| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Departments of Immunology, Medicine, and
Medical Biophysics, University of Toronto; Ontario Cancer Institute,
Princess Margaret Hospital; both of Toronto, Canada; and Department of
Medicine, Division of Experimental Medicine, McGill University,
Montréal, QC, Canada.
Cytokines play an essential role during early T-cell development.
However, the mechanisms controlling cytokine signaling in developing
thymocytes have not been elucidated. Cytokine receptor signaling can be
modulated by suppressor of cytokine signaling-1 (SOCS-1), which acts as
a negative regulator of Janus kinases. SOCS-1 is normally expressed
throughout thymocyte development; however, retroviral-mediated
overexpression of SOCS-1 in fetal liver-derived hematopoietic
progenitors prevented their progression beyond the earliest stage of
T-cell development. Further analysis revealed that SOCS-1 expression is
transiently suppressed following pre-T-cell receptor (TCR) signaling.
Moreover, constitutive expression of SOCS-1 abrogated
pre-TCR- mediated expansion of immature thymocytes but
did not interfere with differentiation. These findings reveal that
SOCS-1 serves to regulate cytokine signaling at critical checkpoints
during early T-cell development.
(Blood. 2001;97:2269-2277) Cytokines play an important role in the regulation
of cell differentiation, proliferation, survival, and migration. These effects are mediated by the binding of cytokines to specific
cell-surface receptors, which activate Janus kinases (JAKs), leading to
phosphorylation and nuclear translocation of signal transducers and
activators of transcription (STATs).1 Severe lymphocyte
developmental defects are observed in mice deficient for various JAKs
and STATs, illustrating the requirement for stringent regulation of
cytokine signaling pathways. For example,
JAK3 Hematopoietic progenitors migrate from the fetal liver or the adult
bone marrow to the thymus, where commitment to the T-cell lineage
occurs.7 The earliest thymic precursors lack surface expression of the CD4 and CD8 coreceptors and are thus termed double-negative (DN) thymocytes. This subset can be subdivided based on
the ordered surface expression of CD25 (interleukin-2 receptor Recently, a new family of negative regulators of JAK-STAT signaling was
identified,14 providing a potential mechanism for the
regulation of cytokine responses. Proteins belonging to this family are
termed suppressors of cytokine signaling (SOCS) and are characterized
by the presence of a Src homology 2 (SH2) domain and a
carboxyl-terminal conserved domain called the SOCS box. At present, 8 members of the SOCS family have been identified, suppressor of cytokine
signaling-1 (SOCS-1) to SOCS-7 and CIS (cytokine-inducible
SH2-containing protein). Expression of SOCS-1 is induced by several
cytokines, including IL-2, IL-3, IL-4, IL-6, IL-13,
granulocyte-monocyte colony-stimulating factor, erythropoietin, interferon- To gain insight into the possible function of SOCS-1 during T-cell
development, we overexpressed SOCS-1 in fetal liver-derived hematopoietic progenitors by retrovirus-mediated gene transfer and
examined their ability to give rise to T cells in fetal thymic organ
culture (FTOC). Although SOCS-1 is normally expressed throughout thymocyte development, constitutive expression of SOCS-1 in
hematopoietic progenitors prevented their progression beyond the
earliest stage of T-cell development. Further analysis revealed that
SOCS-1 expression is transiently suppressed following pre-TCR
signaling. Moreover, overexpression of SOCS-1 in DNIII thymocytes
abrogated pre-TCR-mediated expansion of DNIV thymocytes but did not
interfere with differentiation to the DP stage of T-cell development.
Thus, SOCS-1 down-regulation may allow for the proliferative burst
associated with pre-TCR signaling, suggesting that this outcome can be
functionally dissociated from allelic exclusion, survival, and
differentiation. Our findings suggest that SOCS-1 may regulate Mice
Cell lines
Flow cytometry For flow cytometry, fluorescein isothiocynate (FITC)-, phycoerythrin (PE)-, Cy-Chrome-, allophycocyanin (APC)-, or biotin-conjugated antibodies were purchased from Pharmingen (Mississauga, ON). Flow cytometry was performed as previously described.27 To obtain purified subsets of DN thymocytes, single-cell suspensions from day 14 CD1 fetal thymic lobes were stained with anti-CD25-FITC, anti-CD117-PE, and biotinylated lineage markers (CD3 , CD4, CD8, B220, Gr-1, Mac-1, DX-5), followed by APC-conjugated
streptavidin. Purified DP and single-positive (SP) thymocytes were
obtained by staining single-cell suspensions from adult CD1 thymus with anti-CD4-FITC, anti-TCR -PE, and anti-CD8-APC; DP cells were
defined by a CD4+CD8+TCR Int
phenotype, and SP cells were defined by a
CD4+CD8 TCR High or
CD4 CD8+TCR High phenotype.
Cells were sorted using a Coulter Elite flow cytometer (Coulter
Electronics, Montréal, QC); in all cases, sort purity was more
than 99%.
RNA preparation and reverse transcriptase-polymerase chain reaction Total RNA was prepared from purified thymocyte populations using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA) was produced with the Omniscript RT kit (Qiagen) using random hexamers. Polymerase chain reaction (PCR) was performed in a final volume of 25 µL containing 1 × PCR buffer (Qiagen), 0.5 mM deoxyribonucleoside triphosphate, 2.5 U HotStar Taq polymerase (Qiagen), and appropriate dilutions of cDNA. For SOCS-1 reverse transcriptase (RT)-PCR, 1 × Q solution (Qiagen) was added. Cycle conditions were 95°C for 15 minutes, followed by 35 cycles of 94°C for 30 seconds, annealing for 30 seconds at the indicated temperature, and 72°C for 30 to 40 seconds, depending on the size of the expected PCR product. After a final incubation at 72°C for 10 minutes, reactions were run on a 1.6% agarose gel, and PCR products were visualized by ethidium bromide staining. The -actin cDNA was amplified using the -actin forward
(GTGGGCCGCTCTAGGCACCAA) and reverse (CTCTTTGATGTCACGCACGATTTC) oligonucleotides, with annealing at 55°C, generating a 539-base-pair (bp) product. CD45 cDNA was amplified using the CD45 forward
(CTACGCAAAGCACGGCCTG) and reverse (TCGAGTCTGCGTTGTCCCAC)
oligonucleotides, with annealing at 52°C, generating a 340-bp
product. SOCS-1 cDNA was amplified using the SOCS-1 forward
(TCCTCGTCCTCGTCTTCGTC) and reverse (AAGCCATCTTCACGCTGAGC) oligonucleotides, with annealing at 58°C, generating a 279-bp product. TCR-C cDNA was amplified using the TCR-C forward
(AGAACCTGCTGTGTACCAGTTAA) and reverse (CATGAGCAGGTTAAATCCGGCT)
oligonucleotides, with annealing at 55°C, generating a
350-bp product.
Retrovirus infection Single-cell suspensions from day 14 fetal liver were depleted of cells expressing high levels of CD24 (heat-stable antigen) by complement-mediated lysis. Briefly, cell suspensions were incubated with J11d hybridoma28 culture supernatant for 5 minutes at 4°C and lysed by addition of freshly reconstituted Low-Tox-H rabbit complement (Cedarlane Laboratories, Hornby, ON) and incubation at 37°C for 30 minutes. Dead cells and contaminating erythrocytes were removed using Lympholyte-M (Cedarlane Laboratories). Subsequently, 1 × 106 to 3 × 106 purified hematopoietic precursors were seeded onto GP+E 86 monolayers in 60-mm tissue culture dishes in culture medium supplemented with a further 5% FCS, 4 µg/mL hexadimethrine bromide, IL-3, IL-6, IL-7, and SCF (R&D Systems, Minneapolis, MN). Cells were cocultured for 24 hours at 37°C, and then CD117+GFP+ cells were isolated by flow cytometry. Equal numbers of sorted cells, 3 × 103 to 5 × 103, were transferred into deoxyguanosine (dGuo)-treated CD1 fetal thymus lobes by hanging drop in an inverted Terasaki plate for 24 hours at 37°C. Thymic organs were subsequently cultured in standard FTOC conditions, as previously described.29 Single-cell suspensions from the FTOCs were prepared at the indicated times, and thymocytes were analyzed by flow cytometry, as described above.Retrovirus infection of developing thymocytes in intact organ cultures Day 14 fetal thymus lobes from CD1 or RAG2 / mice were cocultured with GP+E 86 cells in a high oxygen-supported submersion culture. Briefly, GP+E 86 cells were seeded onto flat-bottom 96-well microtiter plates
(2 × 104 cells/well) and allowed to adhere by incubation
at 37°C for 16 hours, after which time the cells were irradiated
(3000 rad) to prevent further proliferation. The culture medium was
replaced with fresh culture medium supplemented with a further 5% FCS
and 2 µg/mL hexadimethrine bromide. Fetal thymus lobes were placed onto the GP+E 86 monolayers, and cultures were conducted for 2 to 3 days in an atmosphere containing 70% O2, 25%
N2, and 5% CO2.30,31 Thymus lobes
were then washed and further cultured in standard FTOC conditions. At
the indicated time, single-cell suspensions were prepared and
thymocytes counted and analyzed by flow cytometry as described above.
Antibody treatment of mice and fetal thymus lobes Neonatal RAG2 / mice (< 8 days) were
injected intraperitoneally with 10 µg/g body weight purified
anti-CD3 monoclonal antibody (mAb) (Pharmingen). Injections were
given 36 hours or 72 hours prior to harvest to obtain
CD25Low or ISP (immature SP) and DP thymocytes,
respectively.32 Fetal thymus lobes were prepared from
RAG2 / fetuses at day 14 of gestation and
infected by submersion culture as indicated. The lobes were then
transferred in regular FTOC conditions with or without 10 µg/mL
purified anti-CD3 mAb, similar to the method of Levelt et
al.33 After 8 days, single-cell suspensions were prepared.
Cell counts were performed, and cells were analyzed by flow cytometry
as described above.
Cell proliferation assay Microcultures were prepared by seeding B23 cells in 96-well microtiter plates (104 cells/well) in a final volume of 100 µL. After 48 hours or 72 hours, 3.7 × 104 Bq/well of [3H]thymidine (Dupont NEN, Boston, MA) was added to one set of triplicate cultures, and cells were incubated for a further 6 hours. The amount of [3H]thymidine incorporated was determined by transferring cell lysates onto glass fiber filter mats, followed by scintillation counting.
Expression of SOCS-1 during T-cell development Thymocytes isolated from CD1 fetal thymic lobes and adult thymus were separated according to the surface expression of coreceptors CD4 and CD8 into DN, DP, and SP populations. The DN population was further fractionated according to surface expression of CD25 and CD117 by flow cytometry. Total RNA was prepared and reverse transcribed to cDNA. The amount of SOCS-1 cDNA was assayed by semiquantitative PCR and normalized according to -actin cDNA levels (Figure
1). We were able to detect SOCS-1 cDNA in
all subpopulations, indicating that SOCS-1 is expressed at all stages
of T-cell development (Figure 1).
Overexpression of SOCS-1 abrogates T-cell differentiation from hematopoietic precursors To examine the role of SOCS-1 during the earliest steps of T-cell commitment, we introduced wild-type SOCS-1 by retroviral gene transfer into day 15 fetal liver-derived hematopoietic progenitors (Figure 2A). Infected cells were sorted for GFP and CD117 expression, and GFP+ CD117+ cells were transferred into fetal thymic lobes, which were subsequently cultured in standard FTOC conditions (Figure 2B). The GFP+ cells contained within the organ cultures were analyzed on days 6 and 14 by flow cytometry for surface expression of CD4 and CD8 or of CD25 and CD117 (Figure 3A). We were unable to recover significant numbers of GFP+ cells from SOCS-1-infected progenitors in FTOCs at either day 6 or 14 (Figure 3A). In contrast, progenitors infected with GFP alone gave rise to progeny that developed normally, reaching the DNI/II stage at day 6 and then progressing through the DNIII/IV stages to the DP and SP stage by day 14 (Figure 3A). To determine whether the effects of SOCS-1 required a functional SH2 domain, we introduced a mutant form of SOCS-1 harboring a loss-of-function mutation within the phosphotyrosine binding site in the SOCS-1 SH2 domain (SOCS-1:SH2*) (Figure 3A). We observed normal T-cell development in the GFP+ SOCS-1:SH2*-infected cells, demonstrating that the effects of SOCS-1 on early thymic development require a functional SH2 domain. To ensure that the failure to detect SOCS-1-infected progenitors in FTOC was not due simply to an inability to colonize fetal thymic lobes, we analyzed FTOC at day 4 and were able to detect GFP+ SOCS-1-infected cells (Figure 3B). This indicates that these progenitors seeded the thymi but failed to progress beyond the DNI stage.
Overexpression of SOCS-1 impairs T-cell differentiation from committed thymic precursors To determine the capacity of SOCS-1 to influence later stages of T-cell development, we cocultured day 14 fetal thymi with SOCS-1, SOCS-1:SH2*, or GFP (control) retroviral packaging cell lines for 3 days. This allowed us to study the effects of SOCS-1 overexpression after the DNI-to-DNII transition had occurred but prior to the DNIII-to-DP transition, because fetal thymi from day 14 embryos contain only DN thymocytes.7 Thymic lobes were then transferred to standard FTOC conditions for 1, 3, or 6 days. In all cases, GFP populations (ie, noninfected cells) progressed
through the DN, DP, and SP stages of thymocyte development (Figure
4, rows C, F, and I). The development of
control GFP- and SOCS-1:SH2*-infected cells paralleled the normal
development observed with noninfected cells (Figure 4, rows B, E and
H). We also observed GFP+ SOCS-1-infected thymocytes at
each developmental stage. However, in contrast to the accumulation of
GFP+ cells observed in GFP- and SOCS-1:SH2*-infected
thymic lobes, there was no significant increase in the number of
GFP+ SOCS-1-infected cells by day 9 (Figure 4, rows A and
G; absolute number of GFP+ cells per lobe are shown in
parentheses). These results suggest that either most DN thymocytes were
infected after 3 days of coculture and subsequently differentiated into
DP thymocytes but failed to undergo the normal burst of proliferation
or suggest that only a few DN thymocytes were successfully infected and
subsequently underwent normal expansion. The latter hypothesis is
unlikely, because the frequency of GFP+ cells at day 4 of
culture was similar in SOCS-1-infected thymic lobes compared with
GFP-infected lobes (Figure 4, row A). Moreover, when FTOCs were
analyzed at an earlier time point (day 0-2), the frequency of
GFP+ cells in SOCS-1-infected lobes was higher than in
GFP-infected lobes (data not shown).
Expression of SOCS-1 is reduced upon pre-TCR signaling The apparent decrease in SOCS-1 expression observed in DNIV thymocytes (Figure 1) together with the observation that forced expression of SOCS-1 impaired the pre-TCR-dependent proliferation occurring during the transition from the DNIII to the DP stage (Figure 4) suggested that the expression of SOCS-1 might need to be down-regulated during this transition. Because a preparation of DNIV cells from normal mice consists of a heterogeneous population of cells, we took advantage of an experimental model of pre-TCR activation first developed by Levelt et al33 to study the expression of SOCS-1 messenger RNA (mRNA) following pre-TCR signaling. This model is based on the use of RAG-deficient mice, in which thymocytes are arrested at the DNIII stage due to an inability to rearrange the TCR genes. Cross-linking of CD3 at the surface of these cells with anti-CD3 mAb mimics pre-TCR signaling and allows
thymocytes to progress to the DP stage. DNIII cells (CD25+)
were purified from untreated RAG2 / mice by
cell sorting, whereas CD25Low, ISP
(CD4+CD8- or CD4-CD8+),
and DP thymocytes were obtained from anti-CD3 -treated
RAG2 / mice. The expression of SOCS-1 mRNA
from each population was analyzed by semiquantitative reverse
transcriptase-polymerase chain reaction (RT-PCR) and normalized
against -actin mRNA levels (Figure 5).
SOCS-1 was abundantly expressed in the CD25+ (DNIII)
population but was undetectable in CD25Low cells following
pre-TCR signaling. SOCS-1 expression was again detectable in the ISP
and DP subsets. The presence of germline TCR transcripts (TCR C ),
which normally follows successful selection, was detected in ISP
and DP thymocytes, thus confirming that anti-CD3 treatment initiated
a normal developmental program. Moreover, to ensure that the loss of
SOCS-1 mRNA was selective and not the result of nonspecific
down-regulation of multiple mRNA species, CD45 expression was detected
in all subsets (Figure 5).
Overexpression of SOCS-1 hinders pre-TCR-driven proliferation of immature thymocytes To determine whether failure to down-regulate SOCS-1 expression might affect the maturation of thymocytes from the DNIII to the DP stage, we constitutively expressed SOCS-1 in RAG-deficient thymocytes. Fetal thymic lobes from RAG2 / day 14 embryos
were cocultured with GFP or SOCS-1 retroviral packaging cell lines for
2 days and then placed in standard FTOC conditions in the presence of
anti-CD3 mAb. After 6 days, thymic cellularity was assessed and
cells were analyzed for CD4 and CD8 expression. Both GFP- and
SOCS-1-infected thymocytes were able to give rise to DP cells (Figure
6). However, whereas the percentage of
GFP- and SOCS-1-infected DP cells were similar (56% and 55%, respectively), SOCS-1-expressing DP thymocytes represented a 6-fold smaller fraction of the total thymic cellularity compared with GFP-infected DP cells (Figure 6, right panel). Analysis of infected RAG2 / thymic lobes after 2 days of coculture
with the retroviral packaging lines demonstrated that GFP+
DNIII thymocytes were present at a higher frequency in SOCS-1-infected thymic lobes than in GFP-infected thymic lobes (data not shown). Therefore, the reduced number of SOCS-1-infected DP thymocytes could
not be explained by a decrease in the number of SOCS-1-infected DNIII
thymocytes prior to stimulation with anti-CD3 mAb. These observations suggest that the forced expression of SOCS-1 in DNIII thymocytes does not prevent pre-TCR-mediated differentiation but, rather, results in the failure of these cells to expand in response to
this stimulus.
The c-dependent cytokines
(IL-2, IL-7, IL-9, and IL-15) might play a role at the DNIII stage:
IL-7R / c receptors are expressed at this stage34,35;
DNIII and DNIV thymocytes are severely depleted in
IL-7/IL-7R / c-deficient mice36; and
c / × pT![]() / mice
demonstrate a complete arrest in thymocyte development, whereas the
absence of pT alone allows T-cell development to proceed, albeit
with reduced efficiency.36,37 At present, IL-7 is the only
c-dependent cytokine for which a role in T-cell development has
clearly been demonstrated.8 SOCS-1 has been shown to be a
potent inhibitor of a variety of cytokines, including IL-6, IFN- ,
LIF, and SCF,14,16 but to date its activity in modulating IL-7/IL-7R / c signaling has not been examined. To determine
whether SOCS-1 could interfere with this signaling pathway, we analyzed the proliferation of the IL-7-dependent B-cell line B23 in the presence or absence of ectopically expressed SOCS-1 (Figure
7A). A profound block in proliferation
was observed in B23 cells overexpressing SOCS-1, demonstrating that
SOCS-1 potently interfered with the induction of DNA synthesis
following IL-7 stimulation.
To ascertain whether IL-7 or other
The data presented in this study demonstrate that SOCS-1
intervenes at 2 critical checkpoints during early T-cell development. The first checkpoint occurs at the transition from the DNI to the DNII
stage, where SOCS-1 may modulate c-Kit- and The differentiation and proliferation of early thymic precursors
is guided in part by signals delivered through cytokine receptors. Among the large number of cytokines produced by the thymic stroma, IL-7
and SCF have emerged as the dominant cytokines governing the early
stages of thymopoiesis.38-41 Although transition from the
DNI to the DNII stage can proceed in the absence of IL-7 or SCF
signaling, it is abrogated when both of these signaling pathways are
inoperative. We observed that fetal liver progenitors constitutively expressing SOCS-1 could not reconstitute FTOCs, indicating that this
process depends on signaling pathways inhibited by SOCS-1. The
developmental arrest of thymocytes at the DNI stage observed with
SOCS-1 overexpression is reminiscent of the phenotype of c-kit The ability of SOCS-1 to inhibit the differentiation or renewal of hematopoietic stem cells within the thymus suggested that it might also inhibit stem cell function within the bone marrow. We tested this possibility by injecting fetal liver hematopoietic progenitors infected either with SOCS-1, SOCS-1:SH2*, or GFP retrovirus into sublethally irradiated RAG-deficient hosts. Whereas both SOCS-1:SH2*- and GFP-infected hematopoietic progenitors repopulated the marrow and periphery of host mice, SOCS-1-infected progenitors failed to reconstitute all hematopoietic lineages, including the erythrocyte, granulocyte, megakaryocyte, and lymphocyte lineages (data not shown). Thus, survival, self-renewal, differentiation, and migration of hematopoietic stem cells may be adversely affected by constitutive overexpression of SOCS-1. There is ample evidence to support a model of T-cell development in which thymocyte survival, differentiation, and proliferation are regulated by a series of overlapping signals provided by cytokine and T-cell receptors.8,36,37,42 At each stage of development, efficient thymopoiesis appears to require at least 2 such signals. For instance, the transition from the DNI stage to the DNII stage requires the synergistic action of IL-7 and SCF. This "2-signal" requirement persists throughout the existence of the T cell. Indeed, activation of naive T cells in the periphery necessitates signaling not only through the TCR but also through costimulatory receptors such as CD28.43 At the transition from the DNIII stage to the DP stage, there again appears to be a requirement for 2 separate signals, because overexpression of SOCS-1 curbs the proliferative burst normally induced by pre-TCR signaling. In support of this notion, it was recently shown that transgenic mice overexpressing SOCS-1 display a reduction in thymic cellularity, owing to an apparent block in thymocyte development at the transition from the DNIII to the DP stage.44 However, the role of SOCS-1 at the earliest stages of T-cell development could not be assessed in this study, and a direct link between pre-TCR signaling and SOCS-1 regulation was not investigated. Whereas pre-TCR signals are clearly essential for the generation of DP
thymocytes, the role of cytokine receptor signaling for this process
remains uncertain. It has been proposed that Our results further support a key role for SOCS-1 in providing
additional regulation at the The recent discovery that SOCS-1 inhibits apoptosis and promotes
activation of the p38 mitogen-activated protein kinase (MAPK) induced
by TNF- These results reveal a novel role for cytokine signaling acting in
concert with pre-TCR signals to allow efficient proliferation of
TCR
We thank Drs Alison Michie and Philippe Poussier for critical review of this manuscript. S.T. is the recipient of a Doctoral Research Award from the Medical Research Council of Canada. R.R. and J.C.Z.-P. are the recipients of a Scientist Award from the Medical Research Council of Canada.
Submitted September 29, 2000; accepted December 12, 2000.
Supported by grants from the Canadian Institutes of Health Research.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Juan Carlos Zúñiga-Pflücker, Dept of Immunology, University of Toronto, 1 King's College Circle, Toronto, ON M5S 1A8, Canada; e-mail: jc.zuniga.pflucker{at}utoronto.ca.
1. Leonard WJ, O'Shea JJ. Jaks and STATs: biological implications. Annu Rev Immunol. 1998;16:293-322[CrossRef][Medline] [Order article via Infotrieve].
2.
Eynon EE, Kuida K, Flavell RA.
Disruption of cytokine signaling in lymphoid development: unique contributions of the common cytokine
3.
Eynon EE, Livák F, Kuida K, Schatz DG, Flavell RA.
Distinct effects of Jak3 signaling on
4.
Nosaka T, van Deursen JM, Tripp RA, et al.
Defective lymphoid development in mice lacking Jak3.
Science.
1995;270:800-802 5. Park SY, Saijo K, Takahashi T, et al. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity. 1995;3:771-782[CrossRef][Medline] [Order article via Infotrieve].
6.
Thomis DC, Gurniak CB, Tivol E, Sharpe AH, Berg LJ.
Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking Jak3.
Science.
1995;270:794-797 7. Carlyle JR, Zúñiga-Pflücker JC. Lineage commitment and differentiation of T and natural killer lymphocytes in the fetal mouse. Immunol Rev. 1998;165:63-74[CrossRef][Medline] [Order article via Infotrieve]. 8. Haks MC, Oosterwegel MA, Blom B, Spits HM, Kruisbeek AM. Cell-fate decisions in early T cell development: regulation by cytokine receptors and the pre-TCR. Semin Immunol. 1999;11:23-37[CrossRef][Medline] [Order article via Infotrieve]. 9. von Boehmer H, Aifantis I, Feinberg J, et al. Pleiotropic changes controlled by the pre-T-cell receptor. Curr Opin Immunol. 1999;11:135-142[CrossRef][Medline] [Order article via Infotrieve].
10.
Saint-Ruf C, Ungewiss K, Groettrup M, et al.
Analysis and expression of a cloned pre-T cell receptor gene.
Science.
1994;266:1208-1212
11.
Buer J, Aifantis I, DiSanto JP, Fehling HJ, von Boehmer H.
Role of different T cell receptors in the development of pre-T cells.
J Exp Med.
1997;185:1541-1547 12. von Freeden-Jeffry U, Solvason N, Howard M, Murray R. The earliest T lineage-committed cells depend on IL-7 for Bcl-2 expression and normal cell cycle progression. Immunity. 1997;7:147-154[CrossRef][Medline] [Order article via Infotrieve].
13.
Kim K, Lee CK, Sayers TJ, Muegge K, Durum SK.
The trophic action of IL-7 on pro-T cells: inhibition of apoptosis of pro-T1, -T2, and -T3 cells correlates with Bcl-2 and Bax levels and is independent of Fas and p53 pathways.
J Immunol.
1998;160:5735-5741 14. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol. 2000;18:143-164[CrossRef][Medline] [Order article via Infotrieve]. 15. Naka T, Fujimoto M, Kishimoto T. Negative regulation of cytokine signaling: STAT-induced STAT inhibitor. Trends Biochem Sci. 1999;24:394-398[CrossRef][Medline] [Order article via Infotrieve]. 16. De Sepulveda P, Okkenhaug K, Rose JL, et al. Socs1 binds to multiple signalling proteins and suppresses Steel factor-dependent proliferation. EMBO J. 1999;18:904-915[CrossRef][Medline] [Order article via Infotrieve]. 17. Marine JC, Topham DJ, McKay C, et al. SOCS1 deficiency causes a lymphocyte-dependent perinatal lethality. Cell. 1999;98:609-616[CrossRef][Medline] [Order article via Infotrieve].
18.
Starr R, Metcalf D, Elefanty AG, et al.
Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling-1.
Proc Natl Acad Sci U S A.
1998;95:14395-14399
19.
Naka T, Matsumoto T, Narazaki M, et al.
Accelerated apoptosis of lymphocytes by augmented induction of Bax in SSI-1 (STAT-induced STAT inhibitor-1) deficient mice.
Proc Natl Acad Sci U S A.
1998;95:15577-15582 20. Metcalf D, Alexander WS, Elefanty AG, et al. Aberrant hematopoiesis in mice with inactivation of the gene encoding SOCS-1. Leukemia. 1999;13:926-934[CrossRef][Medline] [Order article via Infotrieve].
21.
Alexander WS, Starr R, Fenner JE, et al.
SOCS1 is a critical inhibitor of interferon 22. Shinkai Y, Rathbun G, Lam KP, et al. RAG-2deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 1992;68:855-867[CrossRef][Medline] [Order article via Infotrieve].
23.
Di Santo JP, Muller W, Guy-Grand D, Fischer A, Rajewsky K.
Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor 24. Markowitz DG, Goff SP, Bank A. Safe and efficient ecotropic and amphotropic packaging lines for use in gene transfer experiments. Trans Assoc Am Physicians. 1988;101:212-218[Medline] [Order article via Infotrieve]. 25. Hawley RG, Lieu FHL, Fong AZC, et al. Retroviral vectors for production of interleukin-12 in the bone marrow to induce a graft-versus-leukemia effect. Ann N Y Acad Sci. 1996;795:341-345[Medline] [Order article via Infotrieve]. 26. Cheng L, Du C, Murray D, et al. A GFP reporter system to assess gene transfer and expression in viable human hematopoietic progenitors. Gene Ther. 1997;4:1013-1022[CrossRef][Medline] [Order article via Infotrieve].
27.
Trop S, Steff AM, Denis F, Wiest DL, Hugo P.
The connecting peptide domain of pT 28. Bruce J, Symington FW, McKearn TJ, Sprent J. A monoclonal antibody discriminating between subsets of T and B cells. J Immunol. 1981;127:2496-2501[Abstract].
29.
Michie AM, Carlyle JR, Zúñiga-Pflücker JC.
Early intrathymic precursor cells acquire a CD4low phenotype.
J Immunol.
1998;160:1735-1741
30.
Watanabe Y, Katsura Y.
Development of T cell receptor
31.
Sugawara T, Di Bartolo V, Miyazaki T, et al.
An improved retroviral gene transfer technique demonstrates inhibition of CD4-CD8- thymocyte development by kinase-inactive ZAP-70.
J Immunol.
1998;161:2888-2894
32.
Levelt CN, Wang B, Ehrfeld A, Terhorst C, Eichmann K.
Regulation of T cell receptor (TCR)-
33.
Levelt CN, Mombaerts P, Iglesias A, Tonegawa S, Eichmann K.
Restoration of early thymocyte differentiation in T-cell receptor
34.
Sudo T, Nishikawa S, Ohno N, et al.
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc Natl Acad Sci U S A.
1993;90:9125-9129
35.
Kondo M, Ohashi Y, Tada K, Nakamura M, Sugamura K.
Expression of the mouse interleukin-2 receptor 36. Di Santo JP, Rodewald HR. In vivo roles of receptor tyrosine kinases and cytokine receptors in early thymocyte development. Curr Opin Immunol. 1998;10:196-207[CrossRef][Medline] [Order article via Infotrieve].
37.
Di Santo JP, Aifantis I, Rosmaraki E, et al.
The common cytokine receptor
38.
Peschon JJ, Morrissey PJ, Grabstein KH, et al.
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice.
J Exp Med.
1994;180:1955-1960 39. Rodewald HR, Kretzschmar K, Swat W, Takeda S. Intrathymically expressed c-kit ligand (stem cell factor) is a major factor driving expansion of very immature thymocytes in vivo. Immunity. 1995;3:313-319[CrossRef][Medline] [Order article via Infotrieve].
40.
von Freeden-Jeffry U, Vieira P, Lucian LA, et al.
Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine.
J Exp Med.
1995;181:1519-1526
41.
Rodewald HR, Ogawa M, Haller C, Waskow C, DiSanto JP.
Pro-thymocyte expansion by c-kit and the common cytokine receptor 42. Baird AM, Gerstein RM, Berg LJ. The role of cytokine receptor signaling in lymphocyte development. Curr Opin Immunol. 1999;11:157-166[CrossRef][Medline] [Order article via Infotrieve]. 43. Lenschow DJ, Walunas TL, Bluestone JA. CD28/B7 system of T cell costimulation. Annu Rev Immunol. 1996;14:233-258[CrossRef][Medline] [Order article via Infotrieve].
44.
Fujimoto M, Naka T, Nakagawa R, et al.
Defective thymocyte development and perturbed homeostasis of T cells in STAT-induced STAT inhibitor-1/suppressors of cytokine signaling-1 transgenic mice.
J Immunol.
2000;165:1799-1806
45.
Guidos CJ, Williams CJ, Grandal I, et al.
V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors.
Genes Dev.
1996;10:2038-2054 46. Haks MC, Krimpenfort P, van den Brakel JH, Kruisbeek AM. Pre-TCR signaling and inactivation of p53 induces crucial cell survival pathways in pre-T cells. Immunity. 1999;11:91-101[CrossRef][Medline] [Order article via Infotrieve].
47.
Li S, Chen S, Xu X, et al.
Cytokine-induced Src homology 2 protein (CIS) promotes T cell receptor-mediated proliferation and prolongs survival of activated T cells.
J Exp Med.
2000;191:985-994
48.
Morita Y, Naka T, Kawazoe Y, et al.
Signals transducers and activators of transcription (STAT)induced STAT inhibitor-1 (SSI-1)/suppressor of cytokine signaling-1 (SOCS-1) suppresses tumor necrosis factor 49. Rincón M, Conze D, Weiss L, et al. Do T cells care about the mitogen-activated protein kinase signalling pathways? Immunol Cell Biol. 2000;78:166-175[CrossRef][Medline] [Order article via Infotrieve].
50.
Michie AM, Trop S, Wiest DL, Zúñiga-Pflücker JC.
Extracellular signal-regulated kinase (ERK) activation by the pre-T cell receptor in developing thymocytes in vivo.
J Exp Med.
1999;190:1647-1655
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. Xu, A. Sharma, M. Z. Hossain, D. L. Wiest, and J. M. Sen Sustained Expression of Pre-TCR Induced {beta}-Catenin in Post-{beta}-Selection Thymocytes Blocks T Cell Development J. Immunol., January 15, 2009; 182(2): 759 - 765. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Baron, D. Gauchat, R. La Motte-Mohs, N. Kettaf, A. Abdallah, T. Michiels, J.-C. Zuniga-Pflucker, and R.-P. Sekaly TLR Ligand-Induced Type I IFNs Affect Thymopoiesis J. Immunol., June 1, 2008; 180(11): 7134 - 7146. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Dimayuga, H. Li, K.-Y. Chyu, G. N. Fredrikson, J. Nilsson, M. C. Fishbein, P. K. Shah, and B. Cercek T Cell Modulation of Intimal Thickening After Vascular Injury: The Bimodal Role of IFN-{gamma} in Immune Deficiency Arterioscler. Thromb. Vasc. Biol., December 1, 2005; 25(12): 2528 - 2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yu, B. Erman, J.-H. Park, L. Feigenbaum, and A. Singer IL-7 Receptor Signals Inhibit Expression of Transcription Factors TCF-1, LEF-1, and ROR{gamma}t: Impact on Thymocyte Development J. Exp. Med., September 20, 2004; 200(6): 797 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ilangumaran, S. Ramanathan, T. Ning, J. La Rose, B. Reinhart, P. Poussier, and R. Rottapel Suppressor of cytokine signaling 1 attenuates IL-15 receptor signaling in CD8+ thymocytes Blood, December 1, 2003; 102(12): 4115 - 4122. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ilangumaran, S. Ramanathan, J. La Rose, P. Poussier, and R. Rottapel Suppressor of Cytokine Signaling 1 Regulates IL-15 Receptor Signaling in CD8+CD44high Memory T Lymphocytes J. Immunol., September 1, 2003; 171(5): 2435 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Cornish, M. M. Chong, G. M. Davey, R. Darwiche, N. A. Nicola, D. J. Hilton, T. W. Kay, R. Starr, and W. S. Alexander Suppressor of Cytokine Signaling-1 Regulates Signaling in Response to Interleukin-2 and Other {gamma}c-dependent Cytokines in Peripheral T Cells J. Biol. Chem., June 13, 2003; 278(25): 22755 - 22761. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Galm, H. Yoshikawa, M. Esteller, R. Osieka, and J. G. Herman SOCS-1, a negative regulator of cytokine signaling, is frequently silenced by methylation in multiple myeloma Blood, April 1, 2003; 101(7): 2784 - 2788. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Cornish, G. M. Davey, D. Metcalf, J. F. Purton, J. E. Corbin, C. J. Greenhalgh, R. Darwiche, L. Wu, N. A. Nicola, D. I. Godfrey, et al. Suppressor of Cytokine Signaling-1 Has IFN-{gamma}-Independent Actions in T Cell Homeostasis J. Immunol., January 15, 2003; 170(2): 878 - 886. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Egwuagu, C.-R. Yu, M. Zhang, R. M. Mahdi, S. J. Kim, and I. Gery Suppressors of Cytokine Signaling Proteins Are Differentially Expressed in Th1 and Th2 Cells: Implications for Th Cell Lineage Commitment and Maintenance J. Immunol., April 1, 2002; 168(7): 3181 - 3187. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||