SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Guzman, M. L. Articles by Jordan, C. T. Search for Related Content PubMed PubMed Citation Articles by Guzman, M. L. Articles by Jordan, C. T. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 1 April 2001, Vol. 97, No. 7, pp. 2177-2179 BRIEF REPORT Expression of tumor-suppressor genes interferon regulatory factor 1 and death-associated protein kinase in primitive acute myelogenous leukemia cells Monica L. Guzman, Donna Upchurch, Barry Grimes, Dianna S. Howard, David A. Rizzieri, Selina M. Luger, Gordon L. Phillips, and Craig T. Jordan From the Blood and Marrow Transplant Program, Markey Cancer Center, Division of Hematology/Oncology, University of Kentucky Medical Center, Lexington Division of Oncology and Bone Marrow Transplantation, Duke University Medical Center, Durham, NC; and the Department of Hematology/Oncology, University of Pennsylvania, Philadelphia, PA.     Abstract Top Abstract Introduction Study design Results and discussion References Previous studies indicate that human acute myelogenous leukemia (AML) arises from a rare population of leukemic stem cells. Cells of this nature can initiate and maintain leukemic cell growth in both long-term cultures and nonobese diabetic/severe combined immune-deficient mice. To characterize the biology of primitive AML cells, gene expression screens were performed with 7 primary AML and 3 normal specimens. For each sample, stem cell populations (CD34+/CD38) were isolated and used to synthesize radiolabeled complementary DNA (cDNA). AML vs normal probes were then hybridized to cDNA arrays containing genes related to cancer and apoptosis. Of approximately 1400 genes analyzed, 2 tumor-suppressor genes were identified that were overexpressed in all 7 of the AML CD34+/CD38 cell populations: death-associated protein kinase and interferon regulatory factor 1. Expression of each gene was confirmed by reverse-transcription polymerase chain reaction and immunoblot analysis. It is proposed that tumor-suppressor proteins play a role in the biology of primitive AML cells. (Blood. 2001;97:2177-2179) © 2001 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References The concept of a hierarchical organization to leukemic populations has been considered for many years,1,2 but only recently has the phenotypic description of leukemic stem cells allowed more direct analyses. Recent studies have shown that CD34+/CD38 or CD34+/HLA-DR acute myelogenous leukemia (AML) cells are unique in their ability to initiate leukemic cell growth in long-term cultures or nonobese diabetic/severe combined immune-deficient mice.3-5 In addition, our own studies have recently shown that primitive AML cells can be distinguished from normal stem cells by virtue of strong CD123 expression.6 Thus, it is now possible to isolate pure populations of primitive AML cells for experimental analysis. Given the potentially critical role of leukemic stem cells in the pathogenesis of leukemic disease, we sought to identify genes preferentially expressed in primitive AML cells. Moreover, we were specifically interested in genes whose expression is conserved among different AML subtypes. Our rationale was that conserved genes may represent those most important to the underlying cause of stem cell transformation. Using this approach, we have identified 2 genes that are expressed in primitive AML cells of differing subtypes. Both genes, death-associated protein kinase (DAPK) and interferon regulatory factor 1 (IRF-1), are strongly associated with tumor- suppressor activity, and their expression is therefore not expected in malignant cells.7,8 We suggest that the presence of these factors may indicate previously uncharacterized features of AML biology.     Study design Top Abstract Introduction Study design Results and discussion References Cells and processing AML blood and normal marrow cells were isolated and processed as previously described.6 Flow cytometry To isolate purified cells, primary AML or normal leukocytes were labeled with CD34- FITC and CD38- phycoerythrin (PE) (Becton Dickinson, San Jose, CA). Samples were sorted by means of a FACSVantage (Becton Dickinson, San Jose, CA) flow cytometer (typical purity, at least 95%). AML cells were also analyzed with CD123-PE (Pharmingen, San Diego, CA). Complementary DNA arrays With the use of CD34+/CD38 cells (0.5 to 1.0 × 106 cells), total RNA was isolated by means of the NucleoSpin RNA II kit (Clontech, Palo Alto, CA), and probes were generated by means of the Atlas cDNA Expression Array kit (Clontech, Palo Alto, CA) as per manufacturer's instructions. Samples were hybridized (3 million to 5 million cpm) to Clontech Human Cancer 1.2 and Hematology arrays. Data from each array was analyzed by phospho-imager and quantitated by means of the Atlas Image 1.0 software. On the basis of the consistency of CD34 expression in both cell types, expression of all genes in the array is expressed in units relative to CD34 (intensity arbitrarily set = 1). Furthermore, serial probing of complementary DNA (cDNA) arrays with probes from the same specimen showed a high degree of consistency. Reverse-transcription polymerase chain reaction RNA samples were prepared with the use of the Miltenyi µMACS (Mitenyi, Auburn, CA) messenger RNA isolation kit according to the manufacturer's instructions and reverse transcribed with Superscript II (Gibco, BRL, Rockville, MD) via standard procedure. Polymerase chain reactions (PCRs) were performed by means of a PerkinElmer 9700 thermalcycler and the following primers: 2-microglobulin forward, CTCGCGCTACTCTCTCTTTC; reverse, CATGTCTCGATCCCACTTAAC. IRF-1 forward, CGGGGCTCATCTGGATTAATAAAGAGG; reverse, GGATGTGCCAGTCGGGGAGAGTG. DAPK forward, AAGCCATCATCCATGCCATC; reverse, TCTCTCCTTCTCGGTTCTTGA. For each reaction, the cDNA equivalent of 1000 cells was amplified for 30 cycles (94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds). Immunoblots Cell samples were prepared and analyzed as previously described.6 The DAPK-55 antibody (Sigma, St Louis, MO) was used at a 1:500 dilution. IRF-1 was detected with the C-20 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000. All primary antibodies were visualized by means of alkaline phosphatase-conjugated secondary antibodies and the ECF reagent (Pharmacia, Sweden) according to the manufacturer's instructions.     Results and discussion Top Abstract Introduction Study design Results and discussion References The AML specimens analyzed were of French-American-British (FAB) subtypes M1 (n = 2), M2 (n = 1), M4 (n = 3), and M2/M6 (n = 1), which exhibited either normal or aberrant cytogenetics (footnote, Table 1). It should be noted that in order to obtain sufficient CD34+/CD38 cells for analysis, it was necessary to use AML specimens with a high white blood count (Table 1). A key issue in generating probes was to distinguish between leukemic and normal primitive cells that might be present together in a primary specimen. Each sample was derived from peripheral blood; therefore, the frequency of normal stem cells should be extremely low. However, a clearer definition of leukemic vs normal primitive cells can be obtained by analyzing expression of the CD123 antigen. Recently, we have shown that CD123 is preferentially up-regulated on leukemic, but not normal, CD34+/CD38 cells.6 Each of the CD34+/CD38 specimens used for this study was highly enriched for CD123+ cells (95% to 100% pure) (footnote, Table 1). Therefore, most, if not all, primitive cells were of leukemic origin.                                View this table: [in this window] [in a new window]   Table 1. Gene expression data from cDNA arrays CD34+/CD38 cells sorted from each population were used to isolate RNA and synthesize 32P-labeled cDNA probes. We analyzed 7 AML specimens in parallel with samples of normal CD34+/CD38 cells. The cumulative results are shown in Table 1 and represent analysis of approximately 1400 known genes. The first 2 genes listed in Table 1, DAPK and IRF-1, were found to be overexpressed in all 7 of the AML samples examined. DAPK has been shown to be active as an inducer of apoptosis and is strongly implicated as a tumor-suppressor gene.7,9 Indeed, the gene is silenced in many malignant cell types, including some leukemic cell lines.10,11 Similarly, the transcription factor IRF-1 has also been shown to be a tumor suppressor and is strongly induced by interferon-.8,12 Moreover, this gene is usually deleted or shows exon skipping in acute promyelocytic leukemia or leukemias with deletion of chromosome 5q31.13 Interestingly, DAPK was originally discovered by means of a genetic screen for interferon--inducible apoptosis.14 Thus, we speculate that IRF-1 may directly activate expression of DAPK in AML cells. To confirm the expression of DAPK and IRF-1, reverse transcription (RT)-PCR was performed on highly purified populations derived from AML and normal specimens. As shown in Figure 1A, expression of each gene was evident in CD34+/CD38 cells from leukemic specimens, but was not seen in normal specimens. To further assess expression of each gene, immunoblots were performed. While it is not typically feasible to isolate sufficient CD34+/CD38 cells for this type of analysis, it was possible to enrich for primitive cells by purifying the CD34+ population. As shown in Figure 1B, DAPK, and IRF-1 are readily detected in AML but not normal CD34+ cells. View larger version (83K): [in this window] [in a new window]   Figure 1. Expression analysis of DAPK and IRF-1 in primitive leukemic and normal cells. (A) RT-PCR was performed on the equivalent of 1000 purified cells from normal bone marrow (BM) or AML-derived CD34+/CD38 cells. Lanes 1-3 are independent normal marrow CD34+/CD38 cell specimens. The remaining 4 lanes are derived from independent AML blood specimens sorted to isolate CD34+/CD38 populations. PCRs for IRF-1 and DAPK are shown in the top and middle panels, respectively. The bottom panel shows control reactions using primers for 2-microglobulin. (B) Immunoblot analysis was performed to analyze IRF-1 and DAPK with the use of the equivalent of 400 000 cells per lane (each lane is an independent specimen). Samples were derived from flow-cytometrically sorted normal CD34+ cells (first 4 lanes after the KG-1 cell line control) or sorted AML CD34+ cells (adjacent 9 lanes). From left to right, AML specimens were from FAB types M4, M1, M1, M2/6, M2, M4, M4, M5, and M4. In addition to DAPK and IRF-1, 5 genes potentially relevant to AML biology (Table 1, genes 3-7) were found to be overexpressed in 4 or more primary AMLs. Notably, 3 of these genes, AML-1, AF-4, and EWS, are known cancer-related genes. In particular, both AML-1 and AF-4 are associated with the common disruptions of CBF and MLL frequently found in myeloid leukemias.15-17 However, none of the samples assayed had the translocations associated with AML-1 and AF-4. Gene 6, Ikaros, is implicated in the development of early hematolymphoid cells and has also been reported to have aberrant activity in acute lymphoblastic leukemia (ALL).18,19 In addition, dominant negative forms of Ikaros have been reported in infant ALL with the MLL-AF4 translocation.20 A surprising finding was expression of Stat6 in several AML specimens. Transgenic studies have implicated Stat6 as critical for development and function of TH2 lymphocytes,21 but to our knowledge it does not have a known role in myeloid development or malignancy. In summary, we have documented consistent overexpression of the tumor-suppressor genes IRF-1 and DAPK in primary AML cells with a primitive phenotype. These data are surprising in that pro-apoptotic factors are typically absent from malignant cells, and they thereby indicate that IRF-1 and DAPK may play a role in the biology of early leukemogenic cells. One interpretation of these results may be that leukemic cells undergo the beginnings of apoptotic induction, but clearly fail to complete the process of apoptosis. Thus, some proteins associated with apoptosis or tumor suppression are evident. We suggest that exploiting the presence of these molecules may be an interesting means of affecting programmed cell death in leukemic stem/progenitor cells.     Acknowledgments The authors thank Drs Gary Van Zant and Stephen J. Szilvassy for helpful discussions and critical evaluation of the manuscript, and the National Disease Research Interchange for help in procuring normal bone marrow specimens.     Footnotes Submitted August 14, 2000; accepted December 7, 2000. Supported by grants to C.T.J. from the Leukemia and Lymphoma Society (Translational Grant 6057-99) and the American Cancer Society RPG-99-206-01-LBC); also supported by the McDowell Cancer Foundation and the Donatina Colachicco Cancer Research Fund. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Craig T. Jordan, Markey Cancer Center, 800 Rose St, Rm CC407, Lexington, KY; e-mail: cjordan{at}pop.uky.edu.     References Top Abstract Introduction Study design Results and discussion References 1. McCulloch EA, Minden MD, Miyauchi J, Kelleher CA, Wang C. Stem cell renewal and differentiation in acute myeloblastic leukaemia. J Cell Sci Suppl. 1988;10:267-281[Medline] [Order article via Infotrieve]. 2. Messner HA, Griffin JD. Biology of acute myeloid leukaemia. Clin Haematol. 1986;15:641-667[Medline] [Order article via Infotrieve]. 3. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-648[CrossRef][Medline] [Order article via Infotrieve]. 4. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737[CrossRef][Medline] [Order article via Infotrieve]. 5. Blair A, Hogge DE, Sutherland HJ. Most acute myeloid leukemia progenitor cells with long-term proliferative ability in vitro and in vivo have the phenotype CD34(+)/CD71(-)/HLA-DR-. Blood. 1998;92:4325-4335[Abstract/Free Full Text]. 6. Jordan CT, Upchurch D, Szilvassy SJ, et al. The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia. 2000;14:1777-1784[CrossRef][Medline] [Order article via Infotrieve]. 7. Levy-Strumpf N, Kimchi A. Death associated proteins (DAPs): from gene identification to the analysis of their apoptotic and tumor suppressive functions. Oncogene. 1998;17:3331-3340[Medline] [Order article via Infotrieve]. 8. Tanaka N, Ishihara M, Kitagawa M, et al. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell. 1994;77:829-839[CrossRef][Medline] [Order article via Infotrieve]. 9. Cohen O, Feinstein E, Kimchi A. DAP-kinase is a Ca2+/calmodulin-dependent, cytoskeletal-associated protein kinase, with cell death-inducing functions that depend on its catalytic activity. EMBO J. 1997;16:998-1008[CrossRef][Medline] [Order article via Infotrieve]. 10. Kissil JL, Feinstein E, Cohen O, et al. DAP-kinase loss of expression in various carcinoma and B-cell lymphoma cell lines: possible implications for role as tumor suppressor gene. Oncogene. 1997;15:403-407[CrossRef][Medline] [Order article via Infotrieve]. 11. Katzenellenbogen RA, Baylin SB, Herman JG. Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. Blood. 1999;93:4347-4353[Abstract/Free Full Text]. 12. Pine R, Decker T, Kessler DS, Levy DE, Darnell JE Jr. Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both beta interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either. Mol Cell Biol. 1990;10:2448-2457[Abstract/Free Full Text]. 13. Green WB, Slovak ML, Chen IM, Pallavicini M, Hecht JL, Willman CL. Lack of IRF-1 expression in acute promyelocytic leukemia and in a subset of acute myeloid leukemias with del(5)(q31). Leukemia. 1999;13:1960-1971[CrossRef][Medline] [Order article via Infotrieve]. 14. Deiss LP, Feinstein E, Berissi H, Cohen O, Kimchi A. Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death. Genes Dev. 1995;9:15-30[Abstract/Free Full Text]. 15. Lo Coco F, Pisegna S, Diverio D. The AML1 gene: a transcription factor involved in the pathogenesis of myeloid and lymphoid leukemias. Haematologica. 1997;82:364-370[Abstract/Free Full Text]. 16. Hilden JM, Kersey JH. The MLL (11q23) and AF-4 (4q21) genes disrupted in t(4;11) acute leukemia: molecular and clinical studies. Leuk Lymphoma. 1994;14:189-195[Medline] [Order article via Infotrieve]. 17. Hromas R, Klemsz M. The ETS oncogene family in development, proliferation and neoplasia. Int J Hematol. 1994;59:257-265[Medline] [Order article via Infotrieve]. 18. Klug CA, Morrison SJ, Masek M, Hahm K, Smale ST, Weissman IL. Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes. Proc Natl Acad Sci U S A. 1998;95:657-662[Abstract/Free Full Text]. 19. Sun L, Goodman PA, Wood CM, et al. Expression of aberrantly spliced oncogenic ikaros isoforms in childhood acute lymphoblastic leukemia. J Clin Oncol. 1999;17:3753-3766[Abstract/Free Full Text]. 20. Sun L, Heerema N, Crotty L, et al. Expression of dominant-negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia. Proc Natl Acad Sci U S A. 1999;96:680-685[Abstract/Free Full Text]. 21. Akira S. Functional roles of STAT family proteins: lessons from knockout mice. Stem Cells. 1999;17:138-146[Abstract/Free Full Text]. © 2001 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: E. C. Attar, D. J. DeAngelo, J. G. Supko, F. D'Amato, D. Zahrieh, A. Sirulnik, M. Wadleigh, K. K. Ballen, S. McAfee, K. B. Miller, et al. Phase I and Pharmacokinetic Study of Bortezomib in Combination with Idarubicin and Cytarabine in Patients with Acute Myelogenous Leukemia Clin. Cancer Res., March 1, 2008; 14(5): 1446 - 1454. [Abstract] [Full Text] [PDF] M. L. Guzman, R. M. Rossi, S. Neelakantan, X. Li, C. A. Corbett, D. C. Hassane, M. W. Becker, J. M. Bennett, E. Sullivan, J. L. Lachowicz, et al. An orally bioavailable parthenolide analog selectively eradicates acute myelogenous leukemia stem and progenitor cells Blood, December 15, 2007; 110(13): 4427 - 4435. [Abstract] [Full Text] [PDF] M. Rizzi, M. P. Tschan, C. Britschgi, A. Britschgi, B. Hugli, T. J. Grob, N. Leupin, B. U. Mueller, H.-U. Simon, A. Ziemiecki, et al. The death-associated protein kinase 2 is up-regulated during normal myeloid differentiation and enhances neutrophil maturation in myeloid leukemic cells J. Leukoc. Biol., June 1, 2007; 81(6): 1599 - 1608. [Abstract] [Full Text] [PDF] M. Komor, S. Guller, C. D. Baldus, S. de Vos, D. Hoelzer, O. G. Ottmann, and W.-K. Hofmann Transcriptional Profiling of Human Hematopoiesis During In Vitro Lineage-Specific Differentiation Stem Cells, September 1, 2005; 23(8): 1154 - 1169. [Abstract] [Full Text] [PDF] M. L. Guzman, R. M. Rossi, L. Karnischky, X. Li, D. R. Peterson, D. S. Howard, and C. T. Jordan The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells Blood, June 1, 2005; 105(11): 4163 - 4169. [Abstract] [Full Text] [PDF] G. P. Dunn, K. C.F. Sheehan, L. J. Old, and R. D. Schreiber IFN Unresponsiveness in LNCaP Cells Due to the Lack of JAK1 Gene Expression Cancer Res., April 15, 2005; 65(8): 3447 - 3453. [Abstract] [Full Text] [PDF] T. Passioura, A. Dolnikov, S. Shen, and G. Symonds N-Ras-Induced Growth Suppression of Myeloid Cells Is Mediated by IRF-1 Cancer Res., February 1, 2005; 65(3): 797 - 804. [Abstract] [Full Text] [PDF] D. G. Gilliland, C. T. Jordan, and C. A. Felix The Molecular Basis of Leukemia Hematology, January 1, 2004; 2004(1): 80 - 97. [Abstract] [Full Text] [PDF] M. L. Guzman, C. F. Swiderski, D. S. Howard, B. A. Grimes, R. M. Rossi, S. J. Szilvassy, and C. T. Jordan Preferential induction of apoptosis for primary human leukemic stem cells PNAS, December 10, 2002; 99(25): 16220 - 16225. [Abstract] [Full Text] [PDF] U. Testa, R. Riccioni, S. Militi, E. Coccia, E. Stellacci, P. Samoggia, R. Latagliata, G. Mariani, A. Rossini, A. Battistini, et al. Elevated expression of IL-3Ralpha in acute myelogenous leukemia is associated with enhanced blast proliferation, increased cellularity, and poor prognosis Blood, September 26, 2002; 100(8): 2980 - 2988. [Abstract] [Full Text] [PDF] F. J. Giles, A. Keating, A. H. Goldstone, I. Avivi, C. L. Willman, and H. M. Kantarjian Acute Myeloid Leukemia Hematology, January 1, 2002; 2002(1): 73 - 110. [Abstract] [Full Text] M. L. Guzman, S. J. Neering, D. Upchurch, B. Grimes, D. S. Howard, D. A. Rizzieri, S. M. Luger, and C. T. Jordan Nuclear factor-{kappa}B is constitutively activated in primitive human acute myelogenous leukemia cells Blood, October 15, 2001; 98(8): 2301 - 2307. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Guzman, M. L. Articles by Jordan, C. T. Search for Related Content PubMed PubMed Citation Articles by Guzman, M. L. Articles by Jordan, C. T. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?

	Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020