|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
A congenital dysfibrinogenemia,
fibrinogenNieuwegein, was discovered in a young man
without any thromboembolic complications or bleeding. A homozygous
insertion of a single nucleotide (C) in codon A Fibrinogen is a 340-kd glycoprotein that is present
in the blood at a concentration of approximately 3 mg/mL.1
It is composed of 6 polypeptide chains ( The structure of the fibrin network present in the fibrinous exudate is
an important determinant in the extent of capillary tube
formation.11-13 The architecture of the fibrin network and its fibrinolytic sensitivity are determined by the rate of
polymerization and its extent of cross-linking.14-17 The
carboxyl-terminal region of the A Several endothelial cell receptors interact with different domains in
the fibrinogen molecule.23-25 Integrins are heterodimers, composed of an Congenital dysfibrinogenemias, fibrinogens with structural or
functional defects, have proven not only to be valuable tools to study
structure-function relationships in the fibrinogen
molecule,33 but also to investigate interactions of
various cells with fibrinogen and fibrin.34 In the present
study, we characterized a new congenital dysfibrinogenemia,
fibrinogenNieuwegein, with a truncated A Coagulation studies
Purification of fibrinogen
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of plasma and immunoblot analysis Fibrin monomers were prepared by clotting plasma with Reptilase. After washing of the clot with PBS, fibrin monomers were dissolved in 0.025 M acetic acid. Fibrin monomers were reduced with 7% wt/vol -mercaptoethanol and subjected to electrophoresis on a 0.1% sodium
dodecyl sulfate (SDS), 10% wt/vol polyacrylamide gel (PAGE) (Biorad,
Hercules, CA) according to Laemmli.37 For Western
blotting, plasma or fibrin monomers were subjected to SDS-PAGE (Biorad)
using 5% wt/vol or 4% to 16% wt/vol gradient gels, and proteins were
semidry blotted onto a nitrocellulose filter. The blots were incubated
with monoclonal antibodies (mAbs) against the amino-terminus
(Y18)38 and the carboxy-terminus of the A -chain of
fibrinogen (G8),39 a
rabbit-antihuman-fibrinogen,40 or a rabbit-antihuman
albumin (Nordic, Tilburg, The Netherlands). The antibodies were coupled
to horseradish peroxidase and used in dilutions of 1:1000, 1:10 000,
1:3000, and 1:1000, respectively.
Fibrin structure Turbidity of the fibrin network. Human fibrin gels were prepared in 96-well plates by addition of 1 µL 10 U/mL thrombin (Leo Pharmaceutical Products, Weesp, The Netherlands) to 100 µL 3 mg/mL fibrinogen dialyzed against PBS. After 4 hours of polymerization, the turbidity of fibrin gels, which is dependent on fiber thickness,41 was measured at 340 nm by using a Titertek reader (Titertek Multiscan, Flows Labs, McLean, VA). Scanning electron microscopy of fibrin. Plasma was clotted on a formvar-coated 200-mesh nickel grid by the addition of 1 U/mL thrombin. After clotting, fibrin was washed, fixed with 2% glutaraldehyde, dehydrated with a serial dilution of ethanol, transferred in 100% acetone, and dried using a Polaron critical point drying apparatus. The samples were coated with gold and examined in a Hitachi scanning electron microscope. DNA isolation and DNA sequencing Genomic DNA was isolated from white blood cells42 and the DNA encoding the carboxy-terminal part of the A-chain from
amino acid 391 to 625, corresponding to exon V, was amplified by
polymerase chain reaction (PCR), using as forward oligonucleotides
6A (TGGGGCACATTTGAAGAGGTGTCA) and as reverse CD2
(GGAACTTACAGTCGACCACAAAAACAGACC). The 829-bp PCR product of
fibrinogen A-gene was sequenced by Baseclear
(Leiden, The Netherlands).
Cell culture Human foreskin microvascular endothelial cells were isolated, cultured, and characterized as previously described.43 Cells were cultured until confluence at 5% CO2/95% air on fibronectin-coated dishes in M199 supplemented with 2 mM L-glutamine, 20 mM HEPES (pH 7.3) (Biowitthaker, Verviers, Belgium), 10% heat-inactivated human serum (serum pooled from 10 donors, obtained from a local blood bank), 10% heat-inactivated newborn calf serum (GIBCO BRL, Paisley, Scotland), 150 µg/mL crude endothelial cell growth factor supplement (ECGFs) (prepared from bovine brain as described by Maciag and coworkers44), 5 U/mL heparin (Leo Pharmaceutical Products), 100 IU/mL penicillin, and 100 µg/mL streptomycin (Biowitthaker). Subsequently, the endothelial cells were detached by treatment with trypsin/EDTA and transferred to fibronectin-coated dishes with a split ratio of 1:3. Confluent endothelial cells were used at passage 11.In vitro angiogenesis Preparation of fibrin gels. Human fibrin gels were prepared in 96-well plates by addition of 2 µL 100 U/mL thrombin to 100 µL 3 mg/mL fibrinogen in PBS, pH 7.4. Bovine TG (Sigma Chemicals, St Louis, MO), human TG (purified from red blood cells according to Lobitz and coworkers45), or factor XIIIa (a kind gift from Dr H. Boeder and Dr P. Kappes, Centeon Pharma, Marburg, Germany) was added in different concentrations together with 5 mM CaCl2. After 4 hours of polymerization, thrombin was inactivated by equilibrating the gels for 12 hours with 0.2 mL M199 containing 10% human serum and 10% newborn calf serum. Inhibiting mAbs or peptides were added during this equilibration period to allow diffusion into the fibrin matrix. All experiments were performed with duplicate wells. Altering the pH prior to polymerization by adding HCl (to pH 7.0) or NaOH (to pH 7.8) changes the structure of the formed fibrin network.46In vitro angiogenesis model. Endothelial cells were detached from the fibronectin-coated dishes with trypsin/EDTA and seeded on the fibrin matrices in a confluent density. After 24 hours the medium was replaced with medium containing different test compounds. Every 48 hours the medium was changed and collected, for a total of 4 to 6 days. Accumulation of fibrin degradation products in the conditioned media was assayed by a specific fibrin degradation enzyme-linked immunosorbent assay (ELISA; Organon Teknika, Boxtel, The Netherlands). The formation of tubular structures of endothelial cells by invasion in the underlying matrix was analyzed by phase contrast microscopy. Quantification of the length of the formed structures was performed by a computer equipped with Optimas image analysis software and a monochrome CCD camera (MX5) connected to it.47 Cross-sectional analysis of the formed structures revealed that they reflected tubular structures or invaginations in the underlying fibrin matrix.12,47 Immunohistochemical analysis of the formed capillary-like tubular structures Fibrin matrices were fixed in 4% P-formaldehyde in PBS, pH 7.4 for 2 hours at 4°C. After fixation the fibrin matrices were washed overnight with 5% sucrose in PBS and embedded in Tissue-Tek (Sakura, Zoeterwoude, The Netherlands) and snap-frozen in precooled 2-methyl butane and stored at 80°C. For
immunohistochemical analysis sections 7 µm thick were made throughout
the whole specimen and the sections were fixed on the slide by 4%
P-formaldehyde in PBS. Incubation with the primary antibody
(CD-51, a mAb against the v-chain was used at a
concentration of 1:100) was in dakodiluent (Dako, Carpinteria, CA) for
1 hour at room temperature. As secondary antibody antimouse-Cy3 (Sigma
Chemicals) was used in a 1:100 dilution for a 1-hour incubation. After
washing the sections were mounted with Vectashield (Vector
Laboratories, Burlingame, CA).
Adhesion of endothelial cells to fibrin Fibrin matrices were prepared in a 96-well plate. After clotting the matrices were equilibrated with M199 with 1% wt/vol human serum albumin (HSA) (CLB, Amsterdam, The Netherlands) with or without the addition of anti-v3-antibodies
(LM609, Chemicon, Temecula, CA) or c-RGD peptides (c-RGD, ie,
cyclo(-Arg-Gly-Asp-D-Phe-Val) (Bachem United Kingdom, Saffron Walden,
United Kingdom), for a period of 12 hours. The hMVEC-forming confluent
monolayers were detached by trypsin/EDTA, sedimented by centrifugation
at 250g for 5 minutes, and resuspended in 1% wt/vol HSA in
M199 in a concentration of 50 000 cells/mL. A volume of 150 µL of
the cell suspension was added to the wells and allowed to attach
for 2 hours at 37°C. The wells were washed 3 times to remove
unattached cells and fixed with 2% P-formaldehyde, after
which adhered cells were counted. The amount of attached cells was
expressed as a percentage value relative to the numbers of cells
attached to normal fibrin.48
Statistics Experiments were performed with duplicate wells and expressed as percent of control. For statistical analysis the ANOVA was used followed by a modified t test according to Bonferroni.
Coagulation parameters of normal plasma and plasmaNieuwegein A 35-year old man showed a prolonged activated partial thrombin time, which was determined routinely prior to a biopsy procedure. The clotting time of this plasma, as determined by the Clauss assay, was prolonged (clotting times for normal plasma and patient plasma were 4.5 and 15 seconds, respectively). This delayed clotting occurred despite a normal plasma concentration of fibrinogen (1.7 mg/mL), suggesting an abnormality in the patient's fibrinogen molecule. This fibrinogen is further referred to as fibrinogenNieuwegein. When plasma was clotted by the addition of thrombin (1 U/mL), the turbidity at 340 nm increased progressively with normal plasma but not with plasmaNieuwegein (Figure 1A). Differences in turbidity were also observed when normal plasma and the patient's plasma were clotted with Reptilase or when purified fibrinogens were used (data not shown).
Determination of the fibrin structure by scanning electron microscopy To visualize the fibrin networks, normal plasma and plasmaNieuwegein were clotted by the addition of 1 U/mL thrombin and the formed network was analyzed by scanning electron microscopy. Consistent with the turbidity data, the fibrin network formed from fibrinogenNieuwegein (fibrinNieuwegein) was tighter than the network formed from normal fibrinogen and consisted of thin fibrin fibers instead of the thick fibrin bundles of normal fibrin (Figure 1B,C).SDS-PAGE and immunoblot analysis of fibrin monomers and plasma The different molecular forms of fibrinogen in plasmaNieuwegein and control plasma were analyzed under nonreducing conditions (Figure 2A). Although control plasma contained the pattern of fibrinogen molecules consistent with high-molecular-weight (HMW) fibrinogen (340 kd), low-molecular-weight (LMW) fibrinogen (300 kd), and LMW fibrinogen (270 kd) (Figure 2A, lane 2),49,50 a large heterogeneity of fibrinogen molecules with aberrant molecular masses was found in plasmaNieuwegein (Figure 2A, lane 1).
To further evaluate the nature of the altered structure of the
fibrinogenNieuwegein molecule, the individual fibrinogen
chains were characterized. To this end, fibrin monomers were derived from plasmaNieuwegein by Reptilase treatment, and
subsequently analyzed by SDS-PAGE under reducing conditions. Whereas in
control plasma 3 bands corresponding to the A Amplification and DNA sequence analysis of exon V of the
fibrinogen A -chain of fibrinogenNieuwegein revealed that in the triplet coding
for A 453 (proline) a cytosine residue is inserted, altering the
sequence from CCT to CCC. This insertion alters the reading frame,
changing the GAT sequence, the codon for A 454 (asparagine), to a
termination codon (TGA). The normal sequence for the A-chain was not
detected in the amplified DNA, indicating that the patient is
homozygous for this mutation. This insertion results in a truncated
A-chain lacking the amino acids 454 to 625. As shown for
fibrinogenMarburg34 and
fibrinogenMilanoIII,51 this premature chain
termination will give rise to an A-chain with an apparent mass of 46 kd on a SDS-PAGE gel according to Laemmli and also explains the
presence of fibrinogen-albumin complexes, due to disulfide formation
between the unpaired cysteine at position A 442 and a free cysteine
present in albumin.
Influence of dysfibrinogenNieuwegein on in vitro angiogenesis To investigate the effect of the structural defect of fibrinogenNieuwegein on tube formation, fibrin matrices prepared from this fibrinogen were used in an established in vitro angiogenesis model.47 When hMVEC seeded on top of a control fibrin matrix were stimulated with basic fibroblast growth factor and tumor necrosis factor- (bFGF/TNF), they invaded the
underlying fibrin matrix and formed capillary-like tubular structures
(Figure 3B). This process was accompanied
by local degradation as was evident from the accumulation of fibrin
degradation products in the conditioned medium. Cross-sectional
analysis confirmed the presence of tubular structures with a lumen
covered with endothelial cells. In agreement with our previous
findings,47 no tubular structures were formed in the
absence of bFGF/TNF- (Figure 3A). When
fibrinNieuwegein was used as a matrix, a marked reduction
in fibrin degradation products in the conditioned media (666 ± 162
ng/mL as compared to 7289 ± 217 ng/mL, n = 3) and a reduction
(75% ± 6%, n = 5) in tubular structure formation occurred
(Figure 3C). Because the outgrowth of vessels depends on the local
degradation of the underlying fibrin matrix by the
urokinase-plasminogen activator (u-PA)/plasmin system, the
concentrations of u-PA and plasminogen activator inhibitor (PAI)-1
antigen47 were determined in the conditioned media. No
differences in accumulation of these proteins in conditioned media from
cells cultured on top of a control and a fibrinNieuwegein matrix were found (data not shown).
Localization of -chain in
fibrinogenNieuwegein eliminates the RGD sequence at
position A 572-574, which constitutes an adhesion site for
endothelial v3-integrin. To investigate
whether this may be the cause of the diminished tube formation, we
first confirmed the presence of v-integrins on
endothelial cells. Immunohistochemical analysis of hMVEC cultured on
top of a normal fibrin matrix showed the presence of
v-integrins on the surface of hMVEC present in
capillary-like tubular structures in the matrix, as well as in cells
present on top of the fibrin matrix (Figure
4).
Role of RGD sequences in fibrin and endothelial
v3 receptor during cell
adhesion and tube formation was evaluated using cyclic-RGD peptides
(c-RGD, 10 µg/mL) and an inhibiting mAb against
v3 (LM609, 10 µg/mL). This antibody completely blocks the adhesion of hMVEC to a vitronectin matrix, which indicates that endothelial cells have a
functional v3-complex (Figure
5A, compare
to Figure 4). The attachment of endothelial cells to an underlying
fibrin matrix was slightly reduced by 20% ± 9% (n = 2) by the
presence of c-RGD; addition of 25 to 50 µg/mL c-RGD reduced the
adhesion of cells in a dose-dependent fashion. The adhesion of cells
was unaffected by the presence of LM609 (95% ± 4% of control
values, n = 3) (Figure 5A). Adhesion of endothelial cells to
fibrinNieuwegein was not impaired either.
During the process of capillary-like tubular structure formation in the
underlying fibrin matrix the presence of 10 µg/mL c-RGD hardly
reduced the extent of tube formation. Addition of higher concentrations
of c-RGD (50-100 µg/mL) reduced the outgrowth to 80%. The addition
of LM609 did not alter the extent of outgrowth (80% ± 9% and
95% ± 3% of control values, n = 3, respectively) (Figure 5B).
These data indicate that Influence of the fibrin structure on in vitro angiogenesis The effect of the abnormal polymerization of fibrinogenNieuwegein on capillary-like structure formation was further analyzed in 2 ways. First, because the fibrinogen molecules in plasmaNieuwegein can form complexes with albumin, either one or 2 per molecule, albumin was added to the polymerizing fibrinogen in a 1:1 or 2:1 molar ratio to investigate the effect of albumin on fibrin structure and the formation of capillary-like tubular structures. The extent of tube formation was only slightly affected by the highest concentration of albumin tested (data not shown). This suggests that the presence of albumin per se in a fibrin matrix does not significantly influence fibrin formation and as such tube formation. These results, however, do not exclude the possibility that covalent binding of albumin to fibrinogenNieuwegein affects fibrin polymerization and as such tube formation.Second, as shown in Figure 6A, the pH of
the polymerization buffer influences the structure of the fibrin
matrices.12 An increase of pH during the polymerization of
normal fibrin from pH 7.0 to 7.8 results in a decrease of turbidity.
Analysis of tube formation reveals a parallel decrease in the tube
length formed. Similarly, an increase in turbidity of fibrin matrices prepared from fibrinogenNieuwegein was observed when the pH
of the buffer was decreased to pH 7.0 (Figure 6A), with a parallel increase (53% ± 19%) in tube formation (Figure 6B). These findings suggest that the configuration of the fibrin network is an important determinant of the outgrowth of tubes in a fibrin matrix.
Effect of cross-linking of fibrin on the extent and maintenance of tube formation Not only the bundle structure is an important factor in the architecture of the fibrin matrix, but also the extent of cross-linking. Factor XIIIa, which is present in the circulation, covalently links 2 -chains in adjacent fibrin molecules, while TG,
which is released during wounding of a vessel, covalently links 2 A-chains. The presence of factor XIIIa during the polymerization of
normal fibrin caused a concentration-dependent reduction of tube
formation (Figure 7A), resulting in a
68% ± 3% (n = 4) decrease at 10 U/mL factor XIIIa. Cross-linking
of the fibrinNieuwegein with 3 U/mL factor XIIIa resulted
in a proportional decrease (42% ± 1%, n = 5) of the length of
tubes formed.
Addition of TG during the polymerization of normal fibrin reduced the
length of the formed tubes by 42% ± 9% (n = 5) and
78% ± 5% (n = 5) for 0.02 U/mL and 0.6 U/mL TG, respectively
(Figure 7B). Addition of 0.6 U/mL TG to polymerizing
fibrinNieuwegein did not affect the extent of tubes formed
(Figure 7B). This is consistent with the absence of a cross-linking
site for TG in fibrinNieuwegein due to the deletion of the
carboxyl-terminal part of the A Interestingly, cross-linking of the normal fibrin matrix with TG retards the initiation of capillary-like tubular structure formation and as such the increase in formed tube length after 4 days. During a prolonged period of 7 days, the tubular structures in the non-cross-linked fibrin matrices were regressed to invaginations in the fibrin matrix. The structures formed in cross-linked matrices, however, appeared to be stable during the prolonged stimulation (data not shown). These data suggest that cross-linking of the fibrin matrix by TG not only affects the initiation and extent of tubular structure formation but also the maintenance of the structures formed.
In this paper we describe the effect on capillary-like
tubular structure formation of a new congenital dysfibrinogenemia, fibrinogenNieuwegein, which is characterized by the
deletion of amino acids A FibrinogenNieuwegein has characteristics that are
very similar to the previously described dysfibrinogen
Marburg34 and Milano III.51 In both congenital
dysfibrinogenemias clotting time is prolonged and the fibrin network
formed is tight. The deletion of carboxyl-terminal amino acids 454-610 in fibrinogenNieuwegein and that of amino acids 461-610 in
fibrinogenMarburg result in the presence of an unpaired
cysteine at position A Because of the deletion of the carboxyl-terminal part of A The results of this paper and previous work11-13 show that the architecture of the formed fibrin matrix plays a critical role during the formation of capillary-like tubular structures. Turbid and malleable fibrin matrices prepared from intact fibrinogen have an extensive ingrowth of tubular structures, while transparent and rigid matrices retard this process. In line with this, tube formation in the transparent fibrinNieuwegein matrix is delayed. By lowering the pH during polymerization the structure of the fibrinNieuwegein network could be partially normalized, which led to an increased tube formation. The formation of capillary-like tubular structures is dependent on pericellular fibrin degradation by invading endothelial cells,12 and the fact that the dense fibrin network is less degraded than the normal fibrin matrix explains the slower ingrowth of endothelial cells herein.12 Not only the fibrinolytic sensitivity of the matrices influences the outgrowth, but also the differences in pore size between the normal and fibrinNieuwegein network could account for the differences in formation of tubular structures in the underlying matrix. Other congenital dysfibrinogenemias with a structural defect that leads to abnormal fibrin polymerization may similarly be expected to show retarded ingrowth. Cross-linking of fibrin by factor XIIIa and TG further stabilizes the
network and thus further decreases the plasmin-mediated degradation of
the fibrin matrix.58 As a consequence endothelial cells
more slowly degrade the matrix during migration and tube formation,
which results in a retarded ingrowth of tubes. In vivo it has been
shown that an increased stability of the temporary matrix promotes
proper wound healing by ensuring that the matrix persists until tissue
regeneration is completed.59 In
fibrinNieuwegein cross-linking by factor XIIIa resulted in
a diminished tube formation, similar to the decrease observed in normal
fibrin. However, cross-linking by TG, which is more relevant for
wound repair, did not occur as a result of the deletion of the TG
cross-linking site in the carboxyl-terminal part of the A In summary, this report describes a new congenital dysfibrinogenemia
characterized by a deletion of the carboxyl-terminal part of the
A
Gaubius Laboratory, TNO-PG, Leiden, The Netherlands; Vascular Biology, Thrombosis Research Institute, London, United Kingdom; St Antonius Ziekenhuis, Nieuwegein, The Netherlands; Pharming, Leiden, The Netherlands; Institute for Cardiovascular Research, Vrije Universiteit, Amsterdam, The Netherlands.
Submitted March 27, 2000; accepted October 23, 2000.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Victor W. M. van Hinsbergh, Gaubius Laboratory, TNO-PG, Zernikedreef 9, 2333 CK Leiden, The Netherlands; e-mail: vwm.vanhinsbergh{at}pg.tno.nl.
1. Caspary EA, Kekwich RA. Some physiochemical properties of human fibrinogen. Biochemistry. 1957;41-48. 2. Blomback B, Yamashina I. On the N-terminal amino acids in fibrinogen and fibrin. Acta Chem Scand. 1957;11:194-199[CrossRef]. 3. Blomback B. Fibrinogen structure, activation, polymerization and fibrin gel structure. Thromb Res. 1994;75:327-328[CrossRef][Medline] [Order article via Infotrieve].
4.
Pisano JJ, Finlayson JS, Peyton MP.
Cross-link in fibrin polymerized by factor 13: epsilon-(gamma-glutamyl)lysine.
Science.
1968;160:892-893 5. Matacic S, Loewy AG. The identification of isopeptide crosslinks in insoluble fibrin. Biochem Biophys Res Commun. 1968;30:356-362[CrossRef][Medline] [Order article via Infotrieve]. 6. Mitkevich OV, Sobel JH, Shainoff JR, et al. Monoclonal antibody directed to a fibrinogen A alpha #529-539 epitope inhibits alpha-chain crosslinkingby transglutaminases. Blood Coagul Fibrinolysis. 1996;7:85-92[Medline] [Order article via Infotrieve]. 7. Liu HM, Wang DL, Liu CY. Interactions between fibrin, collagen and endothelial cells in angiogenesis. Adv Exp Med Biol. 1990;281:319-331[Medline] [Order article via Infotrieve]. 8. Brown LF, Van de Water L, Harvey VS, Dvorak HF. Fibrinogen influx and accumulation of cross-linked fibrin in healing wounds and in tumor stroma. Am J Pathol. 1988;130:455-465[Abstract]. 9. Ausprunk DH, Folkman J. Migration and proliferation of endothelial cells in preformed and newly formed blood vessels during tumor angiogenesis. Microvasc Res. 1977;14:53-65[CrossRef][Medline] [Order article via Infotrieve]. 10. Albelda SM, Buck CA. Integrins and other cell adhesion molecules. FASEB J. 1990;4:2868-2880[Abstract]. 11. Nehls V, Herrmann R. The configuration of fibrin clots determines capillary morphogenesis and endothelial cell migration. Microvasc Res. 1996;51:347-364[CrossRef][Medline] [Order article via Infotrieve]. 12. Collen A, Koolwijk P, Kroon ME, van Hinsbergh VWM. The influence of fibrin structure on the formation and maintenance of capillary-like tubules. Angiogenesis. 1998;2:153-165. 13. Shats EA, Nair CH, Dhall DP. Interaction of endothelial cells and fibroblasts with modified fibrin networks: role in atherosclerosis. Atherosclerosis. 1997;129:9-15[CrossRef][Medline] [Order article via Infotrieve]. 14. Weisel JW, Nagaswami C. Computer modeling of fibrin polymerization kinetics correlated with electron microscope and turbidity observations: clot structure and assembly are kinetically controlled. Biophys J. 1992;63:111-128[Medline] [Order article via Infotrieve]. 15. Blomback B, Carlsson K, Fatah K, Hessel B, Procyk R. Fibrin in human plasma: gel architectures governed by rate and nature of fibrinogen activation. Thromb Res. 1994;75:521-538[CrossRef][Medline] [Order article via Infotrieve]. 16. Matacic Cy, Loewy AG. The identification of isopeptide crosslinks in insoluble fibrin. Biochem Biophys Res Commun. 1968;30:356-360.
17.
Pisano JJ, Finlayson JS, Peyton MP.
Crosslink in fibrin polymerized by factor XIII: 18. Gorkun OV, Veklich YI, Medved LV, Henschen AH, Weisel JW. Role of alpha C domains of fibrin clot formation. Biochemistry. 1994;33:6986-6997[CrossRef][Medline] [Order article via Infotrieve]. 19. Gorkun OV, Henschen-Edman AH, Ping LF, Lord ST. Analysis of A alpha 251 fibrinogen: the alpha C domain has a role in polymerization, albeit more subtle than anticipated from the analogous proteolytic fragment X. Biochemistry. 1998;37:15434-15441[CrossRef][Medline] [Order article via Infotrieve]. 20. Cierniewski CS, Budzynski AZ. Involvement of the alpha chain in fibrin clot formation. Effect of monoclonal antibodies. Biochemistry. 1992;31:4248-4253[CrossRef][Medline] [Order article via Infotrieve].
21.
Koopman J, Haverkate F, Grimbergen J, et al.
The molecular basis for fibrinogen Dusart (Aa 554 Arg 22. Hantgan R, Fowler W, Erickson H, Hermans J. Fibrin assembly: a comparison of electron microscopic and light scattering results. Thromb Haemost. 1980;44:119-124[Medline] [Order article via Infotrieve]. 23. Chang MC, Wang BR, Huang TF. Characterization of endothelial cell differential attachment to fibrin and fibrinogen and its inhibition by Arg-Gly-Asp-containing peptides. Thromb Haemost. 1995;74:764-769[Medline] [Order article via Infotrieve].
24.
D'Souza SE, Byers-Ward VJ, Gardiner EE, Wang H, Sung SS.
Identification of an active sequence within the first immunoglobulin domain of intercellular cell adhesion molecule-1 (ICAM-1) that interacts with fibrinogen.
J Biol Chem.
1996;271:24270-24277 25. Bach TL, Barsigian C, Chalupowicz DG, et al. VE-cadherin mediates endothelial capillary tube formation in fibrin and collagen gels. Exp Cell Res. 1998;238:324-334[CrossRef][Medline] [Order article via Infotrieve]. 26. Ruoslahti E. RGD and other recognition sequences for integrins. Annu Rev Cell Dev Biol. 1996;12:697-715[CrossRef][Medline] [Order article via Infotrieve]. 27. Byzova TC, Rabbani R, D'Souza SE, Plow EF. Role of integrin alpha(V)beta3 in vascular biology. Thromb Haemost. 1998;80:726-734[Medline] [Order article via Infotrieve]. 28. Thiagarajan P, Rippon AJ, Farrell DH. Alternative adhesion sites in human fibrinogen for vascular endothelial cells. Biochemistry. 1996;35:4169-4175[CrossRef][Medline] [Order article via Infotrieve]. 29. Okada Y, Copeland BR, Hamann GF, Koziol J, Cheresh DA, Del Zoppo GJ. Integrin alphavbeta3 is expressed in selected microvessels after focal cerebral ishemia. Am J Pathol. 1996;149:37-44[Abstract]. 30. Clark RA, Tonnesen MG, Gailit J, Chersh DA. Transient functional expression of alphaVbeta3 on vascular cells during wound repair. Am J Pathol. 1996;148:1407-1421[Abstract]. 31. Brooks PC, Montgomery AM, Rosenfeld M, et al. Integrin alpha v beta 3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell. 1994;79:1157-1164[CrossRef][Medline] [Order article via Infotrieve].
32.
Friedlander M, Brooks PC, Shaffer RW, Kincaid CM, Varner JA, Cheresh DA.
Definition of two angiogenic pathway by distinct alpha v integrins.
Science.
1995;270:1500-1502 33. Koopman J, Haverkate F. Hereditary variants of human fibrinogens. In: Bloom AL,Forbes CD,Thomas DP,Tuddenham EGD, eds. Haemostasis and Thrombosis 3rd ed. London: Churchill Livingstone; 1992:515-529.
34.
Koopman J, Haverkate F, Grimbergen J, Egbring R, Lord ST.
Fibrinogen Marburg: a homozygous case of dysfibrinogenemia, lacking aminoacids A alpha 461-610 (Lys 461 AAA 35. Clauss A. Gerinnungsphysiologische schnellmethode zur Bestimmung des Fibrinogens. Acta Haematol. 1957;17:237-241[Medline] [Order article via Infotrieve]. 36. Straughn W, Wagner RH. A simple method for preparing fibrinogen. Thromb Diath Haemorrh. 1996;16:198-206. 37. Laemmli UK. Cleavage of structural proteins during the assembly of the HEAD of bacteriophage T4. Nature. 1978;175:680-684.
38.
Schielen WJ, Voskuilen M, Tesser GI, Nieuwenhuizen W.
The sequence A alpha-(148-160) in fibrin, but not in fibrinogen, is accessible to monoclonal antibodies.
Proc Natl Acad Sci U S A.
1989;86:8951-8954 39. Hoegee-de Nobel E, Voskuilen M, Briet E, Brommer EJ, Nieuwenhuizen W. A monoclonal antibody-based quantitative enzyme immunoassay for the determination of plasma fibrinogen concentrations. Thromb Haemost. 1988;60:415-418[Medline] [Order article via Infotrieve]. 40. Koopman J, Haverkate F, Koppert P, Nieuwenhuizen W, Brommer EJP, Van der Werf WGC. New enzyme immunoassay of fibrinogen-fibrin degradation products in plasma using a monoclonal antibody. J Lab Clin Med. 1987;109:76-81. 41. Ferry JD, Morrison PR. Preparation and properties of serum and plasma proteins. VIII. The conversion of human fibrinogen to fibrin under various conditions. J Am Chem Soc. 1947;69:388-400[CrossRef]. 42. Gustafson S, Proper JA, Bowie EJW, Sommer SS. Parameters affecting the yield of DNA from human blood. Anal Biochem. 1987;165:294-299[CrossRef][Medline] [Order article via Infotrieve].
43.
Defilippi P, van Hinsbergh V, Bertolotto A, Rossino P, Silengo L, Tarone G.
Differential distribution and modulation of expression of alpha 1/beta 1 integrin on human endothelial cells.
J Cell Biol.
1991;114:855-863
44.
Maciag T, Cerundolo J, Ilsley S, Kelley PR, Forand R.
An endothelial cell growth factor from bovine hypothalamus: identification and partial characterization.
Proc Natl Acad Sci U S A.
1979;76:5674-5678 45. Lobitz CJ, Buxman MM. Characterization and localization of bovine epidermal transglutaminase substrate. J Invest Dermatol. 1982;78:150-154[CrossRef][Medline] [Order article via Infotrieve]. 46. Blomback B, Okada M. Fibrin gel structure and clotting time. Thromb Res. 1982;25:51-70[CrossRef][Medline] [Order article via Infotrieve].
47.
Koolwijk P, van Erck MG, de Vree WJ, et al.
Cooperative effect of TNFalpha, FGF-2, and VEGF on the formation of tubular structures of human microvascular endothelial cells in a fibrin matrix. Role of urokinase activity.
J Cell Biol.
1996;132:1177-1188
48.
Kroon ME, Koolwijk P, van Goor H, et al.
Role and localization of urokinase receptor in the formation of new microvascular structures in fibrin matrices.
Am J Pathol.
1999;154:1731-1742 49. Mosesson MW, Galanakis DK, Finlayson JS. Comparison of human plasma fibrinogen subfractions and early plasmic fibrinogen derivatives. J Biol Chem. 1974;249:4646-4664. 50. Lipinska I, Lipinski B, Gurewich V. Fibrinogen heterogeneity in human plasma. Electrophoretic demonstration and characterization of two major fibrinogen components. J Lab Clin Med. 1974;84:509-616[Medline] [Order article via Infotrieve].
51.
Furlan M, Steinmann C, Jungo M, et al.
A frameshift mutation in exon V of the A alpha-chain gene leading to truncated A alpha-chains in the homozygous dysfibrinogen Milano III.
J Biol Chem.
1994;269:33129-33134 52. Henschen A, Lottspeich F, Kehl M, Southan C. Covalent structure of fibrinogen. Ann N Y Acad Sci. 1983;408:28-35[Medline] [Order article via Infotrieve]. 53. Mosesson MW, Siebenlist KR, Hainfeld JF, et al. The relationship between the fibrinogen D domain self-association/cross-linking site (gammaXL) and the fibrinogen Dusart abnormality (Aalpha R554C-albumin): clues to thrombophilia in the "Dusart syndrome." J Clin Invest. 1996;97:2342-2350[Medline] [Order article via Infotrieve]. 54. McDonagh RP, Carrell NA, Roberts HR, Blatt PM, McDonagh J. Fibrinogen Chapel Hill: hypodysfibrinogenemia with a tertiary polymerization defect. Am J Hematol. 1980;9:23-38[Medline] [Order article via Infotrieve].
55.
Maekawa H, Yamazumi K, Muramatsu S, et al.
An A alpha Ser-434 to N-glycosylated Asn substitution in a dysfibrinogen, fibrinogen Caracas II, characterized by impaired fibrin gel formation.
J Biol Chem.
1991;266:11575-11581 56. Defilippi P, van Hinsbergh V, Bertolotto A, Rossino P, Silengo L, Tarone G. Differential distribution and modulation of expression of alpha 1/beta 1 integrin on human endothelial cells. J Cell Biol. 1991;114:855-863.
57.
Bayless KJ, Salazar R, Davis GE.
RGD-dependent vacuolation and lumen formation observed during endothelial cell morphogenesis in three-dimensional fibrin matrices involves the alpha- (v)beta(3) and alpha(5)beta(1) integrins.
Am J Pathol.
2000;156:1673-1683 58. Carr ME Jr, Gabriel DA, McDonagh J. Influence of factor XIII and fibronectin on fiber size and density in thrombin-induced fibrin gels. J Lab Clin Med. 1987;110:747-752[Medline] [Order article via Infotrieve].
59.
Haroon ZA, Hettasch JM, Lai TS, Dewhirst MW, Greenberg CS.
Tissue transglutaminase is expressed, active, and directly involved in rat dermal wound healing and angiogenesis.
FASEB J.
1999;13:1787-1795
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  P. Lefebvre, P. T. Velasco, A. Dear, K. C. Lounes, S. T. Lord, S. O. Brennan, D. Green, and L. Lorand Severe hypodysfibrinogenemia in compound heterozygotes of the fibrinogen A{alpha}IVS4 + 1G>T mutation and an A{alpha}Gln328 truncation (fibrinogen Keokuk) Blood, April 1, 2004; 103(7): 2571 - 2576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Okumura, F. Terasawa, H. Tanaka, M. Hirota, H. Ota, K. Kitano, K. Kiyosawa, and S. T. Lord Analysis of fibrinogen gamma -chain truncations shows the C-terminus, particularly gamma Ile387, is essential for assembly and secretion of this multichain protein Blood, May 15, 2002; 99(10): 3654 - 3660. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
-chain, alters
endothelial capillary tube formation
Top
Abstract
Introduction
-(
Cys) and its association with abnormal fibrin polymerization and thromophilia.
J Clin Invest.
1993;91:1637-1643.