|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Liver Unit and the Department of Internal
Medicine A, and the Institute of Hematology, Bnai Zion Medical Center;
Division of Hematology, Rambam Medical Center, and Department of
Pathology, Carmel Medical Center, Bruce Rappaport Faculty of Medicine,
Technion, Israel Institute of Technology, Haifa, Israel.
The mechanism of lymphomagenesis of hepatitis C virus
(HCV)-related B-cell lymphoma is unknown. Recently, it has been
suggested that HCV may induce B-cell clonal proliferation and t(14;18)
translocation in patients chronically infected with the virus. Thus,
this study investigated the effect of antiviral treatment on
immunoglobulin heavy-chain gene (IgH) rearrangement and t(14;18)
translocation in HCV infected patients. Twenty-nine patients with
chronic HCV infection were studied in whom IgH rearrangement and/or
t(14;18) translocation were previously detected. The IgH rearrangement (FR3/JH) and t(14;18) translocation (MBR
bcl2-JH) were detected in peripheral blood mononuclear
cells by polymerase chain reaction. Fifteen of 29 patients (8 with IgH
rearrangement, 6 with t(14;18) translocation, and 1 with both) were
treated with either interferon- Lymphomagenesis is a multistep process in which
environmental, genetic, and infectious factors are variably involved.
Viral agents have been implicated in the pathogenesis of various types of hematologic malignancies. They may facilitate the
appropriate milieu for the development of lymphoma, which may thus
constitute one of the opportunistic neoplasias. Examples of this
mechanism include the human immunodeficiency virus and B-cell lymphoma. Alternatively, they may act more directly, as in the Epstein-Barr virus
with Burkitt's lymphoma, human T-lymphotropic virus I with human
T-cell leukemia, or the human herpes 8 virus with body cavity-based non-Hodgkin lymphoma.1 Recently, hepatitis C virus (HCV)
has been recognized as an additional agent that may possibly play a
role in the multifactorial process of lymphomagenesis.2-4
However, the mechanism of malignant transformation is still unknown. In addition to its being hepatotrophic, HCV is also a lymphotrophic virus
that is able to infect and replicate within peripheral blood mononuclear cells (PBMCs).5 Chronic infection with HCV has been clearly shown to be associated with mixed cryoglobulinemia type
II, which is characterized by clonal expansion of B cells and can be
considered a smoldering, low-grade lymphoma that may evolve into an
overt or high-grade lymphoma in some patients.6-11 Within
this context, a possible mechanism for malignant transformation may
involve clonal proliferation of B cell induced by the virus, inhibition
of apoptotic cell death of the infected lymphocytes by bcl-2 oncogene
product, or both. Recently, an increased rate of clonal proliferation
of B cells and bcl-2 translocation and overexpression in PBMCs of
patients with HCV infection was demonstrated.12-14 Because
chronic antigenic stimulation by HCV has been shown to play a role in
the development of B-cell expansion and malignant transformation of
immunocytomas,15 it is possible that eradication of the
persistent infection by antiviral treatment may possibly lead to
regression of the proliferating clone. Thus, this study was conducted
to investigate the effect of antiviral treatment on B-cell
proliferation and bcl-2 translocation in patients chronically infected
by HCV.
Twenty-nine patients with chronic HCV infection were
studied who are followed at the Liver Clinic at Bnai Zion Medical
Center and in whom either immunoglobulin heavy-chain gene (IgH)
rearrangement, t(14;18) translocation, or both were detected in PBMCs
in our previous study.14 All patients had HCV antibody and
detectable HCV RNA in the serum. Excluded were patients who tested
positive for antibodies to human immunodeficiency virus or for
hepatitis B surface antigen and patients with B-cell malignancy.
Sixteen patients had a monoclonal IgH rearrangement, 12 had a
reciprocal t(14;18) translocation, and one patient had both. Fifteen of
the 29 patients received antiviral therapy; 8 of these 15 patients were
IgH+, 6 were t(14;18)+, and one patient was
positive for both an IgH rearrangement and t(14;18) translocation. A
total of 14 patients received no treatment, including 8 with an IgH
rearrangement and 6 with a t(14;18) translocation. Antiviral treatment
was avoided in these patients for the following reasons: decompensated
cirrhosis or age older than 65 years (9 patients), significant
cytopenia (ie, hemoglobin < 100 g/L [< 10 g/dL], leukocytes
< 3.0 × 109/L [< 3000/µL], or platelets
< 75 × 109/L [< 75 000/µL]) (n = 3),
severe depression (n = 1), and refusal of treatment (n = 1). Liver
biopsy was performed in all treated patients and in 9 (64%) of the
nontreated group. In all patients, a "liver panel" (alanine and
aspartate aminotransferases, serum albumin and globulin, bilirubin,
alkaline phosphatase, lactic dehydrogenase, and prothrombin time) and
detection of anti-HCV antibody, HCV RNA, t(14;18) translocation, and
IgH rearrangement were performed at baseline. Evaluation of alanine
aminotransferase (ALT), t(14;18) translocation, and IgH rearrangement
was also performed at the end of treatment in the treated patients and 12 months after baseline evaluation in the nontreated patients. Testing
for HCV RNA was also performed at 6 months and at the end of treatment
in the treated group and at 12 months after baseline evaluation in the
nontreated group. HCV genotype was determined in 13 of 15 and 8 of 14 treated and nontreated patients, respectively. Patients gave written
informed consent, and the study was approved by the Institutional
Review Board of the B'nai Zion Medical Center.
Definition of response
Antiviral treatment
Assessment of HCV infection Anti-HCV was detected using a second-generation enzyme-linked immunosorbent assay (ELISA II) (Abbott Laboratories, North Chicago, IL). Blood samples for HCV RNA determination and HCV genotyping were processed and stored at optimal conditions as described by Davis et al.19 HCV RNA in the serum was measured by a reverse transcription-polymerase chain reaction assay (Amplicor HCV test; Roche Molecular Systems, Somerville, NJ) as previously described.20 HCV genotyping was performed on all HCV RNA+ specimens using genotype-specific primers from the HCV core region under conditions previously described.21Detection of bcl2-JH translocation Detection of IgH rearrangement IgH (FR3/JH) rearrangement was detected by a seminested PCR approach. The reaction mixtures were essentially as those for t(14;18) except for the 5' primer, which was FR3 (ACACGGCTCTGTATTACTCT). Reaction mixtures were heated at 94.5°C for 1 minute, followed by 30 cycles of 40 seconds at 94°C, 40 seconds at 55°C, and 40 seconds at 72°C, with a 5-minute final extension at 72°C. A second round of amplification using 2 µL of 1:500 dilution of the initial reaction was performed under similar conditions using JH in primer for 20 cycles only. PCR products were analyzed on 6% polyacrylamide gels. With each experiment, both positive and negative control samples were carried through all the steps with the other samples.Cryoglobulin detection and analysis Venous blood samples were collected into prewarmed tubes after overnight fast and allowed to clot at 37°C. After centrifugation, sera were incubated at 4°C for 3 days. The cryocrit was evaluated by centrifugation of the serum in hematocrit tubes at 4°C. The cryoprecipitate was washed at 4°C and then resolubilized at 37°C. The purified cryoglobulin was further analyzed and characterized by immunofixation electrophoresis (Immunofix Kit; Helena Laboratories, Beaumont, TX).Statistical analysis Comparison between continuous parametric groups was performed using the Student t test for unpaired groups. Equality of variances was performed using the Levene test. Associations between categorical groups were analyzed using the chi-square test or Fisher exact test when appropriate. Two-tailed P values of .05 or less were considered to be statistically significant. For statistical analysis of the data, the SPSS package for Windows was used.
Table 1 summarizes the
characteristics of the treated and nontreated groups. The patients in
the nontreated group were older and had a higher rate of cirrhosis. The
2 groups were comparable with respect to gender, the presence and
levels of cryoglobulin, mean ALT levels, and rate of genotype 1. Eight
of 15 (53%) treated and 6 of 14 (43%) nontreated patients had risk
factors for acquisition of HCV infection. The duration of HCV infection
as was determined from the occurrence of a potential risk factor for
HCV infection (ie, blood transfusion, injection drug use, or tattooing)
to the detection of IgH and/or t(14;18) translocation was similar among patients of both groups. Notably, 4 patients (2 in each group) had a
normal ALT; 3 of them had no liver disease. Although 22 patients (13 treated, 9 untreated) had cryoglobulinemia, only 8 of the 13 treated
and 3 of the 9 untreated patients had symptoms related to
cryoglobulinemia (ie, dermal vasculitis, arthritis, Raynaud phenomenon,
peripheral neuropathy, or renal involvement).
The clinical data and the effect of antiviral treatment in each patient
are depicted in Table 2. Two of the
treated patients (patients 7 and 13) received antiviral treatment for
symptomatic cryoglobulinemia but had no liver disease. Table
3 summarizes the effect of antiviral
treatment on immunoglobulin heavy-chain gene rearrangement and t(14;18)
translocation in treated and nontreated patients.
At the end of treatment, IgH rearrangement became negative in 7 of 9 treated patients (77%) compared with only 1 of 8 IgH+
nontreated patients (12.5%) (P < .02). The loss of IgH
in the patients who received antiviral treatment was strongly
associated with virologic response: 6 of the 7 (86%) treated patients
in whom IgH rearrangement became negative had cleared the virus at the
end of therapy (Figure 1). In 1 patient,
IgH rearrangement could not be detected despite persistence of HCV
infection. In contrast, none of the nontreated patients had lost the
HCV RNA, including 1 patient who became IgH
Two of the 8 nontreated patients who had previous IgH rearrangement but no bcl-2 translocation (patients No. 6 and 8, Table 2), acquired a new t(14;18) translocation during the follow-up period (ie, after 12 months). None of these patients had clinical symptoms or signs suggesting lymphoma. One other nontreated patient (patient No. 13, Table 2) with t(14;18) translocation without IgH rearrangement developed extranodal, diffuse large cell, non-Hodgkin lymphoma of the urinary bladder 11 months after enrollment in the study. In a second nontreated patient (patient No. 14, Table 2) with t(14;18) translocation but without IgH rearrangement, diffuse large cell, nodal, non-Hodgkin lymphoma was diagnosed 12 months from the detection of B-cell monoclonality.
The data presented in this study show that antiviral treatment may
result in regression of t(14;18) translocation and B-cell clonality in
patients with chronic HCV infection. Treatment with interferon- Recent studies showed an increased frequency of B-cell clonality and t(14;18) translocation in HCV infected patients,12-14,23 suggesting that HCV may induce clonal proliferation of B cells. However, the pathogenetic mechanism of inducing such clonal expansion is not clear. The recent report of somatic hypermutation and preferential expression of the VH 51p1/VL kv325 immunoglobulin gene combination in HCV-associated immunocytomas15 supports the role of chronic antigenic stimulation in inducing B-cell clonality in HCV infected patients. Ivanovski et al have demonstrated substantial intraclonal VH and/or VL gene diversity in each case, consistent with an ongoing somatic hypermutation process in the tumor cells subsequent to the neoplastic transformation.15 A striking similarity regarding V gene repertoire and somatic hypermutation exists between HCV-associated immunocytoma and salivary gland mucosa-associated lymphoid tissue (MALT) lymphoma,24 implying a clonal proliferation of a highly selected B-cell population in response to chronic antigenic stimulation. Thus, it is reasonable to hypothesize that eradication of the antigen may result in disappearance of the proliferating B-cell clone. In concordance with this hypothesis is the well-established association of gastric MALTomas with chronic Helicobacter pylori infection. Eradication of the chronic antigenic stimulation (ie, H pylori) by triple antibiotic therapy results in regression of lymphoma in most patients.25,26 Further support to the analogy between HCV-related lymphoma and gastric MALTomas is the report of Mazzaro et al, in which a regression of monoclonal B-cell expansion in HCV-infected patients with mixed cryoglobulinemia (MC) following interferon treatment was demonstrated.27 The favorable effect of interferon therapy in inducing regression of the proliferative B-cell clone or t(14;18) translocation in HCV-infected patients may be achieved through viral clearance, although its direct antiproliferative effect may also play a role. However, the close association between the virologic response and the loss of B-cell monoclonality and t(14;18) in the present study indicates that the more effective the antiviral therapy is, the more likely is loss of B-cell clonality. The thrust of these conclusions is based on the significant percentage of patients with a biochemical, virologic, and clonal proliferative response following treatment, as demonstrated in Table 2. Such a degree of spontaneous responsiveness must be considered highly unlikely to have occurred independently of therapy. Within this context it is recognized that untreated patients with more advanced disease, as manifested by the presence of cirrhosis, may not represent the perfect matched control population (Table 2), although the absence of response in IgH rearrangement or bcl-2 translocation is much more likely to be associated with the fact that such patients received no therapy. Moreover, there are no solid data to support a quantitative increase in cells bearing t(14;18) or IgH rearrangement in patients with more advanced liver disease (ie, cirrhosis) as compared with noncirrhotic patients. In addition, the older age of the untreated group may contribute to the increased frequency of detection of cells bearing t(14;18) translocation, as suggested by several reports. However, the clonality, as assessed by the presence of t(14;18) translocation, was confirmed by the proper size of the PCR product, and remained unchanged during follow-up. Clonal B-cell expansion and the presence of t(14;18) translocation in HCV+ patients may reflect a premalignant state, at least in some. In our study, 2 patients developed overt lymphoma within 12 months from the detection of B-cell monoclonality. However, the risk of developing B-cell non-Hodgkin lymphoma in HCV-infected patients is unknown. In a recent report from Japan, the relative risk of developing B-cell lymphoma was 2.1 in patients with chronic HCV infection, after a median of 13 years from the onset of HCV infection.28 Thus, antiviral therapy may also be indicated in HCV-infected patients with evidence of clonal expansion of B cell to decrease the risk for developing lymphoma, even in the absence of liver disease. One of the clinical implications of the present study relates to the
management of HCV-related indolent lymphomas. In respect to this issue,
low-grade lymphomas are currently incurable. Traditionally, the
management of low-grade, asymptomatic lymphomas involves a watch-and-wait policy. Alternatively, interferon- In conclusion, antiviral therapy for HCV infection may lead to the loss
of t(14;18) translocation and regression of B-cell clonal
proliferation. The loss of bcl-2 translocation and IgH rearrangement is
closely associated with virologic response to antiviral therapy. The
mechanism of this response can be related to a direct effect of
interferon-
Submitted May 4, 2000; accepted October 27, 2000.
E.Z. and T.Z. made equal contributions to this study and share first authorship.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Eli Zuckerman, Liver Unit, Department of Internal Medicine A, B'nai Zion Medical Center, 47 Golomb St, PO Box 4940, Haifa 31048 Israel.
1. Lyons FS, Liebowitz DN. The role of human viruses in the pathogenesis of lymphoma. Semin Oncol. 1998;25:461-475[Medline] [Order article via Infotrieve]. 2. Ferri C, Caracciolo F, Zignego AL, et al. Hepatitis C virus infection in patients with non-Hodgkin's lymphoma. Br J Hematol. 1994;88:392-394[Medline] [Order article via Infotrieve].
3.
Silvestri F, Pipan C, Barillari G, et al.
Prevalence of hepatitis C virus infection in patients with lymphoproliferative disorders.
Blood.
1996;87:4296-4301
4.
Zuckerman E, Rosenvald-Zuckerman T, Duer D, et al.
Hepatitis C infection in patients with non-Hodgkin B-cell lymphoma.
Ann Intern Med.
1997;127:423-428 5. Zignego AL, Macchia D, Monti M, et al. Infection of peripheral mononuclear blood cells by hepatitis C virus. J Hepatol. 1992;15:382-386[CrossRef][Medline] [Order article via Infotrieve]. 6. Misiani R, Bellavita P, Fenili D, et al. Hepatitis C infection in patients with essential mixed cryoglobulinemia. Ann Intern Med. 1992;117:573-577. 7. Angello V, Chung RT, Kaplan LM. A role for hepatitis C virus infection in type II cryoglobulinemia. N Engl J Med. 1992;327:1490-1495[Abstract]. 8. Ferri C, La Civita A, Longombardo G, et al. Hepatitis C virus and mixed cryoglobulinemia [review]. Eur J Clin Invest. 1993;23:399-405[Medline] [Order article via Infotrieve]. 9. Monteverde A, Ballare M, Pileri S. Hepatic lymphoid aggregates in chronic hepatitis C and mixed cryoglobulinemia. Springer Semin Immunopathol. 1997;19:99-110[CrossRef][Medline] [Order article via Infotrieve]. 10. Monteverde A, Rivano MT, Allegra GC, et al. Essential mixed cryoglobulinemia, type II: a manifestation of a low-grade malignant lymphoma? Acta Hematol. 1998;79:20-25[Medline] [Order article via Infotrieve]. 11. Pozzato G, Mazzaro C, Crovatto M, et al. Low-grade malignant lymphoma, hepatitis C virus infection, and mixed cryoglobulinemia. Blood. 1994;84:8047-8053. 12. Zignego AL, Giannelli F, Marrocchi ME, et al. T(14;18) translocation in chronic hepatitis C virus infection. Hepatology. 2000;31:474-479[CrossRef][Medline] [Order article via Infotrieve]. 13. Kitay-Cohen Y, Amiel A, Hilzenrat N, et al. Bcl-2 rearrangement in patients with chronic hepatitis C associated with essential mixed cryoglobulinemia type II [abstract]. Hepatology. 1999;30(suppl):283A[CrossRef]. 14. Zuckerman E, Zuckerman T, Sahar D, et al. BCL2 and immunoglobulin gene rearrangement in patients with HCV infection. Br J Hematol. In press.
15.
Ivanovski M, Silvestri F, Pozzato G, et al.
Somatic mutation, clonal diversity, and preferential expression of the VH 51p1/ VL kv325 immunoglobulin gene combination in hepatitis C virus associated immunocytomas.
Blood.
1998;91:2433-2442 16. Poynard T, Marcellin P, Lee S, et al. Randomized trial of interferon alfa-2b plus ribavirin for 48 weeks or 24 weeks versus interferon alfa-2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. Lancet. 1998;352:1426-1432[CrossRef][Medline] [Order article via Infotrieve].
17.
McHutchinson J, Gordon S, Schiff E, et al.
Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C.
N Engl J Med.
1998;339:1485-1492 18. Weiland O. Treatment of naive patients with chronic hepatitis C. J Hepatol. 1998;131(suppl 1):168-173. 19. Davis GL, Lau JY-N, Urdea MS, et al. Quantitative detection of hepatitis C virus RNA with a solid-phase signal amplification method: definition of optimal conditions for specimen collection and clinical amplification in interferon-treated patients. Hepatology. 1994;19:1337-1341[CrossRef][Medline] [Order article via Infotrieve]. 20. Nolte FS, Thurnmond C, Fried MW. Preclinical evaluation of AMPLICOR hepatitis C virus test for detection of hepatitis C virus RNA. J Clin Microbiol. 1995;33:1775-1778[Abstract]. 21. Ohno T, Mitzokami M, Wu R-R, et al. A new hepatitis C genotyping system that allows for identification of HCV genotypes 1a, 1b, 2a, 2b, 3a, 3b, 4, 5a, and 6a. J Clin Microbiol. 1996;36:201-206.
22.
Gribben JG, Freedman AS, Woo SD, et al.
All advanced stage non-Hodgkin's lymphoma with polymerase chain reaction amplifiable breakpoint of bcl-2 have residual cells containing the bcl-2 rearrangement at evaluation and after treatment.
Blood.
1991;78:3275-3280 23. Franzin F, Efremov DG, Pozzato G, et al. Clonal B-cell expansion in peripheral blood of HCV-infected patients. Br J Hematol. 1995;90:548-552[Medline] [Order article via Infotrieve]. 24. Bahler DW, Miklos JA, Swerdlow SH. Ongoing Ig gene hypermotation in salivary gland mucosa-associated lymphoid tissue-type lymphomas. Blood. 1997;89:8335-8344. 25. Wotherspoon AC, Doglioni C, Diss TC, et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet. 1993;342:575-577[CrossRef][Medline] [Order article via Infotrieve]. 26. Zucca E, Roggero E, Pileri S. B-cell lymphoma of MALT type: a review with special emphasis on diagnostic and management problems of low-grade gastric tumours. Br J Hematol. 1998;100:3-14[CrossRef][Medline] [Order article via Infotrieve]. 27. Mazzaro C, Franzin F, Tulissi P, et al. Regression of monoclonal B-cell expansion in patients affected by mixed cryoglobulinemia responsive to alfa-interferon therapy. Cancer. 1996;77:2604-2613[CrossRef][Medline] [Order article via Infotrieve]. 28. Ohsawa M, Shingu N, Miwa H, et al. Risk of non-Hodgkin's lymphoma in patients with hepatitis C virus infection. Int J Cancer. 1999;80:237-239[CrossRef][Medline] [Order article via Infotrieve]. 29. Ozer H, Wiernik P, Giles F, et al. Recombinant interferon alfa therapy in patients with follicular lymphoma. Cancer. 1998;82:1821-1839[CrossRef][Medline] [Order article via Infotrieve]. 30. Hermine O, Lefrere F, Bronowicki JP, et al. Patients with splenic lymphoma with villous lymphocytes associated with hepatitis C infection may enter in complete clinical response after reduction of viral load [abstract]. Blood. 1999;94(suppl 1):660a.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  C. S. Rabkin, C. Hirt, S. Janz, and G. Dolken t(14;18) Translocations and Risk of Follicular Lymphoma J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 48 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. D. Charles, R. M. Green, S. Marukian, A. H. Talal, G. V. Lake-Bakaar, I. M. Jacobson, C. M. Rice, and L. B. Dustin Clonal expansion of immunoglobulin M+CD27+ B cells in HCV-associated mixed cryoglobulinemia Blood, February 1, 2008; 111(3): 1344 - 1356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Saadoun, D. A. Landau, L. H. Calabrese, and P. P. Cacoub Hepatitis C-associated mixed cryoglobulinaemia: a crossroad between autoimmunity and lymphoproliferation Rheumatology, August 1, 2007; 46(8): 1234 - 1242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C Visco, L Arcaini, E Brusamolino, S Burcheri, A Ambrosetti, M Merli, E Bonoldi, M Chilosi, A Viglio, M Lazzarino, et al. Distinctive natural history in hepatitis C virus positive diffuse large B-cell lymphoma: analysis of 156 patients from northern Italy Ann. Onc., September 1, 2006; 17(9): 1434 - 1440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mazzaro, M. Spina, and U. Tirelli Regression of Low-Grade Non-Hodgkin's Lymphoma After Treatment With Pegylated Interferon Plus Ribavirin in Hepatitis C Virus Infection J. Clin. Oncol., July 1, 2005; 23(19): 4470 - 4471. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Carbonari, E. Caprini, T. Tedesco, F. Mazzetta, V. Tocco, M. Casato, G. Russo, and M. Fiorilli Hepatitis C Virus Drives the Unconstrained Monoclonal Expansion of VH1-69-Expressing Memory B Cells in Type II Cryoglobulinemia: A Model of Infection-Driven Lymphomagenesis J. Immunol., May 15, 2005; 174(10): 6532 - 6539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Vallisa, P. Bernuzzi, L. Arcaini, S. Sacchi, V. Callea, R. Marasca, A. Lazzaro, E. Trabacchi, E. Anselmi, A. L. Arcari, et al. Role of Anti-Hepatitis C Virus (HCV) Treatment in HCV-Related, Low-Grade, B-Cell, Non-Hodgkin's Lymphoma: A Multicenter Italian Experience J. Clin. Oncol., January 20, 2005; 23(3): 468 - 473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Saadoun, F. Suarez, F. Lefrere, F. Valensi, X. Mariette, A. Aouba, C. Besson, B. Varet, X. Troussard, P. Cacoub, et al. Splenic lymphoma with villous lymphocytes, associated with type II cryoglobulinemia and HCV infection: a new entity? Blood, January 1, 2005; 105(1): 74 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. H. Sasso, M. Martinez, S. L. Yarfitz, P. Ghillani, L. Musset, J.-C. Piette, and P. Cacoub Frequent Joining of Bcl-2 to a JH6 Gene in Hepatitis C Virus-Associated t(14;18) J. Immunol., September 1, 2004; 173(5): 3549 - 3556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Bougie and M. Bisaillon The Broad Spectrum Antiviral Nucleoside Ribavirin as a Substrate for a Viral RNA Capping Enzyme J. Biol. Chem., May 21, 2004; 279(21): 22124 - 22130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Morton, E. A. Engels, T. R. Holford, B. Leaderer, Y. Zhang, S. H. Zahm, P. Boyle, B. Zhang, S. Flynn, G. Tallini, et al. Hepatitis C Virus and Risk of Non-Hodgkin Lymphoma: A Population-Based Case-Control Study among Connecticut Women Cancer Epidemiol. Biomarkers Prev., March 1, 2004; 13(3): 425 - 430. [Abstract] [Full Text]
|
|
|
|
|
|
I. Bougie and M. Bisaillon Initial Binding of the Broad Spectrum Antiviral Nucleoside Ribavirin to the Hepatitis C Virus RNA Polymerase J. Biol. Chem., December 26, 2003; 278(52): 52471 - 52478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. C. Turner, G. Dusheiko, and A. Jones Hepatitis C and B-cell lymphoma Ann. Onc., September 1, 2003; 14(9): 1341 - 1345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Giannelli, S. Moscarella, C. Giannini, P. Caini, M. Monti, L. Gragnani, R. G. Romanelli, V. Solazzo, G. Laffi, G. La Villa, et al. Effect of antiviral treatment in patients with chronic HCV infection and t(14;18) translocation Blood, August 15, 2003; 102(4): 1196 - 1201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ni, E. Hembrador, A. M. Di Bisceglie, I. M. Jacobson, A. H. Talal, D. Butera, C. M. Rice, T. J. Chambers, and L. B. Dustin Accumulation of B Lymphocytes with a Naive, Resting Phenotype in a Subset of Hepatitis C Patients J. Immunol., March 15, 2003; 170(6): 3429 - 3439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mazzaro, D'A. Little, G. Pozzato, L. A. Emens, M. S. Sulkowski, V. Agnello, C. Mecucci, M. Casato, F. Lefrere, X. Troussard, et al. Regression of Splenic Lymphoma after Treatment of Hepatitis C Virus Infection N. Engl. J. Med., December 26, 2002; 347(26): 2168 - 2170. [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Zignego, C. Ferri, F. Giannelli, C. Giannini, P. Caini, M. Monti, M. E. Marrocchi, E. Di Pietro, G. La Villa, G. Laffi, et al. Prevalence of bcl-2 Rearrangement in Patients with Hepatitis C Virus-Related Mixed Cryoglobulinemia with or without B-Cell Lymphomas Ann Intern Med, October 1, 2002; 137(7): 571 - 580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Hermine, F. Lefrere, J.-P. Bronowicki, X. Mariette, K. Jondeau, V. Eclache-Saudreau, B. Delmas, F. Valensi, P. Cacoub, C. Brechot, et al. Regression of Splenic Lymphoma with Villous Lymphocytes after Treatment of Hepatitis C Virus Infection N. Engl. J. Med., July 11, 2002; 347(2): 89 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Giannini, P. Caini, F. Giannelli, F. Fontana, D. Kremsdorf, C. Brechot, and A. L. Zignego Hepatitis C virus core protein expression in human B-cell lines does not significantly modify main proliferative and apoptosis pathways J. Gen. Virol., June 1, 2002; 83(7): 1665 - 1671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Rabkin, B. H. Tess, R. E. Christianson, W. E. Wright, D. J. Waters, H. J. Alter, and B. J. van den Berg Prospective study of hepatitis C viral infection as a risk factor for subsequent B-cell neoplasia Blood, May 13, 2002; 99(11): 4240 - 4242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X Mariette Lymphomas complicating Sjogren's syndrome and hepatitis C virus infection may share a common pathogenesis: chronic stimulation of rheumatoid factor B cells Ann Rheum Dis, November 1, 2001; 60(11): 1007 - 1011. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
or by combination therapy with
interferon and ribavirin for 6 to 12 months. IgH rearrangement became
negative in 7 of 9 treated patients compared with only 1 of 8 of
nontreated patients (P < .02). The t(14;18)
translocation became negative in 6 of 7 treated patients compared with
1 of 6 nontreated patients (P = .03). Disappearance of
IgH rearrangement or t(14;18) translocation was strongly associated with virologic response to treatment. Two t(14;18)+
patients developed B-cell lymphoma during follow-up. Antiviral treatment appears to be effective in eliminating the clonal
proliferation of B cells in patients with chronic HCV infection and may
prevent the subsequent development of lymphoma. The mechanism can be
related to a direct effect of interferon-
t(14;18)
. Treatment
with antiviral therapy led to the loss of t(14;18) translocation in 6 of 7 (86%) treated patients. Disappearance of t(14;18) translocation
was strongly associated with virologic response to treatment: In 5 of 6 treated patients who lost the translocation, HCV RNA became negative at
the end of treatment (Figure 
