertion coincides
with a calcium binding site formed by direct metal contacts with the
side chains of G210 {70} and G220 {80} and with the main-chain oxygen atoms of D212 {72} and G215 {75}. Two water molecules
fill the 2 remaining calcium coordination sites (Figure
2A). All 6 oxygen-calcium bond lengths
range between 0.21-0.24 nm (2.1-2.4 Å) (PDB code, 1cvw). The insertion
will directly affect the G215-calcium interaction, as Figure 2A shows
that the correct main-chain conformation on the loop from D212 {72}
to G215 {75} is critical for this calcium binding site. It is also
likely that the 15-bp insertion will disrupt the G220 interaction with
calcium. To visualize the possible effects of the L213-D217 insertion
on VIIa, its sequence was added to the crystal structure of VIIa by
homology modeling methods. This was most simply achieved by the
deletion of H216 {76} and D217 {77} and reorienting these 2 residues outwards in order to permit the subsequent addition of the 5 additional amino acid residues. Figure 2B shows that the loop could be
readily incorporated into the VIIa structure without steric problems.
This indicated that mutant VIIa might form a folded protein, although
it was not possible to comment on the probability of this correct
folding taking place.
Expression studies To investigate the influence of the insertion mutation, the pEDVIIWT and pEDVIIMT vectors were expressed in COS-1 cells by transient transfection. ELISA assays of the cell lysates demonstrated that VII:Ag levels of WT (80 ng/mL in 3 × 106 cells plated in 36 hours) and MT (75 ng/mL in 3 × 106 cells plated in 36 hours) were similar. However, the VII:Ag levels in the conditioned media of MT were significantly reduced to 5% (7 ng/mL) of WT (140 ng/mL) (Figure 3). No VII procoagulant activity was detectable in the conditioned media of cells transfected with VIIMT (VII:c < 1%), which is consistent with the result obtained by assay of the patient's plasma. Recombinant VIIWT, in contrast, had normal procoagulant activity that was similar to the level of VII:Ag.
To compare the synthesis of VIIWT and VIIMT proteins, in vitro transcription/translation assays were performed. This experiment showed that when both the mRNA and the nascent protein were protected from degradation, equivalent amounts of VIIWT and VIIMT proteins were produced. It was noted that the VIIMT protein, which contained the additional 5 amino acids, migrated more slowly than the VIIWT protein under denaturing conditions (Figure 2). We then investigated VII biosynthesis and secretion in CHO cells stably transfected with pEDVIIWT or pEDVIIMT cDNA. Following a 15-minute pulse with 35S-methionine, a chase was performed at 0, 30, 60, 120 and 240 minutes. At each time-point, the recombinant VIIWT in cell lysates was immunoprecipitated with mAb1476. Detectable levels of VIIWT were maximal at 60-120 minutes and decreased after this time as a consequence of protein secretion. Approximately similar amounts of intracellular protein appeared to be synthesized for VIIWT and VIIMT (Figure 3A, lanes 1-5 and 6-10). No intracellular accumulation was observed for VIIMT (Figure 3A, lanes 1-10). However, in the conditioned media, VIIMT was barely detectable at 120 minutes (Figure 3B, lane 7), and there was only a very small amount (5% to 10% VIIWT) after 240 minutes (Figure 3B, lane 8). The same difference in the electrophoretic mobility between VII WT and VIIMT in the transcription/translation experiment was also present in the immunoprecipitation analysis (Figure 3A,B). Effects of protein degradation inhibitors on VII biosynthesis Because metabolic labeling studies indicated that the VIIMT protein was neither accumulating within the cell nor being secreted, we hypothesized that it might undergo intracellular degradation. We analyzed by ELISA the effects of various inhibitors of protein degradation on the intracellular VII levels in stably transfected CHO cells (Table 1). NH4Cl, a general inhibitor of lysosomal proteolysis, modestly increased WT VII:Ag levels (P = .001) but not MT VII:Ag levels (P = .74). Also, treatment with leupeptin, which inhibits cathepsins B, D, H, and L, did not change VII:Ag levels significantly, demonstrating that VIIMT is not likely to be degraded in the lysosome. We also investigated the effect of Brefeldin A on intracellular levels of VII:Ag. Brefeldin A is a compound that blocks protein transport from the endoplasmic reticulum to the Golgi complex and causes retrograde translocation of Golgi components back to the endoplasmic reticulum. Intracellular levels of VIIWT were increased by 55% after treatment with Brefeldin A (P < .0001), but there was no significant difference for levels of VIIMT (P = .12). This result suggests that partial degradation of the mutant protein occurs in a preGolgi compartment.
The vast majority of mutations in the F7 gene are missense mutations, but a few nonsense mutations and small deletions have also been reported.6,7 We report a novel homozygous insertion-type mutation that causes a severe deficiency of VII. The insertion was localized between codons 217 and 218, leading to a duplication of codons 213 to 217. This mutation appears to be a classic case of slipped mispairing between 2 copies of a direct repeat (GCG AGC ACG AC) separated by 4 bp, in which the wild type evolved by internal duplication, thereby setting up the possibility of a mutation caused by slipped mispairing. Molecular graphic analyses of the 5-amino acid insertion in the VIIa crystal structure revealed that the insertion occurs at the calcium binding site in the catalytic domain. The 6 calcium-oxygen ligands are the same as those reported for bovine trypsin.24 As the intracellular concentration of calcium is 1.5 mM and its plasma concentration is 2.5 mM, VII is expected to interact with calcium as soon as it is synthesized. This report describes experiments that characterize the first mutation directly affecting this VII calcium binding site, and the lack of detectable procoagulant activity in VIIMT stresses the importance of this site for the normal function of VII. Similar intracellular levels of VII:Ag measured by ELISA or detected by immunoprecipitation confirmed the normal synthesis of VIIMT. In contrast, the reduced levels of VII:Ag observed in conditioned media supported our hypothesis of a secretion defect caused by the insertion mutation. After 240 minutes of chase, very small amounts of labeled VIIMT were detected in the conditioned media. However no intracellular VII accumulation was seen, which suggests the additional possibility of intracellular degradation. Thus, we chose to block various pathways of protein biosynthesis and transportation using NH4Cl (an inhibitor of lysosomal degradation) and leupeptin (an inhibitor of cathepsins B, D, H, and L). These inhibitors did not markedly change intracellular VII:Ag levels. However, treatment with Brefeldin A, an agent that usually blocks protein transport from the endoplasmic reticulum to the Golgi complex and causes translocation of Golgi components back to the endoplasmic reticulum, caused the intracellular level of VIIWT to increase by 55%, whereas no significant difference was seen for VIIMT. The small amount of VIIMT protein secreted by transfected cells showed no coagulant activity in a one-stage coagulation assay, and this confirmed the phenotype of the patient. The lack of activity in secreted VIIMT is well-explained in terms of the direct perturbation of 2 calcium binding sites at the main-chain carbonyl atoms of D212 and G215, which can affect either the activation of VIIa and/or the substrate or TF binding activity of VIIa. The insertion of 5 residues implies that the loop main-chain structure will be modified and that many of the side-chain interactions between buried residue pairs involving H216, D217, D219, G220, G221, and arginine (R)223 will no longer be possible. Thus, the insertion is expected to disrupt the side-chain positions of the 2 other calcium binding ligands at G210 and G220. In agreement with the modeling, alanine-scanning mutagenesis has shown that mutations in the side chains of G210, D212, L213, and G220 lead to marked decreases in proteolytic function without affecting TF binding.25 Mutants involving G220 reduced the coagulant activity of VII to 0.1%.26 Even though the homology modeling shows that it was possible to add a surface loop to the surface of VII, the correct formation of folded mutant VIIa may be difficult to achieve for reason of the extensive side-chain interactions in this loop region. If so, this would lead to the misfolding of the catalytic domain of VIIMT. Accordingly VIIMT may either be secreted at lower levels or be abnormally degraded. This explanation would account for the observed reduction in the VIIMT:Ag level when this was measured using 2 mAbs specific for the VIIa light chain.9,12 In conclusion, we report the first insertion mutation in the F7 gene and the first naturally occurring mutation to be associated with the VII calcium binding site in the catalytic domain. This mutation is associated with various defects including abnormal folding, intracellular degradation, secretion failure, and lack of detectable procoagulant activity.
We thank Drs P. V. Jenkins and J. Hinshelwood for assistance with the molecular graphics modeling.
Submitted July 7, 2000; accepted October 16, 2000.
Supported by the Katharine Dormandy Trust for Haemophilia and Allied Disorders and the Medical Research Service of the Department of Veterans Affairs.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Flora Peyvandi, Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, Via Pace, 9-20122, Milan, Italy; e-mail: flora.peyvandi{at}unimi.it.
1.
Hagen FS, Gray CL, O'Hara P, et al.
Characterization of a cDNA coding for human factor VII.
Proc Natl Acad Sci U S A.
1986;83:2412-2416
2.
Bauer KA, Kass BL, Ten Cate, Hawiger JJ, Rosenberg RD.
Factor IX is activated in vivo by tissue factor mechanism.
Blood.
1990;76:731-736
3.
Osterud B, Rappaport S.
Activation of factor IX by the reaction product of tissue factor and factor VII additional pathway for initiating blood coagulation.
Proc Natl Acad Sci U S A.
1977;74:5260-5264
4.
O'Hara PJ, Grant FJ, Haldeman BA, et al.
Nucleotide sequence of the coding region for human factor VII, a vitamin K dependent protein participating in blood coagulation.
Proc Natl Acad Sci U S A.
1987;84:5158-5162 5. Peyvandi F, Mannucci PM, Asti D, Abdoullahi M, Di Rocco N, Sharifian R. Clinical manifestation in 28 Italian and Iranian patients with severe factor VII deficiency. Haemophilia. 1997;3:242-246. 6. Cooper DN, Millar DS, Wacey A, Banner DW, Tuddenham EGD. Inherited factor VII deficiency: molecular genetics and pathophysiology. Thromb Haemost. 1997;78:151-160[Medline] [Order article via Infotrieve]. 7. Peyvandi F, Jenkins PV, Mannucci PM, et al. Molecular characterisation and three-dimensional structural analysis of mutations in 21 unrelated families with inherited factor VII deficiency. Thromb Haemost. 2000;84:250-257[Medline] [Order article via Infotrieve]. 8. Ashton AW, Boehm MK, Johnson DJD, Kemball-Cook G, Perkins SJ. The solution structure of human coagulation factor VIIa in its complex with tissue factor: a study of a heterodimeric receptor-ligand complex by X-ray and neutron scattering and computational modelling. Biochemistry. 1998;37:8208-8217[CrossRef][Medline] [Order article via Infotrieve]. 9. Banner DW, D'Arcy A, Chene C, et al. The crystal structure of the complex of blood coagulation factor VIIa with soluble tissue factor. Nature. 1996;380:41-46[CrossRef][Medline] [Order article via Infotrieve].
10.
Pike ACW, Brzozowski AM, Roberts SM, Olsen OH, Persson E.
Structure of human factor VIIa and its implications for the triggering of blood coagulation.
Proc Natl Acad Sci U S A.
1999;96:8925-8930 11. Kemball-Cook G, Johnson DJD, Tuddenham EGD, Harlos K. Crystal structure of active site-inhibited human coagulation factor VIIa (des-Gla). J Struct Biol. 1991;27:213-223. 12. Coppola R, Tombesi S, Valentini F, Alborali S, Albertini A, Mannucci PM. Enzyme-linked immunosorbent assay of human factor VII based upon a monoclonal antibody that recognizes the native conformation of the protein. Thromb Res. 1992;68:283-293[CrossRef][Medline] [Order article via Infotrieve]. 13. Kunkel LM, Smith KD, Boyer SH, et al. Analysis of human Y chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci U S A. 1997;74:1245-1249. 14. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using polymerase chain reaction. Genomics. 1989;5:874-879[CrossRef][Medline] [Order article via Infotrieve]. 15. Broze GJ. Monoclonal antihuman factor VII antibodies: detection in plasma of a second protein antigenically related to factor VII. J Clin Invest. 1985;76:937-946.
16.
Jenkins PV, Pasi J, Perkins SJ.
Molecular modeling of ligand and mutation sites of the Type A domains of human von Willebrand factor and their relevance to von Willebrand disease.
Blood.
1998;91:2032-2044
17.
Arbini AA, Mannucci PM, Bauer KA.
A Thr359Met mutation in factor VII of a patient with a hereditary deficiency causes defective secretion of the molecule.
Blood.
1996;87:5085-94
18.
Chasin LA, Urlaub G.
Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity.
Proc Natl Acad Sci U S A.
1980;77:4216-4220 19. Jensen T, Loa M, Pind S, Williams D, Goldberg A, Riordan J. Multiple proteolytic system including the proteasome contribute to CFTR processing. Cell. 1995;83:129-135[CrossRef][Medline] [Order article via Infotrieve].
20.
Lukacs G, Mohamed A, Kartner N, Chang X, Riordan J, Grinstein S.
Conformational maturation of CFTR but not its mutant counterpart (
21.
Pipe S, Kaufman R.
Factor VIII C2 domain missense mutations exhibit defective trafficking of biologically functional proteins.
J Biol Chem.
1996;271:25671-25676
22.
Field M, Moran P, Li W, Keller G, Caras I.
Retention and degradation of proteins containing an uncleaved glycosylphosphatidylinositol signal.
J Biol Chem.
1994;269:10830-10837 23. Qu D, Teckmen J, Omura S, Perlmutter D. Degradation of a mutant secretory protein, al-antitrypsin Z, in the endoplasmic reticulum requires proteasome activity. J Biol Chem. 1996;271:2791-2795.
24.
Bode W, Schwager P.
The single calcium binding site of crystalline bovine
25.
Dickinson CD, Kelly CR, Ruf W.
Identification of surface residues mediating tissue factor binding and catalytic function of the serine protease factor VIIa.
Proc Natl Acad Sci U S A.
1996;93:14379-14384 26. Wildgoose P, Foster D, Schiødt J, Wiberg FC, Birktoft JJ, Petersen LC. Identification of a calcium binding site in the protease domain of human blood coagulation factor VII: evidence for its role in factor VII-tissue factor interaction. Biochemistry. 1993;32:114-9[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  P. M. Mannucci, S. Duga, and F. Peyvandi Recessively inherited coagulation disorders Blood, September 1, 2004; 104(5): 1243 - 1252. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
-carboxy-glutamic
acid-rich domain followed by 2 epidermal growth factor (EGF)-like
modules. The heavy chain consists of the catalytic domain. The
F7 gene is 12.8 kb in length and is located 2.8 kb away from
the F10 gene on the long arm of chromosome 13.
80°C until use.
F508) occurs in the endoplasmic reticulum and require ATP.
EMBO J.
1994;13:6076-6086