|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Department of Medicine/Division of
Hematologic Oncology and the Department of Pathology, Memorial
Sloan-Kettering Cancer Center, New York, NY.
Patient-tumor-specific oligonucleotides were generated for the
detection of minimal residual disease (MRD) in a highly specific and
sensitive clonotypic polymerase chain reaction (cPCR). The clone-specific region of highest diversity, CDR-III, was PCR amplified and sequenced. Nested CDR-III clonotypic primers were used in a
semi-nested cPCR with a sensitivity of at least 1 in 105
cells. Patients with protocol-eligible Rai intermediate or high-risk chronic lymphocytic leukemia (CLL) received induction with fludarabine 25 mg/m2 per day for 5 days every 4 weeks for 6 cycles,
followed by consolidative high-dose cyclophosphamide (1.5, 2.25, or
3g/m2). cPCR was performed on peripheral blood and bone
marrow mononuclear cells. All 5 patients achieving a clinical partial
remission (PR) studied by cPCR were positive. Five patients
achieved nodular PR (nPR) (residual nodules or suspicious
lymphocytic infiltrates in a bone marrow biopsy as the sole suggestion
of residual disease). Five of 5 patients with nPR were cPCR positive.
In contrast, flow cytometry for CD5-CD19 dual staining and Cancer patients with minimal residual disease (MRD)
are in clinical complete remission but still have occult disease whose regrowth can result in relapse. During the occult phase of the illness,
detection may be possible by molecular testing, which is far more
sensitive than physical examination, radiologic study, or conventional
histologic examination. Detecting MRD affords an opportunity to
identify patients who will have relapses despite their apparent
cancer-free state. These patients can be offered further potentially
curative therapy, while those who are truly cured can be spared the
toxicity associated with additional treatment.
Tumor-characteristic chromosomal breakpoints can be used as highly
sensitive and specific markers of MRD, though these approaches have
limited applicability for lymphoid neoplasms. Traditional Southern blot
analysis used in most diagnostic laboratories detects a malignant
population only when it exceeds 1% to 5% of the background nonmalignant cells.1 Although the polymerase chain
reaction (PCR) is at least 1000-fold more sensitive, not all lymphoid
tumors have recurrent amplifiable translocations. Even for tumors with well-characterized recurrent translocations such as follicular lymphoma, only 70% of t(14;18) translocations identified by
cytogenetics can be detected by PCR using oligonucleotides spanning the
translocation breakpoint cluster regions.2-4 In the
remaining cases the translocation breakpoints lie outside the
amplifiable regions. Moreover, in some tumors, such as diffuse large
cell lymphoma in which the t(14;18) translocation is present in only
25% of patients, restricting analysis to amplifiable cases introduces
potential biologic bias. A better assay would be directed at a tumor
marker universally present in the lymphomas.
The B and T cell malignancies are unusual cancers in that the clonal
population can be identified by the rearrangement of the immunoglobulin
genes (reviewed in Sklar and Longtime5) or T-cell receptor
unique to that clone. In pre-B cells the immunoglobulin heavy chain
(IgH) locus undergoes sequential rearrangement of diversity (D) and
joining (J) genes followed by rearrangement of the variable (V) and D
genes, which results in an intact IgH variable segment. This is a
direct result of the recombination event occurring in the pre-B cell
that brings together distant parts of the genome, markedly increasing
the diversity of the antigen recognition regions. When a malignant cell
expands, all the progeny carry and express the same immunoglobulin or T
cell receptor as the parent cell, with minor, if any, mutations. (An exception occurs in acute lymphoblastic leukemia, in which further V-D
or D-J recombination may occur.)6-10 Because the same
clone can be demonstrated at both diagnosis and relapse of recurrent low- and intermediate-grade lymphoma,2,11-13 the malignant
clone persists after treatment during the phase of occult disease.
PCR strategies for B and T cell neoplasms depend on this genomic
recombination event to bring together the target sequences within
sufficient proximity, allowing successful amplification of the region
defined by the primer pair. For B cells this involves the amplification
of the V-D-J rearrangement using consensus V region primers and a
downstream primer in the JH region.4
Amplification and isolation of the clonal V-D-J rearrangement allows
for sequencing of the clone-specific region composed of nontemplated N
sequences and the DH segment (N-DH-N), referred
to as complementarity determining region-III (CDR-III).5
This region is ideally suited for strategies that detect a specific
clone of B cells because the nontemplated N sequences inserted by
terminal deoxytidyl-transferase are random and increase the diversity
of the area above that of the recombination event alone. We have
designed a clonotypic PCR using nested 5' patient specific primers and
consensus JH primers to uniquely amplify the malignant
clone for the detection of MRD.
In the current analysis, clonotypic PCR of peripheral blood (PB) and
bone marrow (BM) mononuclear cells was used to assess patients with
intermediate or high-risk chronic lymphocytic leukemia (CLL) treated on
an ongoing clinical trial to determine whether molecular evidence of
disease can be used as a surrogate marker. In 1988 the National Cancer
Institute-sponsored Working Group (NCI-WG) on CLL specified that
patients in complete remission (CR) had to have less than 30%
lymphocytes on bone marrow aspiration, and it recommended that the
clinical significance of lymphoid nodules in CR patients be assessed
prospectively.14 Subsequently, it was demonstrated that
patients who were in CR according to aspirate criteria and physical
examination but who were found on bone marrow biopsy to have either
interstitial involvement or lymphoid nodules had inferior
progression-free survival compared to those in CR.15 In
1996 a revision of the NCI-WG guidelines defined this subgroup as
having nodular partial remission (nPR), stating "It is,
unfortunately, difficult with current techniques to determine the
clonality of these nodules."16 In our trial, a number of
patients achieved nPR. Clonotypic PCR demonstrated that these patients
have MRD.
Patient characteristics
Clinical specimens
Mononuclear cells were isolated by Ficoll gradient and stored at
Polymerase chain reaction amplification of rearranged IgH genes The experimental design is illustrated in Figure 1. The rearranged VH gene from B cell tumors was amplified, as previously described, using upstream primers based on a set of 6 family-specific VH leader primers18 in conjunction with a consensus JH primer.4 The latter was modified by the 5' addition of a T7 sequence, facilitating sequencing and destabilizing a 5'-end loop that could interfere with the primer's performance. PCR reactions were carried out in 50-µL volumes containing 100 ng template DNA, 0.5 µM each of the 5' and 3' primers, 200 µM each dNTP, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, and 0.625 U Amplitaq (Perkin-Elmer Cetus, Norwalk, CT). The samples were overlain with 100 µL mineral oil and subjected to 37 cycles of denaturation (15 seconds at 95°C; first cycle, 3 minutes), annealing (15 seconds at 55°C; 30 seconds, first cycle), and elongation (15 seconds at 72°C; 30 seconds, first cycle) using the Perkin-Elmer thermal cycler. After the last cycle, a final elongation step for 7 minutes at 72°C was performed. PCR fragments (10 µL) were separated on 1.2% agarose gels in 90 mM Tris-borate-2 mM EDTA (TBE buffer) and visualized with ethidium bromide staining.
In the event that this approach failed to reveal a monoclonal band, an alternative set of primers based on Fr2a and Fr3a consensus sequences were used with a downstream semi-nested pair of JH primers (LJH and VLJH), as previously described, with minor modifications.19-21 PCR conditions were identical to those above with the exception of the cycling conditions, as follows: an initial denaturation step at 95°C for 7 minutes, followed by 3 cycles of denaturation (45 seconds at 93°C), annealing (45 seconds at 50°C), and elongation (110 seconds at 72°C). After the last cycle, a final elongation step for 7 minutes at 72°C was performed. The second round of amplification with the semi-nested 3' was carried out under the same conditions. All experiments were run with a negative and a positive control. The former consisted of all the PCR reagents in the absence of a DNA template. The latter used alternative primer pairs for the bcl-2 untranslated region (bcl-2 UT 5' TCAGCCTTGAAACATTGATG and bcl-2 UT 3' CAAGGTCAAAGGGACAACAG), which amplified under the same conditions as the immunoglobulin VH-family specific leader primers, resulting in a 450-bp fragment. The positive control verified the integrity of the DNA template. To prevent contamination, simultaneous amplification of a positive control template was not performed. PCR reactions were carried out in a dedicated hood into which amplified PCR products were never introduced. Clone-specific primer design Nested primer pairs unique to the malignant clone for the detection of MRD were created based on the sequence of the CDR-III region of the malignant clone (Figure 1). The initial PCR product reflecting the monoclonal immunoglobulin rearrangement was gel purified and directly sequenced using a Taq DNA polymerase-based sequencing strategy (Dye Terminator Cycle Sequencing Reaction Kit; Perkin Elmer, Foster City, CA) on an automated sequencer (ABI Prism, Foster City, CA). Bidirectional sequencing was performed for verification. The compatibility and expected performance characteristics of these primers with the appropriate downstream T7JH or VLJH primer were tested using a software package, Oligo 5.0 (LifeBiotechnologies, Plymouth, MN). Thermodynamic properties, including annealing temperatures, were assessed before implementation, increasing the likelihood that PCR using these primers would be successful.Clonotypic polymerase chain reaction Conditions for clonotypic PCR were identical to those used for isolating the initial V-D-J sequence with the exception of the annealing temperatures, which were modified for each primer pair based on the PCR predicted by Oligo 5.0. Primer pairs were first tested on 100 ng of the diagnostic sample from which the initial V-D-J was amplified. Ten-fold serial dilutions of a 100-ng template were made to estimate disease burden. In the first round of amplification, the outer 5' CDR-III clone-specific primer was used. In the second round of amplification, 1 µL of a 10 3 dilution of the
first-round PCR product served as a template with the nested CDR-III
clone-specific primer. PCR products were run on a 4% Metaphor gel (FMC
BioProducts, Rockland, ME) with a 10-bp ladder (Gibco BRL,
Gaithersburg, MD). The predicted sizes of both products served to
verify the specificity of the reaction products. Negative controls
included a no DNA template and a polyclonal template reaction. The
latter also served to test the specificity of the primers. Positive
control reactions used the bcl-2 primers described above.
Flow cytometry Surface membrane antigens were detected by standard direct immunofluorescence using the fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated monoclonal antibodies (mAbs) CD5-FITC and CD19-PE. Antibodies were purchased from Becton Dickinson (Mountain View, CA) and Coulter-Immunotech Immunology (Miami, FL). Dual-color staining was performed by incubating cells simultaneously with optimal concentrations of the 2 monoclonal antibodies of interest. Negative controls using irrelevant monoclonal immunoglobulins of the same isotype were analyzed concurrently. Surface immunoglobulin-bearing lymphocytes (sIg) were assayed using mouse F (ab)2 anti-human CD19-PE/goat F(ab)2 anti-kappa FITC and mouse F (ab)2 anti-human CD19-PE/goat F(ab)2 anti-
FITC (Biosource International, Camarillo, CA). Flow cytometry of the
stained cells was performed on an EPICS Profile (Coulter) equipped with
a 488-nm argon laser. The target lymphocyte population was gated
according to forward and side scatter characteristics of the cells.
Multiparameter Data Acquisition and Display System (Coulter
Electronics) was used to acquire, display, and store output from
the EPICS.
Immunologic detection of MRD was accomplished by dual-color staining of
CD5-CD19 or clonal excess in defined CD19+
populations.22,23 CD5-CD19 positivity in more than 5% of
the cells (representing the nonspecific staining background) was
considered positive for MRD. Clonal excess was defined as a Bone marrow aspirates and peripheral blood were assayed by flow cytometry. Cases reported as negative were negative in both bone marrow and peripheral blood. Cases reported as positive had positive bone marrow aspirates with either positive or negative peripheral blood flow cytometry. No cases were positive in the peripheral blood and negative in the marrow. Immunohistochemistry Five-micrometer sections from paraffin-embedded tissues were stained with hematoxylin and eosin. Immunoperoxidase studies were performed on paraffin sections using a biotin-avidin peroxidase complex method.24 The mAbs used were CD20, CD5, CD3, CD10, and Bcl-2.
Study population and clinical results The results of this recently completed trial have been reported elsewhere.25 Briefly, 35 evaluable patients with intermediate- and advanced-stage CLL were enrolled between April 1992 and August 1996, and 30 were evaluable for response. Five patients were inevaluable and were removed from the study because of protocol violations. Clinical evaluation at the point of maximal response included 3 treatment failures, 13 PRs, 5 nPRs, and 9 CRs. Analysis of the subgroup of previously untreated patients revealed that consolidation with high-dose cyclophosphamide improved the quality of response in 9 patients and generally decreasing tumor burden and converting PR to CR in 5 patients.17Sensitivity of clonotypic polymerase chain reaction Semi-nested PCR could identify at least 1 malignant cell in a background of 105 polyclonal cells (Figure 2A). Serial 10-fold dilutions of 100 ng patient DNA derived from BM (approximately 104 cells) were mixed into 1 µg polyclonal DNA (approximately 105 cells) extracted from normal PB mononuclear cells. The primary clonotypic PCR using the outer 5' patient-specific primer and a JH consensus primer detected 1 cell in 102 polyclonal cells. After a second round of amplification substituting the inner 5' patient-specific primer, one cell in 105 polyclonal cells was detected. This compared favorably to an alternative technique in which the primary-round PCR product was electrophoresed, transferred, and probed with an inner CDR-III primer end labeled with 32P (Figure 2B). This detected one malignant cell of 103 polyclonal cells.
Isolation of clonotypic sequence Using 100 ng DNA from marrow or lymph node obtained at diagnosis, a monoclonal band was identified in all 19 patients evaluated. The VH leader primers were used successfully in 12 patients (63%). In 5 additional patients, the Fr2 or Fr3 primers were successful when used with the 3' nested combination LJH followed by VLJH. In 2 patients, monoclonal bands identified by either set of primers provided sequence that subsequently led to unsuccessful primers (see below). Thus, the combination of the 2 primer sets was able to amplify the CDR-III of the malignant clone and lead to the design of successful clonotypic PCR primers in 89% of the patients.The failure of the VH leader primers to consistently amplify the monoclonal product may be particular to CLL. Bahler et al26 used these primers to determine VH gene usage successfully in 36 of 36 patients with follicular lymphoma. For the 12 cases amplified by VH leader primers, the following breakdown was noted: 6 patients with VH1, 5 patients with VH4, and 1 patient with both VH1 and VH3. This is an unusual distribution for CLL, which typically is predominantly VH3 more than VH1 more than VH4 more than others.27,28 Creation of clone-specific primer Clone-specific primers were selected from within the CDR-III region. Careful attention was given to the thermodynamics, as directed by the software package Oligo 5.0 (LifeBiotechnologies). Primers were chosen that were predicted to have adequate PCR performance. This limited the potential primers that could be created from the region of interest. After sequencing and primer design, the clone-specific primers were tested on the initial diagnostic material to confirm that a band of the appropriate size was obtained.As evaluated by end-point dilution analysis of the pretreatment sample,
the clone-specific primers were able to detect a single cell in 14 of
17 evaluable patients (Table 1)
Illustration of technique A representative clonotypic PCR is illustrated in Figure 3 for a patient who achieved nPR after treatment. At nPR, mature lymphoid cells comprised 18% of the bone marrow aspirate. Before treatment the malignant clone could be detected at a 104 dilution (Figure 3A-B); after
chemotherapy, it could be detected at a 102 dilution
(Figure 3C-D). The relative abundance of the malignant clone was
reduced by a factor of 2 logs in the bone marrow.
Clonotypic polymerase chain reaction The results of clonotypic PCR, correlated with clinical response, are presented in Table 1. To confirm the validity of the clonotypic PCR technique, the first 5 patients who achieved PR were studied. All 5 patients had disease detectable histologically in the core BM biopsy. For these patients, there was no decrement in disease burden after treatment, as judged by end-point dilution analysis.Clonotypic PCR analysis detected disease in all 5 patients who achieved nPR. Of these 5 patients, 3 were evaluable by limiting-dilution analysis at both the pretreatment and the nPR time-point. A decrement in disease burden was seen in 2 of 3 patients. The nPR patients had a variety of bone marrow findings, as
demonstrated in Figure 4 and as
correlated with PCR results in Table 2.
By definition, all patients with nPR had less than 30% mature
lymphocytes on bone marrow aspiration. Noting that biopsy findings were
not included in the definition of response, biopsy specimens ranged
from minute clusters of lymphocytes to dense clusters more readily
identifiable as consistent with CLL. Immunohistochemistry staining
identified disease in only 1 of 4 evaluable patients. This
patient (patient 4) was only weakly CD20+,
CD5
The disease burden, as estimated by end-point dilution analysis, did
not correlate with the findings on biopsy. For example, in patient 7, though there was only a single minute cluster of lymphocytes on biopsy,
PCR of a single cell by end-point dilution was still positive. In
contrast, in patient 4, the marrow had several aggregates of small,
round lymphocytes consistent with CLL and positive immunohistochemistry
staining, yet 100 cells were assayed before a malignant clone could be
detected. Clonotypic PCR results were compared with flow cytometric
assessments of residual disease using dual staining for CD5-CD19 and
Clonotypic PCR yielded variable results in the 7 evaluable patients who had CR. PCR findings were positive for 3 patients and negative for 4. Flow cytometry findings were negative in all but 1 patient whose PCR findings were positive. As judged by end-point dilution, disease burden was reduced in the 2 assessable patients after treatment. Post-response follow-up Four patients have had serial PCR determinations during follow-up after maximal response. In 3 of these 4, increasing disease burdens have been demonstrated, as judged by end-point dilution. None have had clinical relapse.Patient 26 achieved CR. Clonotypic PCR of the BM was positive at a
10 Patient 27 became PCR negative after treatment. Pretreatment BM tested
positive at 10 At CR the undiluted PB and BM DNA of patient 23 remained PCR positive.
This was a 4-log improvement from pre-treatment PCR. Eight months into
follow-up, the BM biopsy specimen had a few clusters of small
lymphocytes, consistent with lymphoma, with only 20% lymphocytes on
aspirate. PCR of the PB demonstrated the malignant clone at a
10
We have used clonotypic PCR to detect MRD in CLL after high-dose, non-myeloablative chemotherapy. Disease was detectable in all patients at nPR and in some patients at CR. A clone-specific technique was chosen because, unlike chronic myelocytic leukemia, acute promyelocytic leukemia, or follicular lymphoma, CLL is not associated with a recurrent chromosomal translocation that could serve as a convenient marker of MRD. CLL is analogous to acute lymphocytic leukemia (ALL), in which molecular probes for clone-specific immunoglobulin rearrangements have been used for the detection of MRD. Several PCR strategies for B cell neoplasms have been devised and applied primarily to the assessment of ALL. In this report we describe a technique of 2 oligonucleotide primers within the CDR-III region that can be used with a consensus JH primer. This enables semi-nested PCR to be performed, increasing both sensitivity and specificity. Although further cycles of amplification increase sensitivity, the requirement that the first round product be made amplifiable by the nested second primer verifies specificity. High-resolution electrophoresis with a 10-bp DNA ladder allowed for relatively precise size determination of the products, again demonstrating specificity. Additionally, the 2-step PCR technique allows a sample to be readily assayed in 2 days from the time the sample arrives in the laboratory. It is unlikely that conventional primers alone are as sensitive for MRD. In 2 patients who had nPR and for whom material was available, the VH leader primers or the framework primers demonstrated a smear with a dominant band or with multiple bands (data not shown). In the cases evaluated by VH leader primers, we saw a skewing of the repertoire, with 50% VH1 and 42% VH4. This is surprising for 2 reasons. First, because VH3 is the largest group of VH genes, it is the one most often used by randomly rearranged genes.5 Moreover, in recent larger series of randomly collected CLL cases,27-29 VH3 is usually the predominant subtype, with more VH3 than VH1, more VH1 than VH4, and more VH4 than others. Most likely this discrepancy reflects our small sample size. VH typing restriction is believed to reflect an antigen selection process in the development of CLL. Although earlier authors have not reported somatic mutations in CLL,30,31 others more recently have demonstrated equal expression of mutated and unmutated VH genes, with inferior clinical outcome in the latter subgroup.27,32 Additional follow-up will be necessary to confirm clinical significance in our study. This clonotypic PCR technique demonstrated MRD in all 5 patients who achieved nPR. Traditionally, response assessment in CLL has relied on bone aspirate differentials, independent of biopsy findings.14 As a consequence, in the absence of other evidence of disease, patients with suspicious BM biopsy specimens were still considered to be in CR. We have demonstrated that patients with the recently defined category of nPR16 can have a dramatic range of findings, from lymphoid clusters to nodules, consistent with involvement by CLL. Moreover, immunohistochemistry fails to demonstrated MRD in most patients. Our PCR results are the first molecular evidence that these lymphoid nodules represent disease. This conclusion is supported by our observation that patients who achieved nPR in this clinical trial had remission lengths essentially identical to those of patients who achieved PR but markedly shorter than those of patients who achieved CR.25 Robertson et al15 report that patients who achieve nPR after treatment with fludarabine plus prednisone have an overall survival rate between those who achieve CR and those who achieve PR. Clonotypic PCR detected MRD in 3 of 6 evaluable patients in CR. These patients will be followed up to determine whether PCR positivity can predict relapse. Using single-round amplification techniques, which are expected to be less sensitive than the methodology used in our study, others have reported molecular CR in patients with CLL. Maloum et al33 demonstrated that 1 of 7 patients became PCR negative after fludarabine treatment alone, whereas 3 of 3 attained molecular remission after autologous transplantation. Esteve et al34 studied 12 patients with low-grade lymphoproliferative disorders treated with fludarabine, 3 of whom had CLL. In this small study, all 3 patients with CLL achieved molecular CR. Analyzed without regard to disease type, patients who were in molecular CR had longer relapse-free survival. Tracking MRD in CLL by clonal excess or dual staining on flow cytometry
is attractive because of its simplicity, sensitivity, and rapid
turnaround. In numerous studies of CLL, investigators have sought to
detect minimal residual disease using flow cytometric techniques.
Despite the sensitivity of this technique, no standards defining what
constitutes a "positive" result have been established. In this
study, we have chosen to define the presence of flow cytometric residual disease as either the ability to detect a Southern blot analysis is an alternative method for monitoring MRD. The technique is at least 100 times less sensitive than PCR for CLL and results depend on the demonstration of rearranged immunoglobulin genes. Robertson et al15 treated CLL patients with fludarabine alone. After evaluating 20% of them by Southern blotting, they detected a residual clonal population in 5 of 7 CR patients and in 6 of 8 nPR patients. Selection bias might have played a role in determining on whom to perform this test. The limiting-dilution technique used here is only semiquantitative. By
this method, disease burden did not decrease in the PR patients but did
decrease with treatment in 2 of 3 nPR analyzable patients. We were
unable to correlate the extent of disease on biopsy and estimated
disease burden by end-point dilution analysis. This disparity may be
explained by sampling error In summary, our results support the hypothesis that nodular PR in CLL represents MRD. Additionally, clonotypic PCR appears more sensitive than flow cytometry for the detection of MRD. Our findings also demonstrate the wide heterogeneity of bone marrow biopsy findings in patients achieving nPR. As the follow-up increases, we will assess the value of clonotypic PCR in predicting clinical outcome. If PCR proves to be a reliable indicator of clinical outcome, it could be used as a surrogate end-point in clinical trials. In addition, it may prove to be useful in predicting which patients are at the greatest risk for relapse, targeting them for additional treatment while sparing those with the least risk from associated morbidity.
Submitted December 28, 1999; accepted November 21, 2000.
Supported in part by the Norman and Rosita Winston Foundation; the Horace W. Goldsmith Foundation; the Mortimer J. Lacher, MD Lymphoma Foundation Fund; the Leukemia Research Foundation of America; and National Institutes of Health grants K12-CA01712-03, K12-CA09512, 1-K08CA73825-01A1, and R01 CA67823-02 USPHS (NCI CA05826-34).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ariela Noy, Dept of Medicine/Division of Hematologic Oncology, Memorial Sloan-Kettering Cancer Center, 1275 York Ave, New York, NY 10021; e-mail: noya{at}mskcc.org.
1.
Cleary ML, Caho J, Warnke R, Sklar J.
Immunoglobulin gene rearrangement as a diagnostic criterion of B-cell lymphoma.
Proc Natl Acad Sci U S A.
1984;81:593-597
2.
Zelenetz AD, Chu G, Galili N, et al.
Enhanced detection of the t(14;18) translocation in malignant lymphoma using pulsed-field gel electrophoresis.
Blood.
1991;78:1552-1560
3.
Ngan B-Y, Nourse J, Cleary M.
Detection of chromosomal translocation t(14;18) within the minor cluster region of bcl-2 by polymerase chain reaction and direct genomic sequencing of the enzymatically amplified DNA in follicular lymphomas.
Blood.
1989;73:1759-1762
4.
Crescenzi M, Seto M, Herzig GP, Weiss PD, Griffith RC, Korsmeyer SJ.
Thermostable DNA polymerase chain amplification of t(14;18) chromosome breakpoints and the detection of minimal residual disease.
Proc Natl Acad Sci U S A.
1988;85:4869-4873 5. Sklar J, Longtime J. The clinical significance of antigen receptor gene rearrangements in lymphoid neoplasia. Cancer. 1992;70(suppl):1710-1718[CrossRef][Medline] [Order article via Infotrieve].
6.
Bird J, Galili N, Link M, Stites D, Sklar J.
Continuing rearrangement but absence of somatic hypermutation in immunoglobulin genes of human B cell precursor leukemia.
J Exp Med.
1988;168:229-245 7. Greenberg SJ, Choi Y, Ballow M, et al. Profile of immunoglobulin heavy chain variable gene repertoires and highly selective detection of malignant clonotypes in acute lymphoblastic leukemia. J Leukoc Biol. 1995;57:856-864[Abstract]. 8. Korsmeyer SJ, Arnold A, Bakhshi A, et al. Immunoglobulin gene rearrangement and cell surface antigen expression in acute lymphoblastic leukemia of T cell and B cell precursor origins. J Clin Invest. 1983;71:301-313.
9.
Choi Y, Greenberg SJ, Du TL, et al.
Clonal evolution in B-lineage acute lymphoblastic leukemia by contemporaneous VH-VH gene replacements and VH-DJH gene rearrangements.
Blood.
1996;87:2506-2512 10. Beishuizen A, Hahlen K, Hagemeijer A, et al. Multiple rearranged immunoglobulin genes in childhood acute lymphoblastic leukemia of T cell and B cell precursor origin. Leukemia. 1991;5:657-667[Medline] [Order article via Infotrieve].
11.
Zelenetz AD, Chen TT, Levy R.
Histologic transformation of follicular lymphoma to diffuse lymphoma represents tumor progression by a single malignant B cell.
J Exp Med.
1991;173:197-207
12.
Siegelman MH, Cleary ML, Warnke R, Sklar J, et al.
Frequent biclonality and Ig gene alterations among B cell lymphomas that show multiple histologic forms.
J Exp Med.
1985;161:850-863
13.
Zelenetz AD, Campbell MJ, Bahler DW, et al.
Follicular lymphoma: a model of lymphoid tumor progression in man.
Ann Oncol.
1991;2:115-122 14. Cheson BD, Bennett JM, Rai KR, et al. Guidelines for clinical protocols for chronic lymphocytic leukemia: report of the NCI-sponsored Working Group. Blood. 1988;29:152-163.
15.
Robertson LE, Huh YO, Butler JJ, et al.
Response assessment in chronic lymphocytic leukemia after fludarabine plus prednisone: clinical, pathologic, immunophenotypic, and molecular analysis.
Blood.
1992;80:29-36
16.
Cheson BD, Bennett JM, Grever M, et al.
National Cancer Institute-sponsored working group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment.
Blood.
1996;87:4990-4997 17. Weiss M, et al. Consolidation therapy with high-dose cyclophosphamide (HDC) reduces minimal residual disease in patients with chronic lymphocytic leukemia (CLL) treated with fludarabine as induction therapy [abstract]. Blood. 1996;88(suppl 1):481. 18. Campbell M, Zelenetz AD, Levy S, Levy R. Use of family specific leader region primers for PCR amplification of the human heavy chain variable region gene repertoire. Mol Immunol. 1992;29:193-203[CrossRef][Medline] [Order article via Infotrieve].
19.
Trainor KJ, Brisco MJ, Story CJ, Morley AA.
Monoclonality in B-lymphoproliferative disorders detected at the DNA level.
Blood.
1990;75:2220-2222
20.
Ramasamy I, Brisco M, Morley A.
Improved PCR method for detecting monoclonal immunoglobulin heavy chain rearrangement in B cell neoplasms.
J Clin Pathol.
1992;45:770-775 21. Diss TC, Peng H, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J Pathol. 1993;169:291-295[CrossRef][Medline] [Order article via Infotrieve].
22.
Letwin B, Wallace PK, Muirhead KA, Hensler GL, Kashatus WH, Horan PK.
An improved clonal excess assay using flow cytometry and B-cell gating.
Blood.
1990;75:1178-1185 23. Lenormand B, Bizet M, Fruchart C, et al. Residual disease in B-cell chronic lymphocytic leukemia patients and prognostic value. Leukemia. 1994;8:1019-1026[Medline] [Order article via Infotrieve]. 24. Erlandson RA. Ancillary procedures for evaluating human tumors. In: Erlandson RA, ed. Diagnostic Transmission, Electron Microscopy of Tumors Wth Clinicopathological, Immunohistochemical and Cytogenetic Correlations. New York: Raven Press; 1994:28. 25. Weiss MA, Glenn M, Maslak P, et al. Consolidation therapy with high-dose cyclophosphamide (HDC) improves the quality of response in patients with chronic lymphocytic leukemia treated with fludarabine as induction therapy. Leukemia. 2000;14:1577-1582[CrossRef][Medline] [Order article via Infotrieve].
26.
Bahler DW, et al.
Ig VH gene expression among human follicular lymphomas.
Blood.
1991;78:1561-1568
27.
Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK.
Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia [see comments].
Blood.
1999;94:1848-1854 28. Fais F, Ghiotto F, Hashimoto S, et al. Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J Clin Invest. 1998;102:1515-1525[Medline] [Order article via Infotrieve]. 29. Schroeder HW Jr, Dighiero G. The pathogenesis of chronic lymphocytic leukemia: analysis of the antibody repertoire [see comments]. Immunol Today. 1994;15:288-294[CrossRef][Medline] [Order article via Infotrieve].
30.
Matolcsy A, Casali P, Nador RG, Liu YF, Knowles DM.
Molecular characterization of IgA- and/or IgG-switched chronic lymphocytic leukemia B cells.
Blood.
1997;89:1732-1739 31. Maloum K, Pritsch O, Magnac C, et al. VH gene expression in CD5 positive and CD5 negative B cell chronic lymphoid malignancies. Leuk Lymphoma. 1997;24:437-448[Medline] [Order article via Infotrieve].
32.
Rajendra N, Damle T, Wasil F, et al.
Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia.
Blood.
1999;94:1840-1847 33. Maloum K, Magnac C, Sutton L, et al. Minimal residual disease assessment in chronic lymphocytic leukemia [abstract]. Blood. 1996;88(suppl 1):77. 34. Esteve J, Villamor N, Colomer D, et al. Fludarabine-induced molecular remissions in patients with previously treated chronic lymphoproliferative disorders [abstract]. Blood. 1996;88(suppl 1):78. 35. Cabezudo E, Matutes E, Ramrattan M, Morilla R, Catorsky D. Analysis of residual disease in chronic lymphocytic leukemia by flow cytometry. Leukemia. 1997;11:1909-1914[CrossRef][Medline] [Order article via Infotrieve]. 36. Noy A, Keenan JR, Zelenetz AD. A novel approach to quantitative PCR for minimal residual disease in lymphoid neoplasms [abstract]. Blood. 1997;90(suppl 1):522.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  N. Lamanna, J. G. Jurcic, A. Noy, P. Maslak, A. N. Gencarelli, K. S. Panageas, M. L. Heaney, R. J. Brentjens, D. W. Golde, D. A. Scheinberg, et al. Sequential Therapy With Fludarabine, High-Dose Cyclophosphamide, and Rituximab in Previously Untreated Patients With Chronic Lymphocytic Leukemia Produces High-Quality Responses: Molecular Remissions Predict for Durable Complete Responses J. Clin. Oncol., February 1, 2009; 27(4): 491 - 497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hallek, B. D. Cheson, D. Catovsky, F. Caligaris-Cappio, G. Dighiero, H. Dohner, P. Hillmen, M. J. Keating, E. Montserrat, K. R. Rai, et al. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines Blood, June 15, 2008; 111(12): 5446 - 5456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Arons, I. Margulies, L. Sorbara, M. Raffeld, M. Stetler-Stevenson, I. Pastan, and R. J. Kreitman Minimal residual disease in hairy cell leukemia patients assessed by clone-specific polymerase chain reaction. Clin. Cancer Res., May 1, 2006; 12(9): 2804 - 2811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Noy, J. Yahalom, L. Zaretsky, I. Brett, and A. D. Zelenetz Gastric Mucosa-Associated Lymphoid Tissue Lymphoma Detected by Clonotypic Polymerase Chain Reaction Despite Continuous Pathologic Remission Induced by Involved-Field Radiotherapy J. Clin. Oncol., June 1, 2005; 23(16): 3768 - 3772. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
-
140°C in liquid nitrogen. DNA extraction was performed with proteinase K and was purified using a QIAamp spin column (QIAGEN, Chatsworth, CA). In 2 instances, follow-up samples of fresh bone marrow
aspirates were unavailable, and DNA was extracted from bone marrow
aspirates or paraffin section using octane for paraffin removal. The
minute amount of material obtained precluded accurate determination of
its concentration without losing the DNA. Therefore, results from these
reactions were strictly qualitative.
that is,
the PCR remained positive after a 10
