| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Fels Institute for Cancer Research and
Molecular Biology and the Department of Biochemistry, Temple
University School of Medicine, Philadelphia, PA.
Using a variety of differentiation-inducible myeloid cell lines, we
previously showed that the zinc-finger transcription factor early
growth response gene 1 (Egr-1) is a positive modulator of macrophage
differentiation and negatively regulates granulocytic differentiation.
In this study, high-efficiency retroviral transduction was used to
ectopically express Egr-1 in myeloid-enriched or stem cell-enriched
bone marrow cultures to explore its effect on the development of
hematopoietic progenitors in vitro and in lethally irradiated mice. It
was found that ectopic Egr-1 expression in normal hematopoietic
progenitors stimulates development along the macrophage lineage at the
expense of development along the granulocyte or erythroid lineages,
regardless of the cytokine used. Moreover, Egr-1 accelerated macrophage
development by suppressing the proliferative phase of the
growth-to-macrophage developmental program. The remarkable ability of
Egr-1 to dictate macrophage development at the expense of development
along other lineages resulted in failure of Egr-1-infected
hematopoietic progenitors to repopulate the bone marrow and spleen, and
thereby prevent death, in lethally irradiated mice. These observations
further highlight the role Egr-1 plays in monocytic
differentiation and growth suppression.
(Blood. 2001;97:1298-1305) Early growth response gene (Egr) 1 is a
member of the Egr family of genes, which includes
Egr-1,1,2 Egr-2,3 Egr-3,4 and
Egr-4.5 These genes encode for zinc-finger transcription factors that have specificity to related but not identical
guanine-cytosine-rich DNA binding motifs.6,7 Egr-1 was
initially identified as an immediate-early growth response gene in
cultured fibroblasts,1,6,8 but more recent studies have
provided evidence that Egr-1 plays a role in the development, growth
control, and survival of several cell types, including T cells and B
cells,9 neuronal cells,10 and myeloid
cells.11-13
We previously found evidence that Egr-1 plays a role in the
development of hematopoietic cells along the macrophage
lineage.11-13 We initially identified Egr-1 as a
myeloid-differentiation primary response gene that is activated in the
absence of de novo protein synthesis on
12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced macrophage
differentiation of HL-60 cells.11 Using a variety of
myeloid-differentiation-inducible cell lines, we showed that Egr-1 is
a positive modulator of macrophage differentiation whose function
varies according to the state of lineage commitment for differentiation
and the hematopoietic cell type. In HL-60 cells, Egr-1 blocked
granulocytic differentiation and restricted differentiation to the
monocytic lineage. Egr-1 also blocked granulocyte colony-stimulating factor (G-CSF)-induced differentiation of interleukin (IL)
3-dependent 32Dcl3 hematopoietic precursor cells, endowing the cells
with the ability to be induced by granulocyte-macrophage
colony-stimulating factor (GM-CSF) for terminal differentiation along
the macrophage lineage. Interestingly, Egr-1 was also found to at least
partly mediate the ability of the homeobox gene Hox-B8 (Hox2.4) to
endow 32Dcl3 cells with the potential to be induced by GM-CSF for
terminal macrophage differentiation.14
Furthermore, ectopic expression of Egr-1 in M1 myeloblastic leukemia
cells activated the macrophage-differentiation program in the absence
of the differentiation inducer IL-6.12
The complex process of blood cell formation, which is
regulated throughout life, involves a hierarchy of hematopoietic
progenitor cells in the bone marrow (BM) that proliferate and
terminally differentiate along multiple distinct cell lineages,
including the proliferation and differentiation of myeloid progenitor
cells into a variety of mature myeloid cells.15-19 To
understand how Egr-1 regulates normal hematopoietic cell development,
we here used high-efficiency retroviral transduction to ectopically
express Egr-1 in myeloid-enriched or stem cell-enriched BM cell
cultures and explored its effects on the development of hematopoietic
progenitors in vitro and in vivo. We found that regardless of the
cytokine used, ectopic Egr-1 expression in normal hematopoietic
progenitors stimulated their development to the macrophage lineage at
the expense of development along other lineages, notably the
granulocyte and erythroid lineages. Furthermore, Egr-1 accelerated
macrophage development by suppressing the proliferative phase.
Consequently, Egr-1-infected hematopoietic progenitors failed to
repopulate the BM in lethally irradiated mice.
Mice, BM, and cytokines
For retroviral infection, erythrolysed nucleated BM cells were
prestimulated to promote cell division with IL-3 (10%
WEHI-3B-conditioned medium as a source of IL-3), IL-6 (10 ng/mL), and
stem cell factor (SCF; 200 ng/mL) in Generation of retroviral particles and infection of BM
cells
For BM transplantation studies, washed cells were cultured for 24 hours
in complete In vitro clonogenic progenitor assay Immediately after cocultivation, control and infected BM cells were assessed by in vitro progenitor cell colony-forming assays. Cells were washed and plated in 35-mm tissue-culture dishes (StemCell Technologies Inc) in 1.1 mL methylcellulose-based medium (Methocult HCC 3234; StemCell Technologies Inc) according to the manufacturer's instructions. Colonies were raised in the presence of various cytokines by supplementing methylcellulose-based medium with IL-3 (10% WEHI-3B-conditioned medium), SCM (10%), G-CSF (100 ng/mL), GM-CSF (100 ng/mL), or M-CSF (10% L-cell-conditioned medium). Cells were seeded at an initial density of 0.5 × 105 cells/dish with or without 650 µg/mL G418 (Gibco BRL) and were scored after 8 days.Assays for differentiation-associated properties For each sample, isolated BM colonies were pooled and cytospin smears prepared. Morphologic differentiation was determined by counting at least 300 cells on May-Grünwald-Giemsa-stained cytospin smears and scoring the proportion of blast cells, mature granulocytes, and macrophages.7,8 Immature blast cells are characterized by scant cytoplasm and round or oval nuclei and mature granulocyte-like cells by enlarged cytoplasm and lobulated nuclei. Mature macrophage-like cells are flattened, well spread out, and interspersed with numerous vacuoles in a greatly enlarged cytoplasm. Erythroid cells were identified by benzidine staining.26 To identify granulocytes and macrophages, nitroblue tetrazolium (NBT) staining and nonspecific esterase (NSE) staining, respectively, were done as described previously.11 Analysis of expression of macrophages and granulocyte-specific cell-surface markers on BM was done by using fluorescence-activated cell-sorting (FACS) analysis with fluorescein isothiocyanate (FITC)-conjugated F4/80, a rat monoclonal antibody to mouse macrophage antigen (Caltag Laboratories, Burlingame, CA), and FITC-conjugated Gr-1, an antimouse LyG6 (Pharmingen, San Diego, CA), respectively.General recombinant DNA techniques, expression vectors, and reverse transcriptase-polymerase chain reaction Plasmid preparations, restriction enzyme digestions, DNA fragment preparations, and agarose gel electrophoresis were done as described previously.12 MSCV EB neo, the retroviral plasmid expression vector used in this study, was a gift from Dr Robert G. Hawley (University of Toronto, Toronto, Canada).27 The 2.3-kb BamHI and SalI fragment of the full-length murine Egr-1 complementary DNA was cloned into the XhoI site of the MSCV EB neo retroviral vector by means of blunt-end ligation. To identify ectopic Egr-1 expression in Egr-1-infected BM cells, reverse transcription-polymerase chain reaction (RT-PCR) was done as described previously.13 RNA from the BM cells, extracted by using Trizol reagent (Gibco BRL), was reverse transcribed with the Superscript preamplification system (180-890 11; Gibco BRL) according to the manufacturer's instructions. A region spanning the cloning site was amplified on the MSCVneo Egr-1 vector by using primers corresponding to base pairs 1096 to 2020 of the MSCVneo vector (5'TTCTGCTCTGCAGAATGGCCAACC3') and base pairs 748 to 769 of the Egr-1 insert (5'AAGCAGCTGGAGAAGGCGCCG3').BM transplantation into irradiated mice For BM transplantation studies, 4- to 5-week-old Balb/c mice were irradiated lethally with a total of 935 Gy or sublethally with a total of 700 Gy (delivered at the rate of 1.95 Gy/minute [195 rad/minute]) by using a cesium 137 source irradiator. Lethally irradiated mice were injected with 0.2 × 106 and sublethally irradiated animals with 2 × 106 infected or control BM cells in a volume of 300 µL through the lateral tail vein immediately after irradiation. The mice were maintained in microisolator cages in a barrier animal facility and fed sterilized food and acidified water. To prevent infection in lethally irradiated animals, their drinking water was supplemented with neomycin (1.1 g base/L; Sigma) and polymyxin B (106 U/L; Sigma). The number and type of colony-forming units-spleen were determined 8 or 13 days after transplantation, or both, essentially as described previously.28,29 The number of BM cells obtained from femurs of injected mice22 was determined at the indicated times and was used to assess the ability of injected cells to repopulate the BM of the irradiated mice.
Egr-1 promotes macrophage differentiation and inhibits granulocyte differentiation of myeloid-enriched BM cells Using a variety of differentiation-inducible myeloid cell lines, we previously showed that Egr-1 is a positive modulator of macrophage differentiation whose functions vary according to the state of lineage commitment for differentiation of the hematopoietic cell type. To assess how Egr-1 may modulate normal hematopoietic cell development, we here used high-efficiency retroviral transduction to infect BM cells. Because Egr-1 is a positive modulator of myeloid cell differentiation, initially myeloblast-enriched BM cultures were used as the source of normal cells. These were obtained from femurs of Balb/c mice injected intraperitoneally with SC, which initiates an inflammatory response that increases myelopoiesis.22 The BM cells isolated from mice injected with SC consisted primarily of cells of the myeloid lineage (95% ± 4%), with 33% ± 3% myeloid precursors at the myeloblast-to-promyelocyte stage, compared with 76% ± 4% of myeloid cells, with 18% ± 3% of myeloid precursors for normal BM cells obtained from untreated animals. Retroviral particles were generated by transfecting the pMSCV retroviral vectors into the high-efficiency Bosc23 packaging line. The resulting virus was used to infect the myeloblast-enriched BM cells. The infection efficiency of hematopoietic progenitor cells with pMSCVneo ranged from 25% to 50%, determined by the number of G418-resistant BM colonies generated in methylcellulose supplemented with IL-3, SCM, G-CSF, GM-CSF, or M-CSF.Ectopic Egr-1 expression in infected BM cells Evidence for the presence of transduced pMSCV Egr-1 in myeloid progenitor-enriched BM cells was obtained with RT-PCR using RNA obtained from BM cells infected with MSCVneo Egr-1 retrovirus (BMEgr-1), with the PCR primers corresponding to sequences on both the MSCVneo vector and the Egr-1 insert. This resulted in amplification of a 1-kb fragment spanning the cloning site (data not shown).Transduction of myeloid progenitor-enriched BM cultures with pMSCV
Egr-1 showed that ectopic expression of Egr-1 reduced the colony-forming ability of progenitor cells cultured in methylcellulose supplemented with either IL-3, SCM, G-CSF, GM-CSF, or M-CSF (Figure 1). In all cases, Egr-1-infected
colonies were also smaller in size (
To test whether the smaller colony size of Egr-1-transduced BM
cells was due to reduced proliferative capacity of the cells, secondary
colony assays were done. Equal numbers of cells obtained from primary
colonies were seeded in methylcellulose supplemented with IL-3. As
shown in Figure 2, the ability of
Egr-1-transduced progenitors to form secondary colonies was
significantly impaired compared with that of neo-infected controls. All
the colonies formed by the Egr-1-transduced BM cells in the secondary
cultures were small (< 100 cells/colony) and had dispersed
macrophage-colony morphologic characteristics. Cytologic analysis of
May-Grünwald-stained cytospin smears of the secondary BMEgr-1
colonies revealed exclusively well-differentiated macrophage
phenotypes. In contrast, secondary colonies formed by BMneo cells were
larger (> 500 cells/colony) and contained different myeloid cell
types, most of which had mature macrophage or granulocyte morphologic
features (Figure 2). Similar results were obtained in secondary
colony assays with other cytokines, such as SCM, G-CSF, GM-CSF, and
M-CSF (data not shown).
To determine the effect of ectopic expression of Egr-1 on myeloid
progenitor development, cytologic examinations were done on
May-Grünwald-stained cytospin smears of cells obtained from 8-day-old BM colonies formed in methylcellulose cultures (Figure 3A). Representative pictures of
neo-transduced and Egr-1-transduced cells obtained from colonies
generated in the presence of IL-3 are shown in Figure 3B. Ectopic Egr-1
expression altered the profile of differentiated cellular phenotypes of
BM progenitor cells. Regardless of the cytokines that were used, Egr-1
progenitors had an increased proportion of cells differentiated into
macrophages (except when cultured with G-CSF) and reduced granulocytic
differentiation. Thus, ectopic Egr-1 promoted monocytic differentiation
and inhibited granulocytic differentiation of normal myeloid
progenitors.
To corroborate the results of the cytologic examinations,
neo-transduced and Egr-1-transduced cells obtained from 8-day-old colonies grown with IL-3 were analyzed for expression of
macrophage-specific and granulocyte-specific differentiation markers.
These markers included the cytochemical markers NSE and NBT and the
cell-surface markers F4/80 and Gr-1 specific for macrophages and
granulocytes, respectively. As shown in Figure
4A, 65% of the BMEgr-1 cells stained for
macrophage-specific NSE, whereas only 30% of the neo control cells
did. Conversely, ectopic expression of Egr-1 resulted in a reduction in
the percentage of cells expressing the granulocyte-specific marker NBT;
only 15% of BMEgr-1 colony cells stained for NBT, whereas 60% of the
control BMneo colony cells showed such staining (Figure 4A). Consistent
with expression of macrophage and granulocyte cytochemical markers,
flow cytometry analysis with FITC antibodies revealed that expression
of the macrophage cell-surface marker F4/80 was greatly increased,
whereas expression of the granulocyte cell-surface marker Gr-1 was
greatly decreased in BMEgr-1 cells compared with BMneo controls (Figure
4B).
Together, these data show that Egr-1 expression in hematopoietic progenitor cells promoted monocytic differentiation and inhibited granulocytic differentiation, regardless of the cytokines used. Egr-1 enhances macrophage differentiation in stem cell-enriched myeloid BM cells Using myeloid-enriched BM cultures, we confirmed our previous finding, obtained by employing differentiation-inducible cell lines, that Egr-1 is a positive modulator of differentiation of myeloid cells along the macrophage lineage and that it negatively regulates differentiation along the granulocytic lineage. To expand on these findings, Egr-1 was transduced into stem cell-enriched BM cell cultures obtained from mice given 5-FU.As shown in Figure 5A, with stem
cell-enriched BM cell cultures, MSCVneo transduction efficiencies of
up to 40% were achieved. As with myeloid-enriched BM, Egr-1 also
reduced by 30% to 50% the colony-forming ability of progenitors in
stem cell-enriched BM cells that were seeded in methylcellulose
supplemented with either IL-3, SCM, G-CSF, GM-CSF, or M-CSF by 30% to
50% (Figure 5B). In addition, the colonies were smaller than those
with the neo controls and the ability of Egr-1-expressing progenitors
to form secondary colonies was greatly reduced, a finding
indicative of impaired proliferative capacity (data not
shown).
Analysis of cell types in Egr-1-infected, stem cell-enriched BM confirmed what was observed with myeloid-enriched BM cell cultures. Namely, regardless of the cytokines used, Egr-1 altered the profile of progenitor development, favoring macrophage development at the expense of development along other lineages (Figure 5C). It is notable that this ability of Egr-1 was even more pronounced in stem cell-enriched BM compared with myeloid-enriched BM (Figure 5C [IL-3] and Figure 3A [IL-3]). Egr-1 stimulates macrophage development at the expense of granulocyte or erythroid development The pronounced ability of Egr-1 to enhance hematopoietic progenitor development along the macrophage lineage raised the possibility that Egr-1 expression, in addition to overriding granulocyte differentiation in favor of macrophage differentiation, might also stimulate macrophage differentiation in other blood cell lineages. To test this idea, we analyzed the effect of Egr-1 on the ability of IL-3 plus Epo to stimulate progenitor cells derived from mice treated with 5-FU to differentiate along both the myeloid and erythroid lineages.30 As shown in Figure 6, Egr-1 expression resulted in a significant reduction in the percentage of erythroid cells and an increase in the percentage of macrophages, compared with cells obtained from colonies of neo controls.
Taken together, these observations indicate that ectopic expression of Egr-1 can stimulate the development of hematopoietic progenitors along the macrophage lineage at the expense of erythroid development. Egr-1-transduced progenitors fail to prevent death in lethally irradiated mice To examine how ectopic Egr-1 may modulate hematopoiesis in vivo, we tested the ability of Egr-1-transduced progenitor cells to repopulate the BM and thereby prevent death in lethally irradiated mice. Lethally irradiated mice given transplants of mock-infected BM cells formed spleen colonies and survived for the 4-week period of observation (Table 1). During this period, only 10% of the mice given neo-transduced cells died; the remaining 90% survived and formed macroscopic spleen colonies (Table 1). In contrast, all the mice given transplants of Egr-1-transduced cells died by 10 days after transplantation. Autopsies of these animals revealed that they had shrunken spleens without spleen colonies (Table 1). Furthermore, femurs of mice given transplants of Egr-1-transduced progenitors, unlike femurs of healthy control mice or control mice given neo transplants, contained a greatly reduced number of BM cells on days 7 and 9 after transplantation and the cells obtained failed to generate colonies in methylcellulose (Table 1). Similar results were obtained in mice given transplants of stem cell-enriched BM cell cultures (Figure 7 and data not shown). These observations indicate that the Egr-1-infected hematopoietic progenitors failed to repopulate the BM and thereby prevent death in lethally irradiated mice.
To determine whether the failure of Egr-1-infected hematopoietic
progenitors to repopulate the BM may have been due to a homing defect
or alteration of the terminal-differentiation program, Egr-1-transduced progenitors were transplanted into sublethally irradiated mice. Sublethally irradiated mice given transplants of
either PBS (no BM cells), mock-infected, neo-infected, or
Egr-1-infected BM cells survived for the 6-week observation period.
Groups of these mice were killed 7 days after transplantation and
autopsies done. These revealed that mice given transplants of
Egr-1-infected BM cells formed a reduced number of spleen colonies
compared with control mice given mock-infected or neo BM cells. Femurs
of mice given transplants of Egr-1-transduced progenitors, unlike
femurs of healthy control mice or control mice given neo transplants, also contained a reduced number of BM cells on day 7 after
transplantation (Table 2). In addition,
BM cells of mice given transplants of Egr-1 progenitors had a
significant reduction in the percentage of blast and granulocytic cells
and an increase in the percentage of macrophages adhering to the
surface of the tissue-culture plates (in liquid culture supplemented
with IL-3; Figure 8), compared with BM cells obtained from controls given mock-infected or
neo-infected cells.
Taken together, these observations are consistent with the idea that Egr-1-transduced progenitors have a greatly enhanced probability of undergoing macrophage differentiation after transplantation into irradiated mice, and as a result, they fail to repopulate the BM and spleen and prevent death in the irradiated animals.
In previous studies, a variety of myeloid-differentiation-inducible cell lines were used to show that Egr-1 is a positive modulator of macrophage differentiation. In this study, to increase our understanding of the role Egr-1 plays in hematopoiesis, we analyzed how Egr-1 modulates hematopoietic development of normal myeloid progenitor cells in vitro and in vivo. High-efficiency retroviral transduction was used to ectopically express Egr-1 in myeloid-enriched and stem cell-enriched BM cell cultures. Regardless of the differentiating stimulus, Egr-1 significantly increased the proportion of progenitor cells that developed along the macrophage lineage, often at the expense of developing along either the granulocyte or the erythroid lineage. Thus, ectopic Egr-1 appears to have a remarkable ability to stimulate hematopoietic cell development to the macrophage lineage at the expense of development along other lineages. Consistent with this idea, Egr-1 progenitors failed to repopulate the BM and spleen and therefore prevent death in lethally irradiated mice. In addition, an increase in the proportion of macrophage progenitors was observed in BM cells obtained from sublethally irradiated mice. These findings support our previous findings11-13 that Egr-1 is a positive modulator of macrophage differentiation that overrides development of normal myeloid progenitor cells along other hematopoietic lineages. Using 2-dimensional gel analysis, we previously identified rapid changes in protein expression, including induction and suppression of specific proteins, that were rapidly induced in HL-60 cells on cell attachment associated with TPA-induced macrophage differentiation.31 These protein changes did not occur on induction of HL-60 granulocytic differentiation by dimethyl sulfoxide (DMSO). The same set of protein changes was also observed in normal human peripheral blood monocytes after attachment to the surface of tissue-culture plates and was not observed in human peripheral blood granulocytes,31 indicating the relevance of the observed changes in protein expression to normal myelopoiesis. Furthermore, using this set of protein changes as a diagnostic tool, we showed that HL-60 cells treated with both TPA and DMSO attached and underwent even more rapid macrophage differentiation than cells treated with TPA alone. Moreover, after induction of the granulocyte program by DMSO, stimulation with TPA resulted in rapid cell attachment and a switch from granulocyte to macrophage development. These observations led to the conclusion that cytokine-regulated cell adhesion plays a major role in determining the developmental program of myeloid progenitor cells.31 In accordance with this idea, it is possible that Egr-1 target genes that encode for or regulate expression of cell-surface adhesion proteins play a crucial role in the remarkable ability of Egr-1 to divert the development of progenitors from other myeloid lineages toward macrophage differentiation. Previous studies identified several genes encoding for adhesion molecules involved in both cellular attachment to the extracellular matrix and cell-cell interactions as potential targets for Egr-1. These include intracellular adhesion molecule 1, which was shown to be subject to Egr-1 regulation in B cells32; CD44, which was found to be a target for Egr-1 in B cells33 and the endothelial cell line ECV-30434; and CD31, whose promoter was shown to contain Sp-1 and Egr-1 elements that conferred phorbol myristate acetate inducibility of a reporter gene in myeloid cells.35 The possibility that these and other genes that encode for cell-adhesion molecules are direct targets for Egr-1, which dictates monocytic development of hematopoietic cells, is being investigated. Our results here indicate that Egr-1 not only dictated development of myeloid progenitors along the macrophage lineage but also accelerated this process by suppressing the proliferative phase of the macrophage growth-to-differentiation developmental program. This was evident from the smaller colony size of Egr-1-transduced progenitors compared with controls as well as their greatly reduced ability to yield secondary colonies. This interesting unexpected finding highlights the increasing evidence of a role for Egr-1 in growth suppression and suppression of transformation of many cell types of both hematopoietic and nonhematopoietic origins.7 This finding is also consistent with previous studies demonstrating that ectopic expression of Egr-1 impairs the leukemogenicity of M1 myeloblastic leukemia cells in vivo.12 It has been reported that macrophage differentiation was not affected
in mice lacking the Egr-1 gene.36 There is increasing evidence, however, that the other Egr family members
Submitted January 4, 2000; accepted October 29, 2000.
Supported by National Institutes of Health grants 1R01CA59774 (D.A.L.) and 1R01CA51162 (B.H.), the Core Program on Carcinogenesis (5P3CA12227), and Amgen.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: D. A. Liebermann, Fels Institute for Cancer Research and Molecular Biology and the Department of Biochemistry, Temple University School of Medicine, 3307 N Broad St, Philadelphia, PA 19140; e-mail: lieberma{at}unix.temple.edu.
1. Sukhatme VP, Kartha S, Toback FG, Taub R, Hoover RG, Tsai-Morris CH. A novel early growth response gene rapidly induced by fibroblast, epithelial cell and lymphocyte mitogens. Oncogene Res. 1987;1:343-355[Medline] [Order article via Infotrieve].
2.
Milbrandt J.
A nerve growth factor-induced gene encodes a possible transcription regulatory factor.
Science.
1987;238:797-799
3.
Lemaire P, Revelant O, Bravo R, Charnay P.
Two mouse genes encoding potential transcription factors with identical DNA-binding domains are activated by growth factors in cultured cells.
Proc Natl Acad Sci U S A.
1988;85:4691-4695 4. Patwardhan S, Gashler A, Siegel MG, et al. EGR3, a novel member of the Egr family of genes encoding immediate-early transcription factors. Oncogene. 1991;6:917-928[Medline] [Order article via Infotrieve]. 5. Crosby SD, Puetz JJ, Simburger KS, Fahrner TJ, Milbrandt J. The early response gene NGFI-C encodes a zinc finger transcriptional activator and is a member of the GCGGGGGCG (GSG) element-binding protein family. Mol Cell Biol. 1991;8:3835-3841. 6. Gashler A, Sukhatme VP. Early growth response protein 1 (Egr-1): prototype of a zinc-finger family of transcription factors. Prog Nucleic Acid Res Mol Biol. 1995;50:191-224[Medline] [Order article via Infotrieve]. 7. Liu C, Rangnekar VM, Adamson E, Mercola D. Suppression of growth and transformation and induction of apoptosis by EGR-1. Cancer Gene Ther. 1998;1:3-28. 8. Gashler A, Sukhatme VP. Early growth response protein (Egr-1): prototype of a zinc-finger family of transcription factors. Prog Nucleic Acids Res Mol Biol. 1991;50:191-224. 9. McMahon SB, Monroe JG. The role of early growth response gene 1 (Egr-1) in regulation of the immune response. J Leukoc Biol. 1996;2:159-166. 10. Beckmann AM, Wilce PA. Egr transcription factors in the nervous system. Neurochem Int. 1997;4:477-510. 11. Nguyen H, Hoffman-Liebermann B, Liebermann DA. The zinc finger transcription factor Egr-1 is essential for and restricts differentiation along the macrophage lineage. Cell. 1993;72:197-209[CrossRef][Medline] [Order article via Infotrieve].
12.
Krishnaraju K, Hoffman B, Liebermann DA.
The zinc finger transcription factor Egr-1 activates macrophage differentiation in M1 myeloblastic leukemia cells.
Blood.
1998;92:1957-1966 13. Krishnaraju K, Nguyen HQ, Liebermann DA, Hoffman B. The zinc finger transcription factor Egr-1 potentiates macrophage differentiation of hematopoietic cells. Mol Cell Biol. 1995;15:5549-5507.
14.
Krishnaraju K, Liebermann DA, Hoffman B.
Lineage specific regulation of hematopoiesis by Hox-B8 (Hox2.4): inhibition of granulocyte differentiation and potentiation of monocytic differentiation.
Blood.
1997;90:1840-1849 15. Metcalf D. The molecular control of cell division, differentiation commitment and maturation in hematopoietic cells. Nature. 1989;339:27-30[CrossRef][Medline] [Order article via Infotrieve]. 16. Quesenberry PJ. Hematopoietic stem cells, progenitor cells, and growth factors. In: Williams WJ,Beutler E,Erslev AJ,Lichtman MA, eds. Hematology. New York, NY: McGraw-Hill; 1990:211-228. 17. Cowling GJ, Dexter TM. Apoptosis in the haemopoietic system. Philos Trans R Soc Lond B Biol Sci. 1994;345:257-263[Medline] [Order article via Infotrieve]. 18. Liebermann DA, Hoffman-Liebermann B. Genetic programs of myeloid cell differentiation. Curr Opin Hematol. 1994;1:24-32[Medline] [Order article via Infotrieve]. 19. Liebermann DA, Hoffman B. Differentiation primary response genes and proto-oncogenes as positive and negative regulators of terminal hematopoietic cell differentiation. Stem Cells. 1994;12:352-369[Abstract]. 20. Van Zant G. Studies of hematopoietic stem cells spared by 5-fluorouracil. Exp Med. 1984;159:679-690. 21. Metcalf D, Johnson GR. Production by spleen and lymph node cells of conditioned medium with erythroid and other hemopoietic colony-stimulating activity. J Cell Physiol. 1978;96:31-42[CrossRef][Medline] [Order article via Infotrieve]. 22. Liebermann D, Hoffman-Liebermann B. Proto-oncogene expression and dissection of the myeloid growth to differentiation developmental cascade. Oncogene. 1989;4:583-592[Medline] [Order article via Infotrieve].
23.
Pear WS, Nolan GP, Scott ML, Baltimore D.
Production of high-titer helper-free retroviruses by transient transfection.
Proc Natl Acad Sci U S A.
1993;90:8392-8396 24. Wigler M, Pellicer A, Silverstein S, Axel R. Biochemical transfer of single-copy eucaryotic genes using total cellular DNA as donor. Cell. 1978;14:725-731[CrossRef][Medline] [Order article via Infotrieve]. 25. Cepko CL, Roberts BE, Mulligan RC. Construction and applications of a highly transmissible murine retrovirus shuttle vector. Cell. 1984;37:1053-1062[CrossRef][Medline] [Order article via Infotrieve]. 26. Testa NG,Molineux G, eds. Haematopoiesis: A Practical Approach. New York, NY: Oxford University Press; 1983. 27. Hawley RG, Lieu FH, Fong AZ, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136-138[Medline] [Order article via Infotrieve]. 28. Till JE, McCulloch EA. A direct measurement of the radiation sensitivity of normal bone marrow cells. Radiat Res. 1961;14:213-222[Medline] [Order article via Infotrieve]. 29. Fowler JH, Wu AM, Till JE, McCulloch EA, Siminovitch L. The cellular composition of hematopoietic spleen colonies. J Cell Physiol. 1967;69:65-72[CrossRef].
30.
Ikebuchi K, Wong GG, Clark SC, Ihle JN, Hirai Y, Ogawa M.
Interleukin 6 enhancement of interleukin 3-dependent proliferation of multipotential hemopoietic progenitors.
Proc Natl Acad Sci U S A.
1987;84:9035-9039 31. Liebermann D, Hoffman-Liebermann B, Sachs L. Regulation of gene expression by tumor promoters. II. Control of cell shape and developmental programs for macrophages and granulocytes in human myeloid leukemic cells. Int J Cancer. 1981;28:285-291[Medline] [Order article via Infotrieve].
32.
Maltzman JS, Carmen JA, Monroe JG.
Transcriptional regulation of the Icam 1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor Egr-1.
J Exp Med.
1996;183:1747-1759 33. Maltzman JS, Carman JA, Monroe JG. Role of Egr-1 in regulation of stimulus-dependent CD44 transcription in B lymphocytes. Mol Cell Biol. 1996;16:2283-2294[Abstract].
34.
Fitzgerald KA, O'Neill LA.
Characterization of CD44 induction by IL-1: a critical role for Egr-1.
J Immunol.
1999;162:4920-4927 35. Almendro N, Bellon T, Rius C, et al. Cloning of the human platelet endothelial cell adhesion molecule-1 promoter and its tissue-specific expression: structural and functional characterization. J Immunol. 1996;157:5411-5421[Abstract]. 36. Lee SL, Wang Y, Milbrandt J. Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transcription factor NGFI-A (Egr1). Mol Cell Biol. 1996;16:4566-4572[Abstract].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. Gururajan, A. Simmons, T. Dasu, B. T. Spear, C. Calulot, D. A. Robertson, D. L. Wiest, J. G. Monroe, and S. Bondada Early Growth Response Genes Regulate B Cell Development, Proliferation, and Immune Response J. Immunol., October 1, 2008; 181(7): 4590 - 4602. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Dey, L. Stalker, A. Schnerch, M. Bhatia, J. Taylor-Papidimitriou, and C. Wynder The Histone Demethylase KDM5b/JARID1b Plays a Role in Cell Fate Decisions by Blocking Terminal Differentiation Mol. Cell. Biol., September 1, 2008; 28(17): 5312 - 5327. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Lubieniecka, D. R.H. de Bruijn, L. Su, A. H.A. van Dijk, S. Subramanian, M. van de Rijn, N. Poulin, A. G. van Kessel, and T. O. Nielsen Histone Deacetylase Inhibitors Reverse SS18-SSX-Mediated Polycomb Silencing of the Tumor Suppressor Early Growth Response 1 in Synovial Sarcoma Cancer Res., June 1, 2008; 68(11): 4303 - 4310. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Li, J. Berman, J.-T. Tang, and T.-J. Lin The Early Growth Response Factor-1 Is Involved in Stem Cell Factor (SCF)-induced Interleukin 13 Production by Mast Cells, but Is Dispensable for SCF-dependent Mast Cell Growth J. Biol. Chem., August 3, 2007; 282(31): 22573 - 22581. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Carter and W. G. Tourtellotte Early Growth Response Transcriptional Regulators Are Dispensable for Macrophage Differentiation J. Immunol., March 1, 2007; 178(5): 3038 - 3047. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gehrig, T. Langmann, F. Horling, A. Janssen, M. Bonin, M. Walter, S. Poths, and B. H. F. Weber Genome-Wide Expression Profiling of the Retinoschisin-Deficient Retina in Early Postnatal Mouse Development Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 891 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yuan, J. E. Payton, M. S. Holt, D. C. Link, M. A. Watson, J. F. DiPersio, and T. J. Ley Commonly dysregulated genes in murine APL cells Blood, February 1, 2007; 109(3): 961 - 970. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Li, M. R. Power, and T.-J. Lin De novo synthesis of early growth response factor-1 is required for the full responsiveness of mast cells to produce TNF and IL-13 by IgE and antigen stimulation Blood, April 1, 2006; 107(7): 2814 - 2820. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dauffy, G. Mouchiroud, and R. P. Bourette The interferon-inducible gene, Ifi204, is transcriptionally activated in response to M-CSF, and its expression favors macrophage differentiation in myeloid progenitor cells J. Leukoc. Biol., January 1, 2006; 79(1): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wagner, R. Saffrich, U. Wirkner, V. Eckstein, J. Blake, A. Ansorge, C. Schwager, F. Wein, K. Miesala, W. Ansorge, et al. Hematopoietic Progenitor Cells and Cellular Microenvironment: Behavioral and Molecular Changes upon Interaction Stem Cells, September 1, 2005; 23(8): 1180 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shafarenko, D. A. Liebermann, and B. Hoffman Egr-1 abrogates the block imparted by c-Myc on terminal M1 myeloid differentiation Blood, August 1, 2005; 106(3): 871 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Manfredini, R. Zini, S. Salati, M. Siena, E. Tenedini, E. Tagliafico, M. Montanari, T. Zanocco-Marani, C. Gemelli, T. Vignudelli, et al. The Kinetic Status of Hematopoietic Stem Cell Subpopulations Underlies a Differential Expression of Genes Involved in Self-Renewal, Commitment, and Engraftment Stem Cells, April 1, 2005; 23(4): 496 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chen, Q. Wang, X. Wang, and G. P. Studzinski Up-Regulation of Egr1 by 1,25-Dihydroxyvitamin D3 Contributes to Increased Expression of p35 Activator of Cyclin-Dependent Kinase 5 and Consequent Onset of the Terminal Phase of HL60 Cell Differentiation Cancer Res., August 1, 2004; 64(15): 5425 - 5433. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, J. R. Keefer, Q.-f. Wang, and A. D. Friedman Reciprocal effects of C/EBPalpha and PKCdelta on JunB expression and monocytic differentiation depend upon the C/EBPalpha basic region Blood, May 15, 2003; 101(10): 3885 - 3892. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Tjin Tham Sjin, K. Krishnaraju, B. Hoffman, and D. A. Liebermann Transcriptional regulation of myeloid differentiation primary response (MyD) genes during myeloid differentiation is mediated by nuclear factor Y Blood, June 17, 2002; 100(1): 80 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Amendt, A. Mann, P. Schirmacher, and M. Blessing Resistance of keratinocytes to TGF{beta}-mediated growth restriction and apoptosis induction accelerates re-epithelialization in skin wounds J. Cell Sci., May 15, 2002; 115(10): 2189 - 2198. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Steptoe, J. M. Ritchie, and L. C. Harrison Increased Generation of Dendritic Cells from Myeloid Progenitors in Autoimmune-Prone Nonobese Diabetic Mice J. Immunol., May 15, 2002; 168(10): 5032 - 5041. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||