|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Laboratoire d'Immunologie Cellulaire, Hopital
Pitié-Salpétrière; the Department of Infectious
Diseases and Tropical Medicine, Hopital
Pitié-Salpétrière, Paris, France; and the Faculty of
Life Sciences, Bar-Ilan University, Ramat-Gan, Israel.
Analysis of T-cell receptor (TCR) repertoire usage made by
peripheral T lymphocytes during the chronic phase of HIV-1 infection has revealed the presence of clonal expansions of CD8 T cells that are
also shown to be largely HIV-specific. Yet, it remains unclear whether
the global repertoire perturbation observed during the chronic phase of
the infection is also HIV-related and reversible in the long term with
the application of highly active antiretroviral therapy. Furthermore,
the diversity and the stability of repertoire usage after a relapse of
viral replication were never examined. Eight patients were observed
longitudinally up to 31 months under triple-association therapy. When
viral replication was steadily suppressed, CD8 repertoires were
significantly stabilized. Conversely, in situations of incomplete or
only transient viral suppression, persistence or rebound in repertoire
perturbation was observed. Finally, a T-cell response remarkably
different from baseline, as reflected by a repertoire switch, was
generated after the discontinuation of highly active therapy. In
conclusion, a sustained control of HIV replication correlated with
profound modifications of the CD8 repertoire usage. These data also
suggested that autovaccination by the withdrawal of antiviral drugs
would result in the selection and expansion of T-cell clones that were
not necessarily dominant before the onset of treatment.
(Blood. 2001;97:1787-1795) In adults, the size of the peripheral lymphocyte
population is under homeostatic control, and the total number of T
cells remains constant.1 In mice expressing a transgenic
T-cell receptor (TCR), it has been elegantly shown that memory cells
are maintained for extended periods of time in peripheral pools (though
the size of individual clones decays progressively), whereas new thymic emigrants expressing a diverse repertoire constantly replace
autoreactive and anergic T cells.2 It was proposed that in
HIV-infected patients, CD4+ (and ultimately
CD8+) T cell loss translates into massive T-cell repertoire
deletions.3 In a previous work,4 we showed
that CD4 T-cell repertoires are indeed perturbed in patients with
advanced HIV disease. However, the CD4 repertoire perturbation was not,
as previously concluded,3 the result of massive clonal
deletions but could also be solely explained by the existence of
multiple clonal expansions in that subset.4,5
Nevertheless, it could be feared that the effects of repetitive
antigenic stimulations that bias the peripheral repertoire in HIV
patients could never be compensated, even after the retrieval of the
antigenic stimuli, because of irreversible damage to the thymic
micro-environment.6 However, after 3 to 6 months of efficient treatment, immunoscope profiles derived from
peripheral blood CD4 T cells of HIV patients were found to be
comparable to the corresponding control data obtained from uninfected
controls.4 Long-lasting recovery of CD4 T-cell function
was also evidenced in the successfully treated patients from that
group.7 In comparison, a bias in the usage of the CD8
repertoire appeared to persist in 10 patients observed through 6 months
of treatment.4 In another study,8 persistent
alterations in CD8 T-cell repertoire were also reported after 11 months
of highly active antiretroviral therapy (HAART) in 3 patients, though
HIV replication had been suppressed below the detection level.
The latter results could appear to contradict the conclusions of other
studies that relied on the use of peptide-major histocompatibility tetrameric complexes because a relatively rapid decrease in the frequency of tetramer-stained cells was noted in most patients receiving HAART.9,10 HLA-tetrameric complexes have
allowed, for the first time, a direct ex vivo quantitative analysis of HIV-specific T-cell immunity, but their use is limited to the analysis
of few predefined epitopes that are not necessarily immunodominant in
the patients analyzed. The tetramer-positive populations observed during HAART represented less 0.4%9 or less than
2%10 of all CD8+ T cells at baseline and
probably corresponded to only a fraction of the HIV-specific cellular
response. In a subsequent study it was indeed shown, using the same
technique, that chronically expanded CD8 T cells are also HIV
specific.11 HIV-specific cytotoxic T lymphocytes are found
in lymphoid organs,12 genital mucosae,13 and
skin of HIV-1-infected patients.14 Under HAART, the
redistribution15 and subsequent down-regulation of such
amplified subsets could take a substantial period of time; this
explains the lack of global repertoire stabilization previously
reported during the initial phase of HAART.4 Indeed, it
was recently shown that it takes 7 months to stabilize CD8 repertoires
when therapy is initiated during the primary phase of the
infection.16
Here, the follow-up of 8 chronically infected patients, taken from the
group previously defined in Gorochov et al,4 was extended
to the second semester of treatment (and in 4 cases at least 28 months
after the initiation of therapy) to analyze the long-term evolution of
the CD8 repertoire. For all patients, Immunoscope analysis was
performed at each time point. More detailed information on the
perturbations reported was obtained by combining the Immunoscope CDR3
length analysis with cytofluorometric analysis of BV subset frequencies and DNA sequencing of selected BV subsets. The strategy used in the current work for the evaluation of CD8 repertoire perturbation allows a quantitative and sensitive survey of a large fraction of the expressed repertoire. We show that the strong CD8 TCR
repertoire bias observed in the peripheral blood of HIV patients
results from the accumulation in this compartment of relatively few CD8
T-cell clones, whereas the polyclonal repertoire appears, as a result,
vastly underrepresented. That apparent reduction of diversity is not
irreversible. Indeed, a lasting suppression of HIV replication is
followed by a dramatic size reduction of the CD8 clonal expansions. One
year after the onset of a highly active antiretroviral treatment, and
in the absence of any other ongoing viral infection, the TCRBV
repertoire of peripheral CD8 T cells has returned to a predominantly
polyclonal configuration. In 2 such patients, a lack of adherence to
HAART resulted in a resumption of active viral replication and in the
recall of several baseline CD8 clones, but also in the expansion of
others not dominant at the onset of therapy.
Patients
Viral load measurement
Purification of CD8 T cells Peripheral blood mononuclear cells (PBMCs) were prepared by centrifugation on Ficoll-Hypaque (Pharmacia, Uppsala, Sweden). CD4 and CD8 cells were purified immediately after blood sampling. Cells were washed twice in phosphate-buffered saline (PBS)-0.5% bovine serum albumin (BSA), and CD4+ lymphocytes were first separated using anti-CD4 monoclonal antibodies coated on magnetic beads according to the manufacturer's instructions (Dynabeads; Dynal, Oslo, Norway). The CD8+ cells were purified after removal of the CD4+ cells using anti-CD8 magnetic beads. Bead-coated CD8 lymphocytes were washed 3 times in PBS-0.5% BSA. Purity was assessed by FACS analysis and also by PCR analysis using CD4- and CD8-specific primers on both fractions (not shown). At least 106 CD8+ cells (98% purity) were required for further analysis.Flow cytometry For double- or triple-fluorescence analysis of PBMCs, 5 × 105 cells were incubated for 30 minutes at 4°C with 5µg each monoclonal antibody (mAb) washed with PBS, then fixed with 2% paraformaldehyde in PBS and analyzed on a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Ten thousand events per sample were collected and analyzed using the CellQuest software (Becton Dickinson). All antibodies were obtained from Immunotech (Marseilles, France). All BV-specific mAbs listed in Table 2 were used as phycoerythrin conjugates, except for the anti-BV3 mAb, which was fluorescein isothiocyanate-labeled. The BV-specific monoclonal antibodies were a kind gift of Drs F. Romagne and A. Necker (Immunotech). Denominations correspond to the gene products recognized; the corresponding original clones are listed as follows: BV1S1 (clone BL37.2), BV2S1 (clone MPB2D5), BV3S1 (clone CH92), BV5S1 (clone IMMU157), BV5S2 (clone 36213), BV5S3 (clone 3D11), BV7S1 (clone ZOE), BV8S1/2 (clone 56C5), BV9S1 (clone FIN9), BV11S1 (clone C21), BV12S1 (clone VE R2.32), BV13S1 (clone IMMU222), BV13S6 (clone JU74), BV14S1 (clone CAS1.1.3), BV16S1 (clone TAMAYA), BV17S1 (clone E17SF3), BV18S1 (clone BA62.6), BV20S1 (clone ELL1.4), BV21S3 (clone IG125), BV22S1 (clone IMMU546), and BV23S1 (clone AF23). TCRBV gene segment denomination is in accordance with that of Wei et al.18 Specificities of the panel of antibodies used are based on the findings of the first workshop on human TCR monoclonal antibody19 and of Diu et al20 and Romagne et al.21,22 Those reagents have been tested on a group of 20 healthy seronegative controls to establish reference values and standard deviations.23
TCRBV analysis Total RNA was extracted directly from 106 to 107 bead-coated cells and reverse-transcribed using the single-strand synthesis kit (Stratagene, La Jolla, CA). Amplification reactions were performed using a BC1/BC2-specific primer (CGGGCTGCTCCTTGAGGGGCTGCG) and a BV-specific primer, along with a C
primer set as an internal control of amplification.24
Briefly, 2 µL RT product (corresponding to 2 × 104 to
2 × 105 CD4+ or CD8+ T cells)
were brought to a final reaction volume of 50 µL containing 10 mM
Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, pH 8.3, 20 pmol each oligonucleotide, 0.2 mM each dNTP, and 2.5 U Taq DNA
polymerase blocked by the addition of an anti-Taq mAb (Taq Start;
Clontech, San Diego, CA). After an initial denaturation step of 3 minutes at 95 °C, the reactions were subjected to 30 cycles of PCR
(94°C for 30 seconds, 60°C for 1 minute, 74°C for 1 minute),
followed by a final extension step of 5 minutes at 74°C. One nested
BC oligonucleotide (GTGCACCTCCTTCCCATTCA) was used dye-labeled (Joe Fluorophore; Applied Biosystems, Foster City, CA) in runoff reactions. Two microliters PCR product was added to 8 µL of a mixture containing 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl, pH
8.3, 0.2 mM each dNTP, 0.2 U Taq DNA polymerase, and 0.1 µM Joe
Fluorophore-labeled oligonucleotide. The extension reaction consisted
of a 3-minutes denaturation step at 95°C followed by 12 cycles of 30 seconds at 94°C, 30 seconds at 60°C, and 2 minutes at 72°C. A
final 10-minute incubation at 72°C was performed. Runoff products
were then loaded on a 4% acrylamide-4 M urea sequencing gel and run
on an ABI 377 DNA sequencer (Applied Biosystems). A mixture of
dye-labeled size standards was also loaded on the sequencing gel to
allow the precise determination of the sizes of the BC-BV runoff
reaction products. The sizes and areas of the peaks corresponding to
the DNA products were determined using the Immunoscope
software.25,26 The percentage of representation of each
peak size among all BC-BV segments was subsequently calculated.
Observed peaks were usually separated by 3 bases and corresponded to
in-frame transcripts of TCRs. Windows of analysis were centered on
expected sizes corresponding to TCR transcripts encoding a 10 residue-long CDR3 region, defined according to
Kabat.27
BV family-specific primers used were as follows: BV1, CCGCACAACAGTTCCCTGACTTGC; BV2, GGCCACATACGAGCAAGGCGTCGA; BV3, CGCTTCTTCCGGATTCTGGAGTCC; BV4, TTCCCATCAGCCGCCCAAACCTAA; BV5, AGCTCTGAGCTGAATGTGAACGCC; BV7, CCTGAATGCCCCAACAGCTCTCTC; BV8, CCATGATGCGGGGACTGGAGTTGC; BV15, CAGGCACAGGCTAAATTCTCCCTG; BV16, GCCTGCAGAACTGGAGGATTCTG. BV1, BV2, BV3, BV4, BV5, BV7, and BV8 families were among the most frequently represented in the periphery, whereas BV15 and BV16 were infrequent. BV amplicons of interest were gel-purified and directly ligated into the PCR II vector (TA cloning kit; Invitrogen, San Diego, CA). After amplification into Escherichia coli, plasmids were purified and their inserts were sequenced using an automated sequencer with M13R and T7 dye-labeled primers and AmpliTaq DNA polymerase FS (Perkin Elmer, Foster City, CA). Analysis of controlled serial dilutions of T cells showed that the proportions in the CDR3 length profiles are well conserved down to 4 × 105 cells used for RNA extraction 28 Quantitative analysis of repertoire perturbation The strategy adopted for quantitative analysis of repertoire perturbation was reported previously.4 Briefly, each CDR3 profile obtained from the Immunoscope analysis was translated into a probability distribution, P(i) = Ai/( i
Ai), using the fraction of the area (Ai) under
the profile for each CDR3 length i, from minimal to maximal
length in 3 nucleotide steps. The TCR-BV repertoire for each
sample j is represented by the set of corresponding probability distributions for the various BV families analyzed in the
CD8 subset. Thus, the probability distribution P  j[PThe extent of perturbation in a TCR profile was calculated for each
BVk by the distance between the probability distributions of sample j and the control,
D The statistical significance (P) of differences among
different subgroups of samples or patients was calculated using the nonparametric Wilcoxon rank sum test. Perturbations per BV family were
used when assessing the difference in perturbation between samples
(Figure 4). To evaluate the extent of normalization or further
perturbation in a patient, we calculated the changes in perturbation
per BV family ( In addition, to study the evolution of particular clonal expansions and
not only the general properties of the total repertoire, overrepresented peak sizes among the CDR3 profiles were tracked longitudinally. It has been consistently shown that such peaks usually
correspond to single clonal expansions.4,14,24,28 A
threshold (
Long-term persistence of CD8+ clonal expansions in patients with active HIV replication Cytofluorometric analysis of BV subsets, even when combined with semiquantitative RT-PCR analysis, underscores the extent of CD8 repertoire perturbation found in patients with HIV. As shown in Table 2, few BV subsets were clearly overrepresented in the total CD8 population. In contrast, with the use of Immunoscope, we found that repertoire perturbation was a consistent feature of the CD8 subset before active antiviral treatment because most of the CDR3 length-distribution profiles were notably disrupted. Such disruptions usually correspond to the presence of dominant clonal expansions within the corresponding BV subset.4,14,24,28 Several clonal expansions were stable over a follow-up period of 1 year to 3 years in patients with no highly active antiviral therapy.4To confirm that the repertoire perturbations we measured reflected
expansions of cell subsets, we measured the relative size of various BV
families using a large panel of antibodies covering at least 50% of
the BV repertoire. Expansions were defined based on published data
performed on healthy controls (see "Patients, materials, and
methods"). When FACS and CDR3 length analysis could be performed
simultaneously, the BV subsets with the most perturbed CDR3 profiles
were usually found to be expanded
By multiplying the fraction of cells in a certain BV family (as
measured by FACS) by the fraction of cells of a certain CDR3 length in
that BV family (as measured by Immunoscope), we obtained a maximal
estimate of the frequency of a certain clone from among all the CD8
cells in the blood. The largest clonal expansion documented in our
study (21% of all CD8 cells at M10) was found in patient T13. In that
case, a BV2 clone (with a CDR3 loop 10 AA long) persisted for at least
10 months. In 3 other patients (T8, T11, T16), several clones appeared
to persist for at least 30 months in the peripheral blood (Figures
1, 2).
Down-regulation of clonal expansion after successful and sustained antiviral treatment If the drastic CD8 repertoire perturbations were directly related to the presence of persistent HIV antigens, one would expect that on removal of the latter, CD8 repertoires would, like CD4 repertoires, return to normal. We were, therefore surprised to observe4 that CD8 repertoires remained biased after 6 months of antiviral treatment in most patients, even in those responding very well to therapy. The same patients were followed up for a longer time period. In 4 patients (T8, T17, T18, and T20), viral replication was efficiently suppressed during at least 3 months to levels below the detection threshold. In all 4 patients, the pretreatment CD8+ repertoires was significantly more perturbed (average, D = 30% ± 5%) than in noninfected controls (average, D = 15% ± 5%; P < .001). However, after at least 12 months of efficient therapy, the calculated average CD8 repertoire perturbation was significantly lower (D = 18% ± 8%; P < .001) than before treatment and comparable to that in HIV controls. The reduction of repertoire perturbation
corresponded to a down-regulation of baseline clonal expansions because
only 19% (6 of 31) of the baseline overrepresented peaks were still dominant after 12 to 30 months of evolution in these 4 successfully treated patients (Figure 2). For patient T20 the largest BV subset among CD8 PBMCs was BV5. Immunoscope analysis revealed that BV5 CD8
cells indeed appeared to be dominated by a single clone during the
first 6 months of therapy, but the CDR3 length distribution profile
obtained at 12 months after therapy was characteristic of a polyclonal
subset (Figure 3). This interpretation
was confirmed by DNA sequencing of BV5-specific PCR products obtained
just before the onset of treatment (M0 = day 1 of first month of
treatment) and after 3 or 12 months of treatment (M12 = day 360).
Table 3 shows that a single dominant CDR3 sequence (LGGRNSPLH) of CDR3 length 9 was indeed found at day 0 and day 180. In contrast, all CDR3
sequences from M12 were unrelated, and the above sequence was not found
anymore. Therefore, during the last 6 months of follow-up, the
frequency of the single CD8 T-cell clone, accounting previously for
most of the BV5 subset, was dramatically reduced (from 85% of the BV5
subset on day 0 to less than 5.5% a year later).
In the remaining 4 nonresponding patients (T11, T13, T16, and T19),
viral replication was never efficiently suppressed, and the CD8
repertoire remained significantly more perturbed (D = 29% ± 18%)
than in controls (D = 15% ± 5%; P < .001), even
during treatment (Figure 2). A large fraction (59%; 19 of 32) of the overexpanded peaks found at baseline in the nonresponding patients persisted after 12 to 30 months, significantly higher than in the
responding patients (19%; P < .001). In one of them,
patient T19, a transient control of HIV replication after 6 months of therapy was associated with a corresponding transient reduction in
repertoire perturbation (Figure 4).
Evolution of CD8 repertoires on resumption of HIV replication Two patients experienced early (T19) or late (T18) resumption of viral replication, probably attributable to withdrawal of the antiprotease in the first (Ritonavir was removed from the therapeutic regimen of T19 because of hepatic side effects) and to poor compliance in the second. Both patients experienced, during their first 6 months of treatment, substantial decreases in HIV viremia and repertoire stabilization. The expansion of clones that were not dominant, or even detectable, at baseline was mostly responsible for the rebound in repertoire perturbation observed. Four and 3 "new" clones are found at M28 in patient T18 and at M20 in patient T19, respectively. However, in patient T19, several baseline expanded clones were still present at M20 (Figure 5).
DNA sequencing confirmed that the repertoire bias was shifted in favor of previously undetected clones that expanded gradually during the time of analysis (eg, BV2, BV7, and BV8 for patient T19; Figure 5). As expected from the Immunoscope profile of BV2 obtained on day 0, TCR transcripts with 30-bp long CDR3 regions (CDR3 loop size 10) were predominantly characterized (8 of 18). Among those, a dominant clone (RDLKGLNTEA) was found (4 of 18). The same BV2 clone was still found 12 months later, but, at a greatly reduced frequency (1 of 9), it was no longer detectable at M20 (Table 4). Instead, a previously undetected TCR clone with an 8-residue-long CDR3 became progressively dominant (6 of 9, then 2 of 21). In the BV7 subset, M3, M6, M12, and M20 CDR3 sequences were completely unrelated to the pretreatment dominant clones (Table 4). Interestingly, the repertoire shift occurred very early because the baseline BV7 clone did not dominate the subset after only 1 month of evolution. A different situation occurred in the BV8 subset, in which the same dominant clones were detected in the 20 months of follow up.
We have attempted a global and nevertheless quantitative analysis
of CD8 T-cell repertoires in patients with HIV. Immunoscope analysis
has revealed, before antiviral treatment, dominant clones in virtually
every BV subset analyzed, in all cases studied. A high proportion of
individual clonal expansions was remarkably stable for extended periods
of time. The disrupted CDR3 length profiles are obviously not the
result of multiple clonal deletions but correspond to single clonal
expansions among a particular BV subset, as confirmed by DNA
sequencing. Indeed, if we assume that the TCR- As reported previously, clonal CD8 T cell expansions can frequently be found in healthy young adults,4,30; however, only a few clones reach detection levels, and they typically become stable with time.30 In contrast, CD8 repertoires of HIV patients are predominantly oligoclonal and are susceptible to extensive reorganization under treatment. In the 4 patients in whom HIV RNA levels were maintained below 200 copies/mL for prolonged periods (T8/M30, T17/M12, T18/M12, T20/M12), CD8 repertoires were significantly stabilized. In one of them (patient T8), a significant level of perturbation was nevertheless maintained, though HIV viremia remained undetectable for at least 20 months. Because the repertoire bias documented in patients with HIV can presumably be modulated by many pathogens other than HIV, such an observation is not surprising. Of note, patient T8 had a recurrence of herpes zoster during the last year of follow-up (see Table 1). In patients T11, T13, and T16, HIV replication was less actively suppressed, indicating poor efficacy of the antivirals or poor patient compliance. No significant reduction in the global levels of CD8 repertoire perturbation developed after, respectively, 31, 10, and 30 months of treatment. The antigenic specificity of the CD8 clonal expansions we detected before and during treatment is unknown. Nevertheless, the fact that their frequency is dramatically reduced only when HIV replication is efficiently suppressed, whereas insignificant changes in TCR repertoire perturbations occurred when HIV antigens remained expressed, strongly suggests that the latter repertoire perturbations are HIV-related. Indeed, in a longitudinal study of HIV patients receiving HAART, a strong inverse correlation between the in vivo frequency of HIV-specific clones and the levels of HIV viremia was evident.9 Furthermore, tetrameric major histocompatibility complex-peptide complexes were recently used to show that during the asymptomatic stage of the infection, chronically expanded CD8+ T cells found in the circulating blood are HIV-specific.11 In a previous work, 14 we detected, with the use of Immunoscope, oligoclonal subsets of CD8 T cells in the skin of HIV patients, and the corresponding T-cell lines were also shown to be HIV-specific. In the 2 patients in whom the analysis was performed during resumption
of HIV replication after a period of efficient viral control, an
expected rebound in repertoire perturbation was observed. However,
clones that were not found at baseline most clearly expanded during
that period. That situation contrasts with the stability of the
repertoire bias observed during chronic infection. In patient T18, we
detected 4 significant clonal expansions at baseline and 1 year
later, but they were all different. In the peripheral blood of
patient T19, several clonal expansions were observed at baseline and at
20 months of follow-up, but only 2 clones remained dominant throughout that period (corresponding to peak sizes 9 and 6 in BV8 and
BV15, respectively; Figure 5). DNA sequencing confirmed that a new
clone progressively overshadowed a previously dominant one in BV2 and
BV7 and that only the baseline BV2 clone could still be detected 1 year
later (Table 4). In patient T19, the BV7 clone found expanded after the
relapse of viral replication is CD45RO In summary, the removal of HIV antigens is associated with a progressive decline in baseline CD8 T-cell expansion. The latter clones and novel CD8 amplifications are detected on HIV reactivation. Taken together, the high prevalence of thymic tissue in adults with HIV-1,33 the observed transient renewal of thymopoiesis in infected thymic implants during HAART,34 the slow peripheral increase in CD4 and CD8 cell counts under treatment,15,35 and the progressive repertoire reorganization we describe during treatment and after relapse show that restoration of the immune system is possible in chronically infected patients, if HIV replication is kept under control. Our results also indicate that the antigenic pressure responsible for repertoire skewing is lifted long before HIV can actually be eradicated from the body.36-38 If HIV-specific cellular surveillance has been significantly alleviated in successfully treated patients, specific boosting of the cellular response may be needed, in association with antiviral therapy, to promote the eradication of residual disease and to reduce the risks for viral relapse on drug removal. Indeed, it was recently suggested that strong virus-specific immune responses could be associated with the rare patient in whom HIV replication remains contained after the discontinuation of HAART.39 It was also proposed that a broad T-cell response would be more efficient at containing HIV spread than a response focused on few HIV epitopes.40 We, therefore, suggest that in future studies, Immunoscope analysis should be coupled to functional tests to further characterize the amplitude and the qualitative nature of the T-cell responses elicited by immunization.
We thank C. Pannetier and P. Kourilsky for providing the Immunoscope software package, V. Calvez for the measurement of some viral loads, and B. Autran, M. Karmochkine, and G. Raguin for providing clinical samples.
Submitted April 17, 2000; accepted November 8, 2000.
Supported by the Fondation pour la Recherche Medicale, Paris (Sidaction), the Agence Nationale de la Recherche contre le Sida (ANRS, Paris), the Bettencourt-Schueller Foundation, the Gonda-Goldschmied Medical Diagnostic Center, the Committee for the Advancement of Research of Bar-Ilan University, and an Arc-en-Ciel French-Israel collaboration grant.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Guy Gorochov, Laboratoire d'Immunologie Cellulaire, CERVI, CNRS UMR 7627, Hopital de la Pitié-Salpétrière, 83 Bvd de l'Hopital, 75013 Paris, France; e-mail: guy.gorochov{at}psl.ap-hop-paris.fr.
1. Freitas AA, Rocha B. Lymphocyte lifespans: homeostasis, selection and competition. Immunol Today. 1993;14:25-39[CrossRef][Medline] [Order article via Infotrieve].
2.
Tanchot C, Rocha B.
Peripheral selection of T cell repertoires: the role of continuous thymus output.
J Exp Med.
1997;186:1099-1106 3. Connors M, Kovacs JA, Krevat S, et al. HIV infection induces changes in CD4+ T-cell phenotype and depletions within the CD4+ T-cell repertoire that are not immediately restored by antiviral or immune-based therapies. Nat Med. 1997;3:533-540[CrossRef][Medline] [Order article via Infotrieve]. 4. Gorochov G, Neumann AU, Kereveur A, et al. Perturbation of CD4+ and CD8+ T-cell repertoires during progression to AIDS and regulation of the CD4+ repertoire during antiviral therapy. Nat Med. 1998;4:215-221[CrossRef][Medline] [Order article via Infotrieve]. 5. Roglic M, Macphee RD, Duncan SR, Sattler FR, Theofilopoulos AN. T cell receptor (TCR) BV gene repertoires and clonal expansions of CD4 cells in patients with HIV infections. Clin Exp Immunol. 1997;107:21-30[CrossRef][Medline] [Order article via Infotrieve]. 6. Bonyhadi ML, Rabin L, Salimi S, et al. HIV induces thymus depletion in vivo. Nature. 1993;363:728-732[CrossRef][Medline] [Order article via Infotrieve]. 7. Li TS, Rubinia R, Katlama C, Calvez V, Ait Mohand H, Autran B. Long-lasting recovery in CD4 T-cell function and viral-load reduction after highly active antiretroviral therapy in advanced HIV-1 disease. Lancet. 1998;351:1682-1686[CrossRef][Medline] [Order article via Infotrieve]. 8. Martinon F, Michelet C, Peguillet I, et al. Persistent alterations in T-cell repertoire, cytokine and chemokine receptor gene expression after 1 year of highly active antiretroviral therapy. AIDS. 1999;13:185-194[CrossRef][Medline] [Order article via Infotrieve].
9.
Ogg GS, Jin X, Bonhoeffer S, et al.
Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA.
Science.
1998;279:2103-2106
10.
Gray CM, Lawrence J, Schapiro JM, et al.
Frequency of class I HLA-restricted anti-HIV CD8+ T cells in individuals receiving highly active antiretroviral therapy (HAART).
J Immunol.
1999;162:1780-1788
11.
Wilson JDK, Ogg GS, Allen RL, et al.
Oligoclonal expansions of CD8(+) T cells in chronic HIV infection are antigen specific.
J Exp Med.
1998;188:785-790 12. Cheynier R, Henrichwark S, Hadida F, et al. HIV and T cell expansion in splenic white pulps is accompanied by infiltration of HIV-specific cytotoxic T lymphocytes. Cell. 1994;78:373-387[CrossRef][Medline] [Order article via Infotrieve].
13.
Musey L, Hu Y, Eckert L, Christensen M, Karchmer T, McElrath MJ.
HIV-1 induces cytotoxic T lymphocytes in the cervix of infected women.
J Exp Med.
1997;185:293-303 14. Bachelez H, Hadida F, Parizot C, et al. Oligoclonal expansion of HIV-specific cytotoxic CD8 T lymphocytes in the skin of HIV-1-infected patients with cutaneous pseudolymphoma. J Clin Invest. 1998;101:2506-2516[Medline] [Order article via Infotrieve]. 15. Pakker NG, Notermans DW, De Boer RJ, et al. Biphasic kinetics of peripheral blood T cells after triple combination therapy in HIV-1 infection: a composite of redistribution and proliferation. Nat Med. 1998;4:208-214[CrossRef][Medline] [Order article via Infotrieve].
16.
Soudeyns H, Campi G, Rizzardi GP, et al.
Initiation of antiretroviral therapy during primary HIV-1 infection induces rapid stabilization of the T-cell receptor beta chain repertoire and reduces the level of T-cell oligoclonality.
Blood.
2000;95:1743-1751 17. Centers for Disease Control and Prevention. Revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. MMWR Morb Mortal Wkly Rep. 1993;41:1-19. 18. Wei S, Charmley P, Robinson MA, Concannon P. The extent of the human germline T-cell receptor V beta gene segment repertoire. Immunogenetics. 1994;10:27-36. 19. Posnett DN, Romagné F, Necker A, Kotzin BL, Sekaly RP. First human TCR monoclonal antibody workshop. Immunologist. 1996;4:5-8. 20. Diu A, Romagne F, Genevee C, et al. Fine specificity of monoclonal antibodies directed at human T cell receptor variable regions: comparison with oligonucleotide-driven amplification for evaluation of V beta expression. Eur J Immunol. 1993;23:1422-1429[Medline] [Order article via Infotrieve].
21.
Romagne F, Besnardeau F, Malissen B.
A versatile method to produce antibodies to human T cell receptor V
22.
Romagne F, Kanagawa O, David-Ameline J, Peyrat MA, Bonneville M, Necker A.
TCRBV23 specificity of two monoclonal antibodies revealed by a panel of human V 23. Romagne F. Contributions à l'analyse du repertoire T chez l'homme par la constitution d'une collection d'anticorps monoclonaux anti-segments variables [thesis].: Université de la Mediterranée Aix-Marseille II; 1996.
24.
Gorochov G, Debré P, Leblond V, Sadat-Sowti B, Sigaux F, Autran B.
Oligo-clonal expansion of CD8+CD57+ T cells with restricted TCR
25.
Pannetier C, Cochet M, Darche S, Casrouge A, Zöller M, Kourilsky P.
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor 26. Pannetier C, Even J, Kourilsky P. T cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;6:176-180. 27. Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C. Sequences of proteins of immunological interest. Rockville, MD: US Department of Health and Human Services, Public Health Service, National Institutes of Health; 1991. 28. Gorochov G, Neumann AU, Kereveur A, et al. In: Girard M,Dodet B, eds. Evolution of TCR Repertoires of CD4 and CD8 T Cells in HIV Infected Patients: 11ème Colloque des Cents Gardes, Marnes la Coquette, Paris, France. Paris: Elsevier; 1998:325. 29. Fitzgerald JE, Ricalton NS, Meyer AC, et al. Analysis of clonal CD8+ T cell expansions in normal individuals and patients with rheumatoid arthritis. J Immunol. 1995;154:3538-3547[Abstract]. 30. Shen DF, Doukhan L, Kalams S, Delwart E. High-resolution analysis of T-cell receptor beta-chain repertoires using DNA heteroduplex tracking: generally stable, clonal CD8+ expansions in all healthy young adults. J Immunol Methods. 1998;15:113-121.
31.
Hamann D, Baars PA, Rep MHG, et al.
Phenotypic and functional separation of memory and effector human CD8+ T cells.
J Exp Med.
1997;186:1407-1418
32.
Kundig TM, Bachmann MF, Oehen S, et al.
On the role of antigen in maintaining cytotoxic T-cell memory.
Proc Natl Acad Sci U S A.
1996;93:9716-9723 33. McCune JM, Loftus R, Schmidt DK, et al. High prevalence of thymic tissue in adults with HIV-1 infection. J Clin Invest. 1998;101:2301-2308[Medline] [Order article via Infotrieve]. 34. Withers-Ward ES, Amado RG, Koka PS, et al. Transient renewal of thymopoiesis in HIV-infected human thymic implants following antiviral therapy. Nat Med. 1997;3:1102-1109[CrossRef][Medline] [Order article via Infotrieve].
35.
Autran B, Carcelain G, Li TS, et al.
Positive effects of combined antiretroviral therapy on CD4+ T cell homeostasis and function in advanced HIV disease.
Science.
1997;277:112-116 36. Chun TW, Carruth L, Finzi D, et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature. 1997;387:183-188[CrossRef][Medline] [Order article via Infotrieve]. 37. Perelson AS, Essunger P, Cao Y, et al. Decay characteristics of HIV-1-infected compartments during combination therapy. Nature. 1997;87:188-191.
38.
Wong JK, Hezareh M, Gunthard HF, et al.
Recovery of replication-competent HIV despite prolonged suppression of plasma viremia.
Science.
1997;278:1291-1295 39. Ortiz GM, Nixon DF, Trkola A, et al. HIV-1-specific immune responses in subjects who temporarily contain virus replication after discontinuation of highly active antiretroviral therapy. J Clin Invest. 1998;104:R13-R18.
40.
Pantaleo G, Demarest JF, Schacker T, et al.
The qualitative nature of the primary immune response to HIV infection is a prognosticator of disease progression independent of the initial level of plasma viremia.
Proc Natl Acad Sci U S A.
1997;94:254-258
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  H. Yang, T. Dong, E. Turnbull, S. Ranasinghe, B. Ondondo, N. Goonetilleke, N. Winstone, K. di Gleria, P. Bowness, C. Conlon, et al. Broad TCR Usage in Functional HIV-1-Specific CD8+ T Cell Expansions Driven by Vaccination during Highly Active Antiretroviral Therapy J. Immunol., July 1, 2007; 179(1): 597 - 606. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rizzo, G. Brancaccio, D. De Vito, and G. Rizzo Efficacy of autovaccination therapy on post-coronary artery bypass grafting methicillin-resistant Staphylococcus aureus mediastinitis Interactive CardioVascular and Thoracic Surgery, April 1, 2007; 6(2): 228 - 229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Meyer-Olson, K. W. Brady, M. T. Bartman, K. M. O'Sullivan, B. C. Simons, J. A. Conrad, C. B. Duncan, S. Lorey, A. Siddique, R. Draenert, et al. Fluctuations of functionally distinct CD8+ T-cell clonotypes demonstrate flexibility of the HIV-specific TCR repertoire Blood, March 15, 2006; 107(6): 2373 - 2383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Miyara, Z. Amoura, C. Parizot, C. Badoual, K. Dorgham, S. Trad, M. Kambouchner, D. Valeyre, C. Chapelon-Abric, P. Debre, et al. The immune paradox of sarcoidosis and regulatory T cells J. Exp. Med., February 21, 2006; 203(2): 359 - 370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Posnett, M. E. Engelhorn, and A. N. Houghton Antiviral T cell responses: phalanx or multipronged attack? J. Exp. Med., June 20, 2005; 201(12): 1881 - 1884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E Hodges, M T Krishna, C Pickard, and J L Smith Diagnostic role of tests for T cell receptor (TCR) genes J. Clin. Pathol., January 1, 2003; 56(1): 1 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Benveniste, P. Cherin, T. Maisonobe, R. Merat, O. Chosidow, L. Mouthon, L. Guillevin, A. Flahault, M.-C. Burland, D. Klatzmann, et al. Severe Perturbations of the Blood T Cell Repertoire in Polymyositis, But Not Dermatomyositis Patients J. Immunol., September 15, 2001; 167(6): 3521 - 3529. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
70°C. Plasma HIV-1 RNA levels
were measured by quantitative reverse transcription-polymerase chain
reaction (RT-PCR) (Amplicor HIV Monitor Test; Roche Molecular Systems,
Branchburg, NJ). The detection threshold was 200 copies/mL.
D) between an initial time point (t0) and
the subsequent time point available (t),
= 10%) of 2 times the standard deviation above the
normal distribution was defined, and Immunoscope peaks (i) in every BV
family profile (k) in each sample (j) that were above that threshold
(D
for example, BV7 for patient
T19/M20, BV2 for patient T13/M6/M10, and BV5 for patient T20/M6 (Table
chains characterized
are pairing with one single TCR-