| |
|
|
|
|
|
|
|||
|
BRIEF REPORT
From the Blood and Marrow Transplant Program, Markey
Cancer Center, Division of Hematology/Oncology, University of Kentucky
Medical Center, Lexington Division of Oncology and Bone Marrow
Transplantation, Duke University Medical Center, Durham, NC; and the
Department of Hematology/Oncology, University of Pennsylvania,
Philadelphia, PA.
Previous studies indicate that human acute myelogenous leukemia
(AML) arises from a rare population of leukemic stem
cells. Cells of this nature can initiate and maintain
leukemic cell growth in both long-term cultures and nonobese
diabetic/severe combined immune-deficient mice. To characterize the
biology of primitive AML cells, gene expression screens were
performed with 7 primary AML and 3 normal specimens. For each
sample, stem cell populations (CD34+/CD38 The concept of a hierarchical organization to
leukemic populations has been considered for many
years,1,2 but only recently has the phenotypic description
of leukemic stem cells allowed more direct analyses. Recent studies
have shown that CD34+/CD38 Cells and processing
Flow cytometry
Complementary DNA arrays With the use of CD34+/CD38 cells
(0.5 to 1.0 × 106 cells), total RNA was isolated by
means of the NucleoSpin RNA II kit (Clontech, Palo Alto, CA),
and probes were generated by means of the Atlas cDNA Expression Array
kit (Clontech, Palo Alto, CA) as per manufacturer's instructions.
Samples were hybridized (3 million to 5 million cpm) to Clontech Human
Cancer 1.2 and Hematology arrays. Data from each array was analyzed by
phospho-imager and quantitated by means of the Atlas Image 1.0 software. On the basis of the consistency of CD34 expression
in both cell types, expression of all genes in the array is expressed
in units relative to CD34 (intensity arbitrarily set = 1).
Furthermore, serial probing of complementary DNA (cDNA) arrays with
probes from the same specimen showed a high degree of consistency.
Reverse-transcription polymerase chain reaction RNA samples were prepared with the use of the Miltenyi µMACS (Mitenyi, Auburn, CA) messenger RNA isolation kit according to the manufacturer's instructions and reverse transcribed with Superscript II (Gibco, BRL, Rockville, MD) via standard procedure. Polymerase chain reactions (PCRs) were performed by means of a PerkinElmer 9700 thermalcycler and the following primers: 2-microglobulin forward, CTCGCGCTACTCTCTCTTTC;
reverse, CATGTCTCGATCCCACTTAAC. IRF-1 forward,
CGGGGCTCATCTGGATTAATAAAGAGG; reverse, GGATGTGCCAGTCGGGGAGAGTG. DAPK forward, AAGCCATCATCCATGCCATC; reverse,
TCTCTCCTTCTCGGTTCTTGA. For each reaction, the cDNA equivalent of 1000 cells was amplified for 30 cycles (94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds).
Immunoblots Cell samples were prepared and analyzed as previously described.6 The DAPK-55 antibody (Sigma, St Louis, MO) was used at a 1:500 dilution. IRF-1 was detected with the C-20 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000. All primary antibodies were visualized by means of alkaline phosphatase-conjugated secondary antibodies and the ECF reagent (Pharmacia, Sweden) according to the manufacturer's instructions.
The AML specimens analyzed were of French-American-British (FAB)
subtypes M1 (n = 2), M2 (n = 1), M4 (n = 3), and M2/M6 (n = 1),
which exhibited either normal or aberrant cytogenetics (footnote, Table
1). It should be noted that in order to
obtain sufficient CD34+/CD38
CD34+/CD38 To confirm the expression of DAPK and IRF-1,
reverse transcription (RT)-PCR was performed on highly
purified populations derived from AML and normal specimens. As shown in
Figure 1A, expression of each gene was
evident in CD34+/CD38
In addition to DAPK and IRF-1, 5 genes potentially relevant to AML biology (Table 1, genes 3-7) were found to be overexpressed in 4 or more primary AMLs. Notably, 3 of these genes, AML-1, AF-4, and EWS, are known cancer-related genes. In particular, both AML-1 and AF-4 are associated with the common disruptions of CBF and MLL frequently found in myeloid leukemias.15-17 However, none of the samples assayed had the translocations associated with AML-1 and AF-4. Gene 6, Ikaros, is implicated in the development of early hematolymphoid cells and has also been reported to have aberrant activity in acute lymphoblastic leukemia (ALL).18,19 In addition, dominant negative forms of Ikaros have been reported in infant ALL with the MLL-AF4 translocation.20 A surprising finding was expression of Stat6 in several AML specimens. Transgenic studies have implicated Stat6 as critical for development and function of TH2 lymphocytes,21 but to our knowledge it does not have a known role in myeloid development or malignancy. In summary, we have documented consistent overexpression of the tumor-suppressor genes IRF-1 and DAPK in primary AML cells with a primitive phenotype. These data are surprising in that pro-apoptotic factors are typically absent from malignant cells, and they thereby indicate that IRF-1 and DAPK may play a role in the biology of early leukemogenic cells. One interpretation of these results may be that leukemic cells undergo the beginnings of apoptotic induction, but clearly fail to complete the process of apoptosis. Thus, some proteins associated with apoptosis or tumor suppression are evident. We suggest that exploiting the presence of these molecules may be an interesting means of affecting programmed cell death in leukemic stem/progenitor cells.
The authors thank Drs Gary Van Zant and Stephen J. Szilvassy for helpful discussions and critical evaluation of the manuscript, and the National Disease Research Interchange for help in procuring normal bone marrow specimens.
Submitted August 14, 2000; accepted December 7, 2000.
Supported by grants to C.T.J. from the Leukemia and Lymphoma Society (Translational Grant 6057-99) and the American Cancer Society RPG-99-206-01-LBC); also supported by the McDowell Cancer Foundation and the Donatina Colachicco Cancer Research Fund.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Craig T. Jordan, Markey Cancer Center, 800 Rose St, Rm CC407, Lexington, KY; e-mail: cjordan{at}pop.uky.edu.
1. McCulloch EA, Minden MD, Miyauchi J, Kelleher CA, Wang C. Stem cell renewal and differentiation in acute myeloblastic leukaemia. J Cell Sci Suppl. 1988;10:267-281[Medline] [Order article via Infotrieve]. 2. Messner HA, Griffin JD. Biology of acute myeloid leukaemia. Clin Haematol. 1986;15:641-667[Medline] [Order article via Infotrieve]. 3. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-648[CrossRef][Medline] [Order article via Infotrieve]. 4. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737[CrossRef][Medline] [Order article via Infotrieve].
5.
Blair A, Hogge DE, Sutherland HJ.
Most acute myeloid leukemia progenitor cells with long-term proliferative ability in vitro and in vivo have the phenotype CD34(+)/CD71(-)/HLA-DR-.
Blood.
1998;92:4325-4335 6. Jordan CT, Upchurch D, Szilvassy SJ, et al. The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia. 2000;14:1777-1784[CrossRef][Medline] [Order article via Infotrieve]. 7. Levy-Strumpf N, Kimchi A. Death associated proteins (DAPs): from gene identification to the analysis of their apoptotic and tumor suppressive functions. Oncogene. 1998;17:3331-3340[Medline] [Order article via Infotrieve]. 8. Tanaka N, Ishihara M, Kitagawa M, et al. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell. 1994;77:829-839[CrossRef][Medline] [Order article via Infotrieve]. 9. Cohen O, Feinstein E, Kimchi A. DAP-kinase is a Ca2+/calmodulin-dependent, cytoskeletal-associated protein kinase, with cell death-inducing functions that depend on its catalytic activity. EMBO J. 1997;16:998-1008[CrossRef][Medline] [Order article via Infotrieve]. 10. Kissil JL, Feinstein E, Cohen O, et al. DAP-kinase loss of expression in various carcinoma and B-cell lymphoma cell lines: possible implications for role as tumor suppressor gene. Oncogene. 1997;15:403-407[CrossRef][Medline] [Order article via Infotrieve].
11.
Katzenellenbogen RA, Baylin SB, Herman JG.
Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies.
Blood.
1999;93:4347-4353
12.
Pine R, Decker T, Kessler DS, Levy DE, Darnell JE Jr.
Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both beta interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either.
Mol Cell Biol.
1990;10:2448-2457 13. Green WB, Slovak ML, Chen IM, Pallavicini M, Hecht JL, Willman CL. Lack of IRF-1 expression in acute promyelocytic leukemia and in a subset of acute myeloid leukemias with del(5)(q31). Leukemia. 1999;13:1960-1971[CrossRef][Medline] [Order article via Infotrieve].
14.
Deiss LP, Feinstein E, Berissi H, Cohen O, Kimchi A.
Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death.
Genes Dev.
1995;9:15-30
15.
Lo Coco F, Pisegna S, Diverio D.
The AML1 gene: a transcription factor involved in the pathogenesis of myeloid and lymphoid leukemias.
Haematologica.
1997;82:364-370 16. Hilden JM, Kersey JH. The MLL (11q23) and AF-4 (4q21) genes disrupted in t(4;11) acute leukemia: molecular and clinical studies. Leuk Lymphoma. 1994;14:189-195[Medline] [Order article via Infotrieve]. 17. Hromas R, Klemsz M. The ETS oncogene family in development, proliferation and neoplasia. Int J Hematol. 1994;59:257-265[Medline] [Order article via Infotrieve].
18.
Klug CA, Morrison SJ, Masek M, Hahm K, Smale ST, Weissman IL.
Hematopoietic stem cells and lymphoid progenitors express different Ikaros isoforms, and Ikaros is localized to heterochromatin in immature lymphocytes.
Proc Natl Acad Sci U S A.
1998;95:657-662
19.
Sun L, Goodman PA, Wood CM, et al.
Expression of aberrantly spliced oncogenic ikaros isoforms in childhood acute lymphoblastic leukemia.
J Clin Oncol.
1999;17:3753-3766
20.
Sun L, Heerema N, Crotty L, et al.
Expression of dominant-negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia.
Proc Natl Acad Sci U S A.
1999;96:680-685 21. Akira S. Functional roles of STAT family proteins: lessons from knockout mice. Stem Cells. 1999;17:138-146[Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
E. C. Attar, D. J. DeAngelo, J. G. Supko, F. D'Amato, D. Zahrieh, A. Sirulnik, M. Wadleigh, K. K. Ballen, S. McAfee, K. B. Miller, et al. Phase I and Pharmacokinetic Study of Bortezomib in Combination with Idarubicin and Cytarabine in Patients with Acute Myelogenous Leukemia Clin. Cancer Res., March 1, 2008; 14(5): 1446 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, R. M. Rossi, S. Neelakantan, X. Li, C. A. Corbett, D. C. Hassane, M. W. Becker, J. M. Bennett, E. Sullivan, J. L. Lachowicz, et al. An orally bioavailable parthenolide analog selectively eradicates acute myelogenous leukemia stem and progenitor cells Blood, December 15, 2007; 110(13): 4427 - 4435. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rizzi, M. P. Tschan, C. Britschgi, A. Britschgi, B. Hugli, T. J. Grob, N. Leupin, B. U. Mueller, H.-U. Simon, A. Ziemiecki, et al. The death-associated protein kinase 2 is up-regulated during normal myeloid differentiation and enhances neutrophil maturation in myeloid leukemic cells J. Leukoc. Biol., June 1, 2007; 81(6): 1599 - 1608. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, R. M. Rossi, L. Karnischky, X. Li, D. R. Peterson, D. S. Howard, and C. T. Jordan The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells Blood, June 1, 2005; 105(11): 4163 - 4169. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Dunn, K. C.F. Sheehan, L. J. Old, and R. D. Schreiber IFN Unresponsiveness in LNCaP Cells Due to the Lack of JAK1 Gene Expression Cancer Res., April 15, 2005; 65(8): 3447 - 3453. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Passioura, A. Dolnikov, S. Shen, and G. Symonds N-Ras-Induced Growth Suppression of Myeloid Cells Is Mediated by IRF-1 Cancer Res., February 1, 2005; 65(3): 797 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Gilliland, C. T. Jordan, and C. A. Felix The Molecular Basis of Leukemia Hematology, January 1, 2004; 2004(1): 80 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, C. F. Swiderski, D. S. Howard, B. A. Grimes, R. M. Rossi, S. J. Szilvassy, and C. T. Jordan Preferential induction of apoptosis for primary human leukemic stem cells PNAS, December 10, 2002; 99(25): 16220 - 16225. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Testa, R. Riccioni, S. Militi, E. Coccia, E. Stellacci, P. Samoggia, R. Latagliata, G. Mariani, A. Rossini, A. Battistini, et al. Elevated expression of IL-3Ralpha in acute myelogenous leukemia is associated with enhanced blast proliferation, increased cellularity, and poor prognosis Blood, September 26, 2002; 100(8): 2980 - 2988. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Giles, A. Keating, A. H. Goldstone, I. Avivi, C. L. Willman, and H. M. Kantarjian Acute Myeloid Leukemia Hematology, January 1, 2002; 2002(1): 73 - 110. [Abstract] [Full Text] |
||||
![]() |
M. L. Guzman, S. J. Neering, D. Upchurch, B. Grimes, D. S. Howard, D. A. Rizzieri, S. M. Luger, and C. T. Jordan Nuclear factor-{kappa}B is constitutively activated in primitive human acute myelogenous leukemia cells Blood, October 15, 2001; 98(8): 2301 - 2307. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||