|
|
 Previous Article | Table of Contents
Blood, 1 March 2001, Vol. 97, No. 5, pp. 1518-1521
CORRESPONDENCE
To the editor:
Locus-specific regulation of HLA-A and HLA-B expression is not
determined by nucleotide variation in the X2 box promoter element
HLA class I expression is controlled by several regulatory
pathways. The X2 box is a crucial element of the SXY regulatory module,
which controls the transactivation of HLA class I and  2-microglobulin and of HLA class II and their accessory
genes.1,2 Critical in this class II transactivator
(CIITA)-induced transactivation is the cooperative binding of a
multiprotein complex consisting of RFX, ATF/CREB, and NFY on the SXY
regulatory module.2 Recently, Girdlestone presented evidence to suggest that nucleotide
variation in the X2 box would be responsible for a differential regulation between HLA-A and HLA-B.3 It was concluded that the X2 box of HLA-A did not bind ATF/CREB factors, leading to a lack of
or weaker induction of this locus by CIITA and that an interaction and
synergy between CIITA and RelA would compensate for the lack of
ATF/CREB binding. Here we present data that, similar to HLA-B, the X2
box of HLA-A binds ATF/CREB and mediates, as part of the SXY regulatory
module, CIITA-induced transactivation.4,5 This
demonstrates that the X2 box is not the basis for locus-specific regulation of HLA-A and HLA-B genes. Our methods were as
follows: Plasmids: Luciferase reporter plasmids used contained
a 228 bp BglII-AhaII HLA-A*0201
promoter fragment (pGL3-A230), a 140 bp
PpuMI-AhaII HLA-A*0201 promoter
fragment (pGL3-A140), or a 269 bp AspI-AhaII
HLA-B*0702 promoter fragment (pGL3-B250) cloned into
pGL3-Basic (Promega, Madison, WI), as described.4 The X2
box mutant constructs (pGL3-AmX2 and pGL3-BmX2) contained a 4 bp
mutation in the X2 box region (HLA-A2:
TCACGACGCG>TCAAACAGCG; HLA-B7:
TCGTGACGCG>TCGGACAGCG) were generated by overlap extension polymerase chain reaction (PCR), as described previously.5 The expression vectors pRSV0-RelA (p65) and pREP4-CIITA
were described previously.4,6 Transient transfection: Cell lines and the calcium phosphate
precipitation method of transfection were described
previously.5 In each of 4 wells of a 6-well plate,
0.2 × 106 Tera-2 cells were transfected with a DNA
precipitate containing 1 µg firefly luciferase pGL3 reporter plasmid,
0.5 µg pREP4-CIITA, and/or 1 µg pRSV0-RelA (p65) and
0.2 µg Renilla luciferase control plasmid (pRL-SV40 or
pRL-RSV). Cells were harvested 3 days after transfection. Luciferase
activity was determined using the dual luciferase reporter assay system
(Promega) and a luminometer (Tropix, Badford, MA). Electrophoretic mobility gel shift assay (EMSA): Preparation
of nuclear extracts and EMSA was performed as described
previously.5 The nucleotide sequence of the X2 probe
of HLA-A*0201 and HLA-B*0702 were: X2A,
GGATACTCACGACGCGGACC; X2B, GGATACTCGTGACGCGTCCC.
For the supershift assays, 1 µg of each antibody (Ab) was added 30 minutes after adding the probe and incubated for 1 hour at 4°C. The
Abs used were directed against ATF/CREB (sc-270x), ATF1 (sc-243x; Santa
Cruz Biotechnology, Santa Cruz, CA). The specific antisera against CREB
(anti-CREB1) was previously described.7 Based on this, we achieved the following results: The X2 box of both HLA-A and HLA-B is an ATF/CREB binding site:
The X2 box is highly conserved and displays relatively little nucleotide variation amongst the different HLA class I
loci.1 However, the X2 box region of HLA-B (CTCGTGACGCG)
is divergent in HLA-A (CTCACGACGCG). The X2 probes of both loci were found to form a number of
protein/DNA complexes using nuclear extracts of HeLa cells in EMSAs, albeit that the complex was slightly weaker to the X2 box of HLA-A compared to HLA-B (Figure 1A). The
complexes binding to the X2 box of HLA-A and HLA-B were supershifted
with the general ATF/CREB Ab and with the Abs specific for ATF1 and
CREB1 (Figure 1A). Complex formation was similar in Tera-2 and in B
cells (not shown). This suggests that there is no significant
difference in binding of these ubiquitously expressed factors.
View larger version (40K):
[in this window]
[in a new window]
| Figure 1.
CREB1 and ATF1 bind the X2 box of HLA-A and HLA-B and
are partners in the CIITA-induced transactivation.
(A) EMSA analysis of nuclear extracts from HeLa cells incubated with
the X2 probes of HLA-A and HLA-B (X2A and X2B probes). Arrows indicate
protein/DNA complexes. Supershifts were observed for ATF/CREB, ATF1,
and CREB1 (indicated by asterisks). (B) Transient cotransfection assay
of HLA-A and HLA-B promoter-driven luciferase reporter constructs (1 µg/well) with Rc/RSV-CREB (1 µg/well), Rc/RSV-ATF1 (1 µg/well),
and/or pREP4-CIITA (0.5 µg/well) in Tera-2 cells. Normalized
luciferase activity values are expressed as mean fold induction ± SD of n = 4. (C) Transient cotransfection assay of HLA-A and HLA-B
promoter constructs with a range of CIITA concentrations (0, 0.01, 0.03, 0.13, 0.5, and 2 µg/well) in Tera-2 cells. Normalized
luciferase activity values are expressed as mean fold induction ± SD of n = 4.
|
|
ATF/CREB contribute to the CIITA induced transactivation of HLA-A
and HLA-B: The crucial dependency of CIITA transactivation on the
X2 box of HLA-A and HLA-B is revealed from mutational analysis (not
shown; see Gobin et al5). In order to evaluate the role of
ATF/CREB factors in the transactivation of HLA-A and HLA-B genes,
transient transfection assays were performed with CREB1, ATF1, and
CIITA. Expression of exogenous CREB1 or ATF1 enhanced CIITA-induced
transactivation of HLA-A and HLA-B (Figure 1B). Both CREB1 and ATF1
also enhanced the basal level of HLA-A and HLA-B transactivation
(Figure 1B). This demonstrates that CREB1 and ATF1 are functional
partners of the CIITA route of transactivation and that the
contribution of ATF/CREB to CIITA-induced transactivation is similar in
both loci. Similar transactivation kinetics of HLA-A and HLA-B by CIITA:
In order to test whether the CIITA-induced transactivation of HLA-A and HLA-B displayed locus-specific differences, promoter activity
was tested with a range of CIITA concentrations. In Tera-2 cells, HLA-A
and HLA-B were induced by CIITA to a similar extent at all
concentrations tested (Figure 1C). It should be noted that, in
transient transfection experiments in several other cell types, frequently a slightly lower fold induction by CIITA was found for the
HLA-A promoter (maximal 50% of HLA-B). However, this difference was
generally related to the higher basal level of promoter activity of
HLA-A, whereas the absolute luciferase values after CIITA induction were similar for HLA-A and HLA-B. Thus there are no significant locus-specific differences in HLA-A and HLA-B transactivation by CIITA. The NF- B and CIITA induced routes of HLA-A
transactivation are not interdependent: A possible interdependency
between the NF-B and CIITA-induced routes of HLA-A transactivation
was tested in transient transfection experiments. RelA strongly
transactivated HLA-A, and cotransfection of RelA with CIITA further
increased the level of transactivation (Figure
2). The transactivation of HLA-A by RelA
and CIITA was generally additive rather than synergistic. Transactivation of HLA-A was not reduced by mutation of the X2 box,
since the X2 box mutant construct pGL3-AmX2 was induced by NF-B to a
similar extent as the wild-type promoter construct pGL3-A230 (not
shown). Cotransfection of CIITA with a HLA-A promoter construct
lacking the upstream regulatory sequences (enhancer A, ISRE) showed
that CIITA transactivation was not impaired by the lack of the upstream
B sites of enhancer A (not shown; see Gobin et al4).
Together, this demonstrates that the NF-B and CIITA-induced routes
of HLA-A transactivation are not interdependent.
View larger version (17K):
[in this window]
[in a new window]
| Figure 2.
NF-B and CIITA-induced HLA-A transactivation.
Transient cotransfection assay of HLA-A promoter driven luciferase
reporter constructs pGL3-A230 (1 µg/well) with pRSV0-RelA
(1 µg/well), and/or pREP4-CIITA (0.5 µg/well) in Tera-2 cells.
Normalized luciferase activity values are expressed as mean ± SD
of n = 4. Stimulation indexes are indicated above the
graph.
|
|
In conclusion, the regulation of HLA class I expression is mediated
through several regulatory pathways. The SXY regulatory module is the
mediator of transactivation by the MHC
enhanceosome.1,2,4,5 Here we demonstrate that the
X2 box of HLA-A binds several proteins of the ATF/CREB family of
transcription factors and, as such, participates in the formation of
the multiprotein complex on XY DNA. This enables CIITA-induced
transactivation of HLA-A to levels that are similar to HLA-B.
Transactivation by NF-B through the upstream B sites of enhancer
A is strengthened by cotransfection of CIITA, which is suggestive of a
cooperative transactivation. However, these 2 routes of HLA-A
transactivation are not interdependent. Thus our data demonstrate that
there are no significant locus-specific differences in HLA-A and HLA-B
transactivation by CIITA. However, the upstream regulatory region
containing the enhancer A and ISRE displays important structural and
functional differences that contribute to the locus-specific expression
of HLA class I molecules.6,8-10
Sam J. P. Gobin and Peter J. van den Elsen
Department of Immunohematology and Blood Transfusion Leiden
University Medical Center Leiden, The Netherlands
Acknowledgments
Supported by the Netherlands Organisation for Research (NWO grant
900-09-200) and the Netherlands Foundation for the Support of Multiple
Sclerosis Research (96-248 MS). S.J.P.G. is a fellow of the Royal
Netherlands Academy of Arts and Sciences.
References
1.
Van den Elsen PJ, Peijnenburg A, Van Eggermond MCJA, Gobin SJP.
Shared regulatory elements in the promoters of MHC class I and class II genes.
Immunol Today.
1998;19:308-312[CrossRef][Medline]
[Order article via Infotrieve].
2.
Van den Elsen PJ, Gobin SJP.
The common regulatory pathway of MHC class I and class II transactivation.
Microbes Infect.
1999;1:887-892[CrossRef][Medline]
[Order article via Infotrieve].
3.
Girdlestone J.
Synergistic induction of HLA- class I expression by RelA and CIITA.
Blood.
2000;95:3804-3808[Abstract/Free Full Text].
4.
Gobin SJP, Peijnenburg A, Keijsers V, Van den Elsen PJ.
Site  is crucial for two routes of IFN- induced MHC class I transactivation: the ISRE mediated route and a novel pathway involving CIITA.
Immunity.
1997;6:601-611[CrossRef][Medline]
[Order article via Infotrieve].
5.
Gobin SJP, Peijnenburg A, Van Eggermond M, Van Zutphen M, Van den Berg R, Van den Elsen PJ.
The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and 2-microglobulin genes.
Immunity.
1998;9:531-541[CrossRef][Medline]
[Order article via Infotrieve].
6.
Gobin SJP, Keijsers V, Van den Elsen PJ.
The role of enhancer A in the locus-specific regulation of classical and non-classical HLA class I genes by NF-B.
J Immunol.
1998;161:2276-2283[Abstract/Free Full Text].
7.
Louis-Plence PL, Moreno CS, Boss JM.
Formation of a regulatory factor X/X2 box-binding protein nuclear factor-Y multiprotein complex on the conserved regulatory regions on HLA class II genes.
J Immunol.
1997;159:3899-3909[Abstract].
8.
Girdlestone J, Isamat M, Gewert D, Milstein C.
Transcriptional regulation of HLA-A and -B: differential binding of members of the Rel and IRF families of transcription factors.
Proc Natl Acad Sci U S A.
1993;90:11568-11572[Abstract/Free Full Text].
9.
Johnson DR, Pober JS.
HLA class I heavy-chain gene promoter elements mediating synergy between tumor necrosis factor and interferons.
Mol Cell Biol.
1994;14:1322-1332[Abstract/Free Full Text].
10.
Gobin SJP, Van Zutphen M, Woltman AM, Keijsers V, Van den Elsen PJ.
Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element.
J Immunol.
1999;163:1428-1434[Abstract/Free Full Text].
Response:
Regulation of HLA class I loci by CIITA
The widespread expression of MHC class I genes might lead them
to be considered as "housekeeping" in comparison with other immune
response genes, but it is evident that they are subject to complex
controls that provide for a wide spectrum of expression levels
according to locus, cell type, developmental stage, and the cytokine
milieu. Several groups reported the interesting finding that CIITA, an
IFN-induced transcription factor identified through its regulation
of MHC class II genes, is also a potent activator of class I
genes.1,2 The action of CIITA was found to be mediated by
a class I promoter region that had been shown previously to be
homologous to the class II promoter3 and to have the properties of a locus control region4. But Gobin et al
reported that, while the promoter was sufficient to mediate virtually
full transactivation by CIITA, the upstream enhancer (ENH) and
interferon response element (IRE) were required in addition to the
promoter site for induction by IFN.2(figs 2,5)
Although one interpretation is that CIITA is not involved in the IFN
response, a more plausible hypothesis was that under normal conditions
CIITA acts in cooperation with factors binding to the ENH/IRE, since
cytokine stimulation does not result in the high levels of CIITA
achieved by overexpression in transient transfections. To test this, I
performed titration series of the candidate factors and found greater
than additive effects with IRF-1 and particularly with
RelA.5 Gobin and van den Elsen's letter depicts findings
with only one dose of each vector, which is maximal for CIITA and
undefined for RelA; so it is not possible to make meaningful
conclusions regarding interactions. Their use of internal controls
driven by viral promoters that are likely to be subject to the effects
of the introduced factors also complicates comparison of
expression levels. One aspect of the original paper dealt with the differential regulation
of HLA-A and -B. Despite their strong homologies, these loci differ in
key bases that have been shown by me and others to affect the
binding and function of a number of transcription factors (see
Girdlestone6). In light of the critical role of the
promoter site, it was striking to me that the sequence of the HLA-A
site differs from that of other HLA and H2 class I genes, and does not
match any empirically determined binding sites for CREB/ATF factors
(TRANSFAC). Under my EMSA conditions I did not find appreciable binding
of nuclear factors to the HLA-A sequence,5 but Gobin and
van den Elsen have now reported its interaction with ATF1/CREB1. They
do mention that the complex was "slightly weaker," but standard
EMSA conditions are not quantitative. It appears that they are using
probe concentrations about 10-fold higher than used for my experiments,
and this would serve to drive the formation of lower affinity
complexes. Cold-competition titration series or binding studies with
purified proteins will be required to assess the differences in
affinity of the CREB/ATF factors for the HLA-A and -B sites. I certainly did not mean to suggest in the original paper that CREB/ATF
factors were not involved in HLA-A expression; indeed, I mentioned as
"data not shown" that a dominant-negative CREB1 blocked expression
of both HLA-A and -B reporters.5(p3807) I also
reported that HLA-A and -B loci are expressed similarly in HeLa
cells,5(fig2E) a finding reproduced in Gobin and van den
Elsen's letter. However, the inverted CAAT box was also found to be
relatively unimportant in HeLA but absolutely required for promoter
activity in MOLT4 cells,5 providing another indication
that that there are differences in the nature of the class I
"enhanceosome" that forms in different cell types. What I hoped to convey in the original paper was that expression
levels of class I genes represent the collective actions of numerous
factors and that their relative binding and/or transcriptional activities differ according to the locus and cell type. What is important now is to address the functional relevance of these differences and to determine how they may contribute to the autoimmune destruction of tissues expressing inappropriate levels of class I
proteins or to the preferential role of HLA-B in graft rejection.
John Girdlestone
Gendaq Ltd London, United Kingdom
References
1.
Martin BK, Chin K-C, Olsen JC, Skinner CA, Dey A, Ozato K, Ting JPY.
Induction of MHC class I expression by the MHC class II transactivator CIITA.
Immunity.
1997;6:591-600[CrossRef][Medline]
[Order article via Infotrieve].
2.
Gobin SJP, Peijnenburg A, Keijsers V, van den Elsen PJ.
Site is crucial for two routes of IFN-induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA.
Immunity.
1997;6:601-611.
3.
Riegert P, Anderson R, Bumstead N, et al.
The chicken 2-microglobulin gene is located on a non-major histocompatibility complex microchromosome: a small, G+C-rich gene with X and Y boxes in the promoter.
Proc Natl Acad Sci U S A.
1996;93:1243-1248[Abstract/Free Full Text].
4.
Kushida MM, Dey A, Zhang X, et al.
A 150-base pair region of the MHC class I HLA-B7 gene is sufficient to direct tissue-specific expression and locus control region activity.
J Immunol.
1997;159:4013-4929.
5.
Girdlestone J.
Synergistic induction of HLA class I expression by RelA and CIITA.
Blood
2000;95:3804-3808.
6.
Girdlestone J.
Transcriptional regulation of MHC class I genes.
Eur J Immunogenetics.
1996;23:395-413[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Articles in Blood Online:
-
Inactivation of the ATM Gene in T-Cell Prolymphocytic Leukemias
- Dominique Stoppa-Lyonnet, Jean Soulier, Anthony Laugé, Hélène Dastot, Richard Garand, François Sigaux, and Marc-Henri Stern
Blood 1998 91: 3920-3926.
[Abstract]
[Full Text]
[PDF]
-
Regulated Genomic Instability and Neoplasia in the Lymphoid Lineage
- Gary J. Vanasse, Patrick Concannon, and Dennis M. Willerford
Blood 1999 94: 3997-4010.
[Full Text]
[PDF]
-
Synergistic induction of HLA class I expression by RelA and CIITA
- John Girdlestone
Blood 2000 95: 3804-3808.
[Abstract]
[Full Text]
[PDF]
-
Clinical manifestations, management, and molecular genetics in congenital factor VII deficiency: the International Registry on Congenital Factor VII Deficiency (IRF7)
- Guglielmo Mariani, Falko H. Herrmann, Francesco Bernardi, Jean-Francois Schved, Gunther Auerswald, Jorgen Ingerslev, and The Factor VII Deficiency Study Group
Blood 2000 96: 374.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
D. R. Johnson
Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression
J. Immunol.,
February 15, 2003;
170(4):
1894 - 1902.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. P. Gobin, M. van Zutphen, S. D. Westerheide, J. M. Boss, and P. J. van den Elsen
The MHC-Specific Enhanceosome and Its Role in MHC Class I and {beta}2-Microglobulin Gene Transactivation
J. Immunol.,
November 1, 2001;
167(9):
5175 - 5184.
[Abstract]
[Full Text]
[PDF]
|
|
|
| |
