|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
GENE THERAPY
From the Division of Experimental Hematology, Department
of Hematology/ Oncology, and Department of Surgery, St Jude
Children's Research Hospital, Memphis, TN.
Long-term expression of coagulation factor IX (FIX) has been
observed in murine and canine models following administration of
recombinant adeno-associated viral (rAAV) vectors into either the
portal vein or muscle. These studies were designed to evaluate factors
that influence rAAV-mediated FIX expression. Stable and persistent
human FIX (hFIX) expression (> 22 weeks) was observed from 4 vectors
after injection into the portal circulation of immunodeficient mice.
The level of expression was dependent on promoter with the highest
expression, 10% of physiologic levels, observed with a vector
containing the cytomegalovirus (CMV) enhancer/ Hemophilia B is an X-linked bleeding disorder that
results from a deficiency of blood coagulation factor IX (FIX). It
affects 1 in 30 000 males and is characterized by spontaneous and
extended bleeding episodes that can be life threatening. Current
treatment for hemophilia B with plasma-derived or recombinant FIX,
although effective at preventing and arresting hemorrhage, requires
frequent intravenous administration. Prophylactic therapy aimed at
maintaining FIX concentration at approximately 2% of physiologic
levels is effective at reducing the incidence of life-threatening
bleeds and the chronic manifestations of recurrent bleeding episodes but is prohibitively expensive and not widely available.
Considerable attention has recently focused on somatic gene therapy for
hemophilia B, as it offers the potential for persistent therapeutic
levels of circulating FIX. Although a number of gene transfer systems
have been evaluated, recombinant adeno-associated viral (rAAV) vectors
show significant promise for in vivo gene therapy for hemophilia B in
that it is possible to achieve persistent therapeutic expression of FIX
leading to the correction of the bleeding phenotype in FIX knockout
mice following a single administration of rAAV vectors.1-3
These studies have subsequently been extended to the hemophilia B dog
model in which several groups have demonstrated sustained expression of
canine FIX (cFIX), leading to amelioration of the bleeding phenotype in
some cases.4-7 Recent studies have documented the safety
of intramuscular administration of rAAV to adult men with FIX
deficiency and suggest that partially corrective levels of FIX can be
achieved.8
Although these pioneering studies have clearly established the
potential of rAAV-mediated gene therapy for hemophilia B, a number of
issues remain unresolved. Various vectors and routes of administration
have been used in different laboratories without systematic comparison.
Specifically, the relative levels of FIX achieved by intramuscular
injection versus systemic venous (tail vein) or hepatic venous (portal
vein) injection have not been defined. The propensity of rAAV to invoke
a FIX-neutralizing antibody response following intramuscular injection
but not after portal vein injections in immunocompetent animals and the
implications of these observations with respect to the use of the
intramuscular route for human gene therapy remain
unresolved.3,9-11 Our studies were designed to address
these gaps in our knowledge regarding rAAV-mediated FIX gene therapy.
rAAV-hFIX vector construction and purification
AAV vectors were made by the transient transfection method described
before.16 In brief, subconfluent 293T cells either in cell
factories (Nunc, Roskilde, Denmark) or plated on 15-cm plates were
cotransfected with the hFIX vector plasmid, a helper plasmid encoding
the adenoviral helper genes 80-XX6 necessary for AAV production and a
packaging plasmid (XX2),17 or split packing plasmids
(pRep-Ad and pCMV-Cap) using the calcium phosphate method. Cells were
harvested between 50 to 60 hours after transfection and lysed by
incubation with 0.5% deoxycholate (Fisher Scientific, Pittsburgh, PA)
in the presence of 50 U/mL Benzonase (Sigma, St Louis, MO), for 30 minutes at 37°C. Following centrifugation at 6000g, the
rAAV particles were isolated by affinity column
chromatography.18 Standard slot-blot analysis was used to
determine the vector particle titer. Contamination with wild-type (wt)
AAV was determined by a polymerase chain reaction (PCR) assay described
before.16 Aliquots of rAAV were periodically subjected to
polyacrylamide gel electrophoresis to determine the degree of
contamination with cellular proteins. The vector stocks were
consistently free of contamination with wt AAV cellular and
adenoviral proteins.
Cell culture and in vitro transduction with rAAV-hFIX
vectors
In vivo transduction with rAAV FIX vectors
Nucleic acid isolation and analysis Organs were isolated from rAAV-FIX-treated and control mice, frozen in liquid nitrogen, and then pulverized using a mortar and pestle. High molecular weight DNA was isolated from the residual material, using Genomic-tip 100/G according to the manufacturers instruction (Qiagen, Valencia, CA). For Southern blot analysis the DNA was digested with EcoRI, electrophoresed through a 0.8% agarose gel and transferred to a nylon membrane (Hybond-N+; Amersham Pharmacia) and then hybridized with an 32P-labeled
1.6-kb hFIX cDNA probe at 42°C. The intensity of the hybridization
was determined, using the STORM PhosphorImager and ImageQuant software
(Molecular Dynamics, Sunnyvale, CA). To evaluate the biodistribution of
rAAV-FIX vectors following intraportal and tail vein administration, 1 µg of genomic DNA extracted from murine liver, spleen, kidneys,
heart, and lungs was subjected to PCR using primers that amplified a
681-bp region of hFIX cDNA (5' GATCATGGCAGAATCACCAG 3' from exon 1, and
5' GCATC TTCTCCACCAACAAC 3' from exon 5). PCR conditions were as
follows: 94°C for 2 minutes and 30 cycles at 95°C for 30 seconds,
55°C for 30 seconds, and 72°C for 1 minute followed by a final
extension of 72°C for 7 minutes. Standards consisting of serial
dilutions of vector DNA in negative genomic DNA were used to quantitate
proviral copy number. Twenty percent of the samples were
electrophoresed on a 1.5% agarose gel. Integrity of DNA was determined
by amplifying a 604-bp region of the murine  -actin gene, using
appropriate primers (5' TGACGGGGTCACCCACACTGTGCCCATCTA 3' and 5'
CTAGAAGCATTTGC GGTGGACGATGGAGGG 3'). The relative intensity of the
signal was assessed digitally, using AlphaImager software version 3.24 (Alpha Innotech, San Leandro, CA).
To determine which organs expressed hFIX, total RNA was isolated from portions of liver, spleen, kidney, heart, and lungs of control mice and animals transduced with rAAV-encoding hFIX 22 weeks after portal vein administration by using RNA STAT (TEL TEST, Friendswood TX). Approximately 1 µg of total RNA from each sample was subjected to the reverse transcription conditions in the presence or absence of reverse transcriptase (RT) using the 1st strand cDNA synthesis kit for RT-PCR (Roche Molecular Biochemicals, Indianapolis, IN). Of the resulting sample, 5 µL was amplified in a 50-µL PCR reaction as described above. Detection of anti-hFIX antibodies Plasma samples from mice were screened for the presence of antibody against hFIX, using an ELISA as described previously.3 In brief, plates were coated overnight with affinity-purified hFIX protein diluted to 1 µg/mL with 0.1 M NaHCO3. Diluted plasma samples (1:64, 1:512) were then applied to these wells in duplicate, and antibody against hFIX was detected with horseradish peroxidase conjugated antimouse immunoglobulin G (IgG; Zymed Laboratories, San Francisco, CA). Titers were estimated from a standard curve derived with serial dilutions of a mouse monoclonal anti-hFIX antibody (Roche Molecular Biochemicals). The presence of anti-hFIX antibody was also confirmed by Western blot analysis as described by Dai et al,24 using the enhanced chemiluminescence kit (Amersham Pharmacia). Additionally, the positive samples were subjected to the Bethesda assay as described previously.25 In brief, citrated plasma diluted in Owren buffer was incubated with normal pooled plasma (Sigma) at 37°C for 2 hours. The residual FIX activity was then determined by using a one-step activated partial thromboplastin time. One Bethesda unit was defined as the reciprocal of the dilution of test plasma at which 50% of FIX activity is inhibited. The sensitivity of the assay was 1 Bethesda inhibitor assay unit per milliliter.Detection of anti-AAV antibodies Plasma samples taken at 2 weekly time points after rAAV administration into immunocompetent mice were mixed (1:100 and 1:500, 1:1000 dilutions) with 1 × 1010 particles of a rAAV vector in which green fluorescent protein was under the control of the CAGG promoter (rAAV CAGG-GFP) and incubated for 60 minutes at 37°C. Control reactions included plasma from transduced immunodeficient mice of the same strain. The reactions were subsequently used to transduce 1 × 105 293T cells/well in 12-well plates. Transduction efficiency was determined by assessing green fluorescent protein expression at 48 hours after exposure to the virus/antibody mix, using fluorescence-activated cell sorter analysis.
Comparison of rAAV-hFIX vectors Four different AAV vectors were constructed, each of which contained the hFIX cDNA under the transcriptional control of either constitutive (MSCV, CMV, CAGG) or liver-specific (hepatitis B enhancer/core promoter) regulatory elements (Figure 1). Splicing sequences were included between the promoter and hFIX cDNA in all the vectors, as these are critical for high-level FIX expression.26,27 The CMV and the CAGG promoter elements have been previously shown to have strong activity in muscle.3,28 The hepatitis B enhancer/core promoter complex was specifically chosen, as it has strong hepatocyte-specific activity.29,30 The activity of these rAAV-hFIX vectors was assessed in vitro by transducing 1 × 105 HepG2- or C57Bl/6-derived primary myoblasts with 1 × 1010 vector genomes. Twenty-four hours conditioned media were collected on day 4 after transduction and assayed for hFIX (Figure 2). hFIX was undetectable in conditioned media from untransduced cells. The highest levels of hFIX were achieved by transduction of HepG2 and myoblast cells with rAAV CAGG-FIX (21 ± 2 pg FIX/cell/24 hours in HepG2 cells and 9 ± 1 pg FIX/cell/24 hours in myoblasts). The CMV promoter had moderate activity (5 ± 0.2 pg FIX/cell/24 hours in HepG2 cells and 3 ± 0.3 pg FIX/cell/24 hours in myoblasts), whereas the MSCV promoter was relatively weak in both cell types (1 ± 0.3 pg FIX/cell/24 hours in HepG2 cells and 1.5 ± 0.2 pg FIX/cell/24 hours in myoblasts). Expression of hFIX was undetectable in conditioned media derived from myoblasts transduced with rAAV HBV-FIX, whereas moderate expression (6 ± 0.5 pg hFIX/cell/24 hours respectively) was observed in conditioned media derived from HepG2 cells transduced with this vector.
To compare the activity of rAAV-hFIX vectors in vivo,
1 × 1011 rAAV genomes were administered into the portal
vein of 7- to 10-week-old male C57Bl/6 SCID mice. Figure
3 shows the level of hFIX in the plasma
of recipient mice for 30 weeks following gene transfer. The profile of
expression for each vector was essentially the same, and the total
amount of hFIX expressed was consistent within each group but varied
substantially among the different vectors. FIX levels approaching 10%
of physiologic levels were detected (506 ± 61 ng/mL) at 12 weeks and
thereafter following the administration of rAAV CAGG-FIX (Figure 3A),
whereas expression from the other vectors was substantially lower
(20-54 ng/mL) (Figure 3B). The difference in the level of hFIX observed
with rAAV CAGG-FIX compared to the other vectors was highly significant
at all time points beyond 4 weeks (P < .001, using
one-way ANOVA). This difference in the level of expression was not
related to vector copy number as shown by Southern blot analysis of
genomic liver DNA from selected animals (Figure 3C). The hFIX proviral
DNA was detected in livers from each animal, ranging from approximately
0.15 to 0.3 proviral copies per diploid genome. Undigested DNA produced
a smear without bands, whereas DNA restricted with SexAI
that cuts once within the FIX cDNA vectors yielded discrete bands whose
apparent molecular weights were equivalent to that of the provirus
(data not shown). These data are consistent with previous reports that
indicate that AAV exists as high molecular weight head-to-tail
concatamers following transduction of murine
hepatocytes.31
Influence of route of administration on rAAV-mediated hFIX plasma levels and distribution and expression of the rAAV genome rAAV CAGG-FIX or rAAV CMV-FIX genomes (5 × 1010) were injected intramuscularly (quadriceps and the tibialis anterior) or intravenously via the tail or portal veins of 2 different strains of immunodeficient mice (C57Bl/6J SCID or C.B-17 SCID) using the same batch of vector. The kinetics of hFIX expression for all 3 routes of administration in the C57Bl/6 SCID mice was similar (Figure 4) with hFIX detectable at 2 weeks and reaching steady state levels by 8 weeks. These levels were maintained for the duration of the study (30 weeks). Intraportal administration of rAAV CAGG-FIX resulted in a 4-fold higher level of hFIX (peak = 436 ± 25 ng/mL) compared to intramuscular injections (peak = 143 ± 66 ng/mL). This difference was highly significant (P < .01, using one-way ANOVA). hFIX expression following administration of rAAV CAGG-FIX via the tail vein peaked at 303 ± 77 ng/mL with steady-state levels approaching 80% of that observed in the cohort of mice receiving rAAV via the portal vein. A similar pattern of expression was observed in C.B-17 SCID mice. Additionally, to determine if the difference in hFIX expression following different routes of administration was promoter specific, 1 × 1011 genomes of rAAV CMV-FIX was injected into the portal vein or muscle of 10-week-old C.B-17 SCID mice. The level of hFIX following portal vein injection was 2.4-fold higher than that observed following intramuscular injection (44 ± 15 ng/mL and 18 ± 4 ng/mL, respectively; P < .05 using paired t test).
Vector DNA was detectable in all tissue samples examined at 22 weeks
following tail vein administration of 5 × 1010 genomes of rAAV CAGG-FIX with the majority detected in the liver and spleen (Figure 5A). Intraportal administration
of the same number of rAAV CAGG-FIX particles resulted in the presence
of the transgene in the liver with no evidence of spillover to the
other organs, using a semiquantitative PCR assay capable of detecting
6 × 10
Influence of route of administration on immunogenicity of hFIX and rAAV rAAV CAGG-FIX was administered to C57Bl/6, Balb/C, and Fv129 strains of immunocompetent mice by the 3 routes of administration outlined above. Although a number of different batches of vector preparations were used, adequate precautions were taken to ensure that an equal number of animals in each of the cohort were transduced with the same batch of vector. Therapeutic levels of hFIX were detected (Figure 6) in 21 of 22 immunocompetent animals following either portal or tail vein administration of rAAV vector particles. The kinetics of hFIX expression in the C57Bl/6 mice was comparable to that observed in its immunodeficient counterpart, although the hFIX levels were lower (1 × 1011 rAAV CAGG FIX particles = 350 ± 31 ng/mL, 5 × 1010 particles = 290 ± 73 ng/mL). As with the immunodeficient animals, the hFIX levels observed following tail vein administration were 77% of those following intraportal infusion. Balb/C and Fv129 strains of mice had comparatively lower levels of hFIX (19% and 62% levels in C57Bl/6 mice, respectively) that may be a reflection of the strain-specific variations in transgene expression reported by others.2 hFIX-specific antibodies were not detected by ELISA, Bethesda, or Western blot analysis in any of these animals.
Intramuscular administration of 5 × 1010 rAAV CAGG-FIX particles resulted in undetectable levels of hFIX in any of the immunocompetent mice (n = 14) irrespective of strain. Anti-hFIX antibodies (90-512 µg/mL) were detected in the plasma of all these mice. The anti-hFIX antibodies had inhibitory activity in a Bethesda coagulation assay (15-25 BU/mL). The anti-hFIX antibody titer persisted at high levels for the duration of the study, suggesting continuing expression of the offending antigen. Histologic examination of the muscle in the vicinity of the injection site did not reveal any evidence of an inflammatory immune response (data not shown). All animals that received rAAV generated a humoral antibody response to AAV vector particles regardless of strain or route of administration (data not shown). The level of anti-AAV antibodies varied significantly in individual mice, but there was no correlation between the route of administration and antibody levels (data not shown).
Our studies were designed to evaluate parameters that influence
the levels of FIX achieved after rAAV-mediated gene transfer. With the
use of immunodeficient mouse strains, we identified the rAAV CAAG-FIX
vector that has a constitutive CMV enhancer- The vector with liver-specific promoter performed less well in the
context of the rAAV vector design then would have been predicted from
its activity in hepatocytes using adenoviral vectors.32 Conversely, the CMV enhancer- Our studies provide the first direct comparison of FIX levels achieved via the hepatic versus systemic venous circulation with the same vector preparation given at the same total dose. The fact that the systemic venous route gives 60% to 80% of the levels achieved by intraportal injection undoubtedly reflects the known propensity of rAAV to collect in liver cells.34 An important practical implication of our results is that selective delivery via the hepatic artery through a percutaneous catheter, a technically less complex and risky procedure than portal vein injections in humans, may be the preferred route for rAAV-FIX administration to patients with hemophilia. Our results suggest dose-dependent "spillover" of vector particles injected into the portal circulation. At a dose of 5 × 1010 vector particles, PCR analysis detected the rAAV genome predominantly in liver, whereas, at a dose of 1 × 1011 particles, a larger proportion of the vector genome was found in the spleen and other organs (Figure 4). Similar dose-dependent spillover has been observed when vector particles were given via the intramuscular route (ORDA web site, http://www.nih.gov/od/oba/3-99RAC.htm). Restricting the distribution of rAAV after hepatic artery injection to the liver seems desirable and may require that the dose of vector particles is kept within certain defined limits. This consideration further underscores the need to use a vector configuration that maximizes liver-specific expression. We used 2 different promoters to demonstrate that the liver is a more
potent site for rAAV-mediated FIX production than muscle irrespective
of mouse strain. This may reflect the fact that the liver is the
natural site of FIX synthesis and has the necessary machinery for
posttranslational modification of the mature protein. Although
processing of FIX in myotubules has been documented,35 the relative efficiency of the gamma-carboxylation in muscle
versus liver is unknown. More important, however, is the issue of
inhibitory antibodies to transgene products. An earlier
study3 reported neutralizing antibodies directed against
hFIX following intramuscular injection of rAAV-hFIX vector particles in
C57Bl/6 mice. Neutralizing antibodies against human Do these findings have implications with regard to human gene therapy applications? Three patients with hemophilia have now been given rAAV-hFIX particles via the intramuscular route without evidence of formation of neutralizing antibodies against FIX.8 However, a relatively low dose of rAAV vector particles was administered. Furthermore, each of the patients had a missense mutation in their FIX gene so that tolerance to FIX had undoubtedly been induced during normal development. A prior study in hemophilic dogs with a missense mutation in their FIX gene is also of some interest.6 In 2 of 5 animals given rAAV-cFIX, antibodies against cFIX were detected by Western blot analysis, with transient reduction in antigen levels. Further studies in this dog model indicate that the tendency to form neutralizing antibodies toward the transgene product following intramuscular administration is partially determined by the vector dose.10 All together, the data suggest that tolerance can be broken at least transiently in such animals. Liver-targeted delivery through the hepatic artery seems the preferred route for administration of rAAV-FIX particles, both because of the potentially higher levels of FIX achieved and the absence of an immune response. Available evidence indicates that rAAV forms head-to-tail concatamers, perhaps via a rate-limiting dimer intermediate, and integrates into liver cell chromosomes.37,38 Thus, stable production of FIX observed in animal studies is likely to persist. Antibodies to AAV, previously observed by other investigators,39,40 were also documented in our studies presumably precluding readministration of rAAV of the same serotype. If necessary, rAAV of different serotypes could be readministered to augment FIX production over time.41 Overall, rAAV seemed to hold significant promise for the treatment of hFIX deficiency.
We wish to thank Jean Johnson for her outstanding assistance in preparation of the manuscript and Professor George Brownlee for his gift of pBS-FIX.
Submitted June 5, 2000; accepted October 16, 2000.
Supported by grant P01 HL 53749 from NHLBI Program Project, by grant 94-00 from the ASSISI Foundation of Memphis, and by the American Lebanese Syrian Associated Charities (ALSAC). A.C.N. was supported by grant 049894/114 from the Wellcome Trust.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Arthur W. Nienhuis, Experimental Hematology, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, TN 38105; e-mail: arthur.nienhuis{at}stjude.org.
1. Snyder RO, Miao CH, Patijn GA, et al. Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat Genet. 1997;16:270-276[CrossRef][Medline] [Order article via Infotrieve].
2.
Wang L, Takabe K, Bidlingmaier SM, Ill CR, Verma IM.
Sustained correction of bleeding disorder in hemophilia B mice by gene therapy.
Proc Natl Acad Sci U S A.
1999;96:3906-3910
3.
Herzog RW, Hagstrom JN, Kung SH, et al.
Stable gene transfer and expression of human blood coagulation factor IX after intramuscular injection of recombinant adeno-associated virus.
Proc Natl Acad Sci U S A.
1997;94:5804-5809 4. Chao H, Samulski R, Bellinger D, Monahan P, Nichols T, Walsh C. Persistent expression of canine factor IX in hemophilia B canines. Gene Ther. 1999;6:1695-1704[CrossRef][Medline] [Order article via Infotrieve]. 5. Wang L, Nichols TC, Read MS, Bellinger DA, Verma IM. Sustained expression of therapeutic level of factor IX in hemophilia B dogs by AAV-mediated gene therapy in liver. Mol Ther. 2000;1:154-158[CrossRef][Medline] [Order article via Infotrieve]. 6. Herzog RW, Yang EY, Couto LB, et al. Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector. Nat Med. 1999;5:56-63[CrossRef][Medline] [Order article via Infotrieve]. 7. Snyder RO, Miao C, Meuse L, et al. Correction of hemophilia B in canine and murine models using recombinant adeno-associated viral vectors. Nat Med. 1999;5:64-70[CrossRef][Medline] [Order article via Infotrieve]. 8. Kay MA, Manno CS, Ragni MV, et al. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector. Nat Genet. 2000;24:257-261[CrossRef][Medline] [Order article via Infotrieve]. 9. Monahan PE, Samulski RJ, Tazelaar J, et al. Direct intramuscular injection with recombinant AAV vectors results in sustained expression in a dog model of hemophilia. Gene Ther. 1998;5:40-49[CrossRef][Medline] [Order article via Infotrieve]. 10. Herzog RW, Fields PA, Arruda VR, et al. Characterization of B- and T-cell response against factor IX in AAV vector-based gene therapy for canine hemophilia B. Mol Ther. 2000;1:S27[CrossRef]. 11. Armstrong E, Fields PA, Arruda VR, et al. Immune response in hemophilia B mice expressing a species specific transgene. Mol Ther. 2000;1:S29. 12. Niwa H, Yamamura K, Miyazaki J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991;108:193-199[CrossRef][Medline] [Order article via Infotrieve].
13.
Samulski RJ, Chang LS, Shenk TE.
A recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication.
J Virol.
1987;61:3096 14. Page SM, Brownlee GG. An ex vivo keratinocyte model for gene therapy of hemophilia B. J Invest Dermatol. 1997;109:139-145[CrossRef][Medline] [Order article via Infotrieve].
15.
Persons DA, Allay JA, Allay ER, et al.
Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo.
Blood.
1997;90:1777-1786 16. Nathwani AC, Hanawa H, Vandergriff J, Kelly P, Vanin EF, Nienhuis AW. Efficient gene transfer into human cord blood CD34+ cells and the CD34+. Gene Ther. 2000;7:183-195[CrossRef][Medline] [Order article via Infotrieve].
17.
Xiao X, Li J, Samulski RJ.
Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus.
J Virol.
1998;72:2224-2232 18. Clark KR, Liu X, McGrath JP, Johnson PR. Highly purified recombinant adeno-associated virus vectors are biologically active and free of detectable helper and wild-type viruses. Hum Gene Ther. 1999;10:1031-1039[CrossRef][Medline] [Order article via Infotrieve].
19.
Fair DS, Bahnak BR.
Human hepatoma cells secrete single chain factor X, prothrombin, and antithrombin III.
Blood.
1984;64:194-204 20. Springer ML, Blau HM. High-efficiency retroviral infection of primary myoblasts. Somat Cell Mol Genet. 1997;23:203-209[Medline] [Order article via Infotrieve]. 21. Michou AI, Santoro L, Christ M, Julliard V, Pavirani A, Mehtali M. Adenovirus-mediated gene transfer: influence of transgene, mouse strain and type of immune response on persistence of transgene expression. Gene Ther. 1997;4:473-482[CrossRef][Medline] [Order article via Infotrieve]. 22. Barr D, Tubb J, Ferguson D, et al. Strain related variations in adenovirally mediated transgene expression from mouse hepatocytes in vivo: comparisons between immunocompetent and immunodeficient inbred strains. Gene Ther. 1995;2:151-155[Medline] [Order article via Infotrieve].
23.
Kay MA, Landen CN, Rothenberg SR, et al.
In vivo hepatic gene therapy: complete albeit transient correction of factor IX deficiency in hemophilia B dogs.
Proc Natl Acad Sci U S A.
1994;91:2353-2357
24.
Dai Y, Schwarz EM, Gu D, Zhang WW, Sarvetnick N, Verma IM.
Cellular and humoral immune responses to adenoviral vectors containing factor IX gene: tolerization of factor IX and vector antigens allows for long-term expression.
Proc Natl Acad Sci U S A.
1995;92:1401-1405
25.
Kung SH, Hagstrom JN, Cass D, et al.
Human factor IX corrects the bleeding diathesis of mice with hemophilia B.
Blood.
1998;91:784-790
26.
Kurachi S, Hitomi Y, Furukawa M, Kurachi K.
Role of intron I in expression of the human factor IX gene.
J Biol Chem.
1995;270:5276-5281 27. Jallat S, Perraud F, Dalemans W, et al. Characterization of recombinant human factor IX expressed in transgenic mice and in derived trans-immortalized hepatic cell lines. EMBO J. 1990;9:3295-3301[Medline] [Order article via Infotrieve]. 28. Daly TM, Okuyama T, Vogler C, Haskins ME, Muzyczka N, Sands MS. Neonatal intramuscular injection with recombinant adeno-associated virus results in prolonged beta-glucuronidase expression in situ and correction of liver pathology in mucopolysaccharidosis type VII mice. Hum Gene Ther. 1999;10:85-94[CrossRef][Medline] [Order article via Infotrieve]. 29. Loser P, Sandig V, Kirillova I, Strauss M. Evaluation of HBV promoters for use in hepatic gene therapy. Biol Chem Hoppe Seyler. 1996;377:187-193[Medline] [Order article via Infotrieve].
30.
Hafenrichter DG, Wu X, Rettinger SD, Kennedy SC, Flye MW, Ponder KP.
Quantitative evaluation of liver-specific promoters from retroviral vectors after in vivo transduction of hepatocytes.
Blood.
1994;84:3394-3404 31. Miao CH, Snyder RO, Schowalter DB, et al. The kinetics of rAAV integration in the liver. Nat Genet. 1998;19:13-15[CrossRef][Medline] [Order article via Infotrieve]. 32. Sandig V, Loser P, Lieber A, Kay MA, Strauss M. HBV-derived promoters direct liver-specific expression of an adenovirally transduced LDL receptor gene. Gene Ther. 1996;3:1002-1009[Medline] [Order article via Infotrieve].
33.
Nakai H, Herzog RW, Hagstrom JN, et al.
Adeno-associated viral vector-mediated gene transfer of human blood coagulation factor IX into mouse liver.
Blood.
1998;91:4600-4607 34. Ponnazhagan S, Mukherjee P, Wang XS, et al. Adeno-associated virus type 2-mediated transduction in primary human bone marrow-derived CD34+ hematopoietic progenitor cells: donor variation and correlation of transgene expression with cellular differentiation. J Virol. 1997;71:8262-8267[Abstract]. 35. Arruda VR, Hagstrom JN, Herzog RW, et al. Factor IX synthesized in dog and human muscle cells has specific activity comparable to plasma-derived factor IX. Blood. 1998;92(suppl 1):2836.
36.
Song S, Morgan M, Ellis T, et al.
Sustained secretion of human alpha-1-antitrypsin from murine muscle transduced with adeno-associated virus vectors.
Proc Natl Acad Sci U S A.
1998;95:14384-14388
37.
Nakai H, Iwaki Y, Kay MA, Couto LB.
Isolation of recombinant adeno-associated virus vector-cellular DNA junctions from mouse liver.
J Virol.
1999;73:5438-5447
38.
Miao CH, Nakai H, Thompson AR, et al.
Nonrandom transduction of recombinant adeno-associated virus vectors in mouse hepatocytes in vivo: cell cycling does not influence hepatocyte transduction.
J Virol.
2000;74:3793-3803 39. Chirmule N, Propert K, Magosin S, Qian Y, Qian R, Wilson J. Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther. 1999;6:1574-1583[CrossRef][Medline] [Order article via Infotrieve].
40.
Chirmule N, Xiao W, Truneh A, et al.
Humoral immunity to adeno-associated virus type 2 vectors following administration to murine and nonhuman primate muscle.
J Virol.
2000;74:2420-2425
41.
Halbert CL, Rutledge EA, Allen JM, Russell DW, Miller AD.
Repeat transduction in the mouse lung by using adeno-associated virus vectors with different serotypes.
J Virol.
2000;74:1524-1532
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  O. Cao and R. W. Herzog TLR3 signaling does not affect organ-specific immune responses to factor IX in AAV gene therapy Blood, August 1, 2008; 112(3): 910 - 911. [Full Text] [PDF]
|
|
|
|
|
|
A. W. Nienhuis Development of gene therapy for blood disorders Blood, May 1, 2008; 111(9): 4431 - 4444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Brown, A. Cantore, A. Annoni, L. S. Sergi, A. Lombardo, P. Della Valle, A. D'Angelo, and L. Naldini A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice Blood, December 15, 2007; 110(13): 4144 - 4152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Nathwani, J. T. Gray, J. McIntosh, C. Y. C. Ng, J. Zhou, Y. Spence, M. Cochrane, E. Gray, E. G. D. Tuddenham, and A. M. Davidoff Safe and efficient transduction of the liver after peripheral vein infusion of self-complementary AAV vector results in stable therapeutic expression of human FIX in nonhuman primates Blood, February 15, 2007; 109(4): 1414 - 1421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Cao, E. Armstrong, A. Schlachterman, L. Wang, D. K. Okita, B. Conti-Fine, K. A. High, and R. W. Herzog Immune deviation by mucosal antigen administration suppresses gene-transfer-induced inhibitor formation to factor IX Blood, July 15, 2006; 108(2): 480 - 486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. J. Muller, B. Leuchs, S. T. Pleger, D. Grimm, W.-M. Franz, H. A. Katus, and J. A. Kleinschmidt Improved cardiac gene transfer by transcriptional and transductional targeting of adeno-associated viral vectors Cardiovasc Res, April 1, 2006; 70(1): 70 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Nathwani, J. T. Gray, C. Y. C. Ng, J. Zhou, Y. Spence, S. N. Waddington, E. G. D. Tuddenham, G. Kemball-Cook, J. McIntosh, M. Boon-Spijker, et al. Self-complementary adeno-associated virus vectors containing a novel liver-specific human factor IX expression cassette enable highly efficient transduction of murine and nonhuman primate liver Blood, April 1, 2006; 107(7): 2653 - 2661. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Dobrzynski, J. C. Fitzgerald, O. Cao, F. Mingozzi, L. Wang, and R. W. Herzog Prevention of cytotoxic T lymphocyte responses to factor IX-expressing hepatocytes by gene transfer-induced regulatory T cells PNAS, March 21, 2006; 103(12): 4592 - 4597. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Grimm, K. Pandey, H. Nakai, T. A. Storm, and M. A. Kay Liver Transduction with Recombinant Adeno-Associated Virus Is Primarily Restricted by Capsid Serotype Not Vector Genotype J. Virol., January 1, 2006; 80(1): 426 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Dobrzynski and R. W. Herzog Tolerance Induction by Viral In Vivo Gene Transfer Clin. Med. Res., November 1, 2005; 3(4): 234 - 240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, E. Dobrzynski, A. Schlachterman, O. Cao, and R. W. Herzog Systemic protein delivery by muscle-gene transfer is limited by a local immune response Blood, June 1, 2005; 105(11): 4226 - 4234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, R. Calcedo, T. C. Nichols, D. A. Bellinger, A. Dillow, I. M. Verma, and J. M. Wilson Sustained correction of disease in naive and AAV2-pretreated hemophilia B dogs: AAV2/8-mediated, liver-directed gene therapy Blood, April 15, 2005; 105(8): 3079 - 3086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Noro, K. Miyake, N. Suzuki-Miyake, T. Igarashi, E. Uchida, T. Misawa, Y. Yamazaki, and T. Shimada Adeno-Associated Viral Vector-Mediated Expression of Endostatin Inhibits Tumor Growth and Metastasis in an Orthotropic Pancreatic Cancer Model in Hamsters Cancer Res., October 15, 2004; 64(20): 7486 - 7490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.-Y. Jin, T.-P. Zhang, T. Gui, D. W. Stafford, and P. E. Monahan Creation of a mouse expressing defective human factor IX Blood, September 15, 2004; 104(6): 1733 - 1739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Dobrzynski, F. Mingozzi, Y.-L. Liu, E. Bendo, O. Cao, L. Wang, and R. W. Herzog Induction of antigen-specific CD4+ T-cell anergy and deletion by in vivo viral gene transfer Blood, August 15, 2004; 104(4): 969 - 977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. White, S. A. Nicklin, H. Buning, M. J. Brosnan, K. Leike, E. D. Papadakis, M. Hallek, and A. H. Baker Targeted Gene Delivery to Vascular Tissue In Vivo by Tropism-Modified Adeno-Associated Virus Vectors Circulation, February 3, 2004; 109(4): 513 - 519. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhang, L. Xu, M. E. Haskins, and K. Parker Ponder Neonatal gene transfer with a retroviral vector results in tolerance to human factor IX in mice and dogs Blood, January 1, 2004; 103(1): 143 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Davidoff, C. Y. C. Ng, J. Zhou, Y. Spence, and A. C. Nathwani Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway Blood, July 15, 2003; 102(2): 480 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Xu, C. Gao, M. S. Sands, S.-R. Cai, T. C. Nichols, D. A. Bellinger, R. A. Raymer, S. McCorquodale, and K. P. Ponder Neonatal or hepatocyte growth factor-potentiated adult gene therapy with a retroviral vector results in therapeutic levels of canine factor IX for hemophilia B Blood, May 15, 2003; 101(10): 3924 - 3932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Takahashi, Y. Hirai, M. Migita, Y. Seino, Y. Fukuda, H. Sakuraba, R. Kase, T. Kobayashi, Y. Hashimoto, and T. Shimada Long-term systemic therapy of Fabry disease in a knockout mouse by adeno-associated virus-mediated muscle-directed gene transfer PNAS, October 15, 2002; 99(21): 13777 - 13782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Nathwani, A. M. Davidoff, H. Hanawa, Y. Hu, F. A. Hoffer, A. Nikanorov, C. Slaughter, C. Y. C. Ng, J. Zhou, J. N. Lozier, et al. Sustained high-level expression of human factor IX (hFIX) after liver-targeted delivery of recombinant adeno-associated virus encoding the hFIX gene in rhesus macaques Blood, August 13, 2002; 100(5): 1662 - 1669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Davidoff, A. C. Nathwani, W. W. Spurbeck, C. Y. C. Ng, J. Zhou, and E. F. Vanin rAAV-mediated Long-term Liver-generated Expression of an Angiogenesis Inhibitor Can Restrict Renal Tumor Growth in Mice Cancer Res., June 1, 2002; 62(11): 3077 - 3083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Mount, R. W. Herzog, D. M. Tillson, S. A. Goodman, N. Robinson, M. L. McCleland, D. Bellinger, T. C. Nichols, V. R. Arruda, C. D. Lothrop Jr, et al. Sustained phenotypic correction of hemophilia B dogs with a factor IX null mutation by liver-directed gene therapy Blood, April 15, 2002; 99(8): 2670 - 2676. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
4 copies per diploid genome. Significantly more
spillover outside of the liver was observed following infusion of
1 × 10
) RT to
exclude genomic DNA amplification.
