| |
|
|
|
|
|
|
|||
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Department of Pathology, State University of
New York at Stony Brook, Stony Brook, NY, and the Department of
Vascular Biology, The Scripps Research Institute, La Jolla, CA.
The contribution of specific type I collagen remodeling in
angiogenesis was studied in vivo using a quantitative chick embryo assay that measures new blood vessel growth into well-defined fibrillar
collagen implants. In response to a combination of basic fibroblast
growth factor (bFGF) and vascular endothelial growth factor (VEGF), a
strong angiogenic response was observed, coincident with invasion into
the collagen implants of activated fibroblasts, monocytes, heterophils,
and endothelial cells. The angiogenic effect was highly dependent on
matrix metalloproteinase (MMP) activity, because new vessel
growth was inhibited by both a synthetic MMP inhibitor, BB3103, and a
natural MMP inhibitor, TIMP-1. Multiple MMPs were detected in the
angiogenic tissue including MMP-2, MMP-13, MMP-16, and a recently
cloned MMP-9-like gelatinase. Using this assay system, wild-type
collagen was compared to a unique collagenase-resistant collagen (r/r),
with regard to the ability of the respective collagen implants to
support cell invasion and angiogenesis. It was found that
collagenase-resistant collagen constitutes a defective substratum for
angiogenesis. In implants made with r/r collagen there was a
substantial reduction in the number of endothelial cells and newly
formed vessels. The presence of the r/r collagen, however, did not
reduce the entry into the implants of other cell types, that is,
activated fibroblasts and leukocytes. These results indicate that
fibrillar collagen cleavage at collagenase-specific sites is a
rate-limiting event in growth factor-stimulated angiogenesis in vivo.
(Blood. 2001;97:2323-2332) Angiogenesis is the process by which the
preexisting vascular tree gives rise to new blood vessels. This process
is tightly regulated during development and occurs only under highly
specialized circumstances in the normal adult animal. Unregulated
angiogenesis may be a pivotal element of disease etiology, such as
during tumor growth and atherosclerosis.1,2 All forms of
angiogenesis, however, are thought to share certain basic features,
including migration and mitogenesis of endothelial cells, lumen
formation, connection of new vascular segments with the preexisting
circulation, and extensive remodeling of the extracellular matrix by
proteases. The detailed mechanisms by which proteolytic enzymes, such
as the matrix metalloproteinases (MMPs), mediate some of these events in vivo remain unclear.3,4 The MMPs constitute a large
family of zinc-dependent endopeptidases that have been strongly
implicated in both normal angiogenesis and tumor
vascularization.2,4 These enzymes are characteristically
regulated at multiple levels, including gene expression, spatial
localization, zymogen activation, and inhibition by the tissue
inhibitors of metalloproteinases (TIMPs).5
In vitro remodeling of extracellular matrices by cultured endothelial
cells has consistently been shown to rely on MMPs.4 However, it is unclear which aspects of cell culture models for angiogenesis may be directly extrapolated to the animal. In vivo studies also have found evidence for a role of MMPs not only during tumor angiogenesis6-10 but also under the more controlled
conditions of growth factor-induced angiogenesis. The MMP inhibitor,
TIMP-1, can induce avascular zones in the chick chorioallantoic
membrane (CAM)11 and can inhibit basic fibroblast growth
factor (bFGF)-stimulated corneal neovascularization.12
Both the synthetic MMP inhibitor BB-94 and TIMP-2 are able to block
vascularization of fibrin gels in response to growth factors in
vivo.13 Genetic experiments to address the roles
of individual MMPs during angiogenesis in vivo suggest that certain
MMPs are involved in the angiogenic process, depending on the biologic
context.14-16 However, the detailed mechanisms by which
angiogenesis is blocked through inhibition of MMP activity by chemical
or genetic techniques have not been elucidated. It is also unclear
which substrates are the relevant targets of these enzymes in vivo.
Type I collagen is the major constituent of the extracellular matrices
to which proliferating endothelial cells are exposed in an injured
tissue.17 Furthermore, endothelial cells in vitro proliferate preferentially on a substratum of interstitial collagen, compared to basement membrane collagen.18 Although
collagen proteolysis has been characterized extensively under various
biochemical conditions, the steps in collagen catabolism during
angiogenesis in vivo have not been clearly delineated. Following
recognition and cleavage between Gly775 and
Ile/Leu776 by interstitial
collagenase,19 the resultant three-quarter length and
one-quarter length fragments of type I collagen exhibit decreased
stability of the triple helix, permitting further degradation by the
gelatinases.20 Wu and coworkers genetically engineered
collagen I to be completely resistant to collagenase by substituting
amino acids at and adjacent to the specific cleavage site21
and subsequently produced transgenic mice expressing only the
collagenase-resistant collagen The goal of the studies described herein was to establish a
quantitative in vivo model of angiogenesis and then to use it to
investigate not only the MMP-mediated collagenolytic activities in the
model but also the role of the major substrates of these enzymes. The
chick embryo CAM has been widely used for the study of angiogenesis
because it provides a means of examining neovascularization in vivo
while still allowing for a high level of control and ease of
manipulation.23 Most CAM assays, however, rely on
subjective scoring procedures and may not distinguish clearly between
preexisting blood vessels and those that arise following an angiogenic
stimulus.24 To circumvent these problems, Nguyen and
colleagues developed a system for monitoring blood vessel growth that
uses a fibrillar collagen implant and allows direct quantitation only
of new blood vessels.25 After modifying this system for a
more robust angiogenic response, we established the importance of MMP
activity in the model by using both synthetic and natural MMP
inhibitors. Experiments designed to alter the extracellular matrix
substratum by using the collagenase-resistant, mutant collagen,
revealed that the initial putative cleavage of interstitial collagen at
the Gly775/Ile776 locus is required for
the full angiogenic effect of growth factors. We propose that the
mechanism of MMP inhibitor-mediated effects on angiogenesis is at
least in part through inhibition of highly specific collagenolytic activity.
Chicken embryo culture
CAM angiogenesis assay
Briefly, pure type I collagen (Vitrogen) at 3.1 to 3.3 mg/mL (8 parts)
was neutralized with 10 × phosphate-buffered saline (PBS; 1 part) and
0.1 N NaOH (1 part). For some experiments, pepsinized dermal collagens
derived from wild-type (WT) or homozygous mutant collagenase-resistant
(r/r) mice (a gift of Dr Stephen M. Krane)22 were
substituted for Vitrogen. Hepes solution (1 M) was added to 20 mM final
concentration to the neutralized collagen solutions to ensure stable pH
7.4. Two parts neutralized collagen solution were then combined with
sterile PBS solutions (1 part) containing bovine serum albumin (BSA;
final concentration, 1 mg/mL) as a carrier protein, with or without
bFGF (Fiblast, final concentration 16.7 µg/mL), a gift from Dr Judith
Abraham (Scios, Sunnyvale, CA) and VEGF (Peprotech; final
concentration 5 µg/mL). For some experiments the soluble
hydroxamate MMP inhibitor, BB3103 (British Biotech, Oxford, United
Kingdom), was also incorporated into the collagen gels at 1.4 µg/implant (final concentration, 100 µM) with subsequent doses of
0.24 µg/implant added topically on days 11 and 12. Recombinant
C-terminally truncated TIMP-1 (N-TIMP-1), a gift from Dr Steven R. Van
Doren (University of Missouri, Columbia, MO),27 was
incorporated at 1.8 µg/implant, with subsequent doses of 1.8 µg/implant given topically as above.
Thirty microliters of the final collagen/growth factor solution with or
without experimental compounds was then pipetted atop 2 layers of
sterile nylon mesh (lower layer, 4 × 4 mm; upper layer, 2 × 2 mm;
Tetko, Kansas City, MO). These collagen/mesh rafts (referred to
hereafter as implants) were then placed at 37.5°C for 1.5 hours to
allow for collagen polymerization into fibrils.
Using jeweler's forceps, the fibrillar collagen implants were placed
on the CAM of a day 10 chick embryo (Figure 1A,B). Four implants were
placed on each CAM with at least one control (no addition) and one
growth factor-containing implant per embryo. Embryos were removed from
the incubator on day 13 and viewed through a stereomicroscope (Olympus,
Melville, NY); distinct blood vessels appearing in the collagen
matrix at or above the plane of the top mesh were identified (Figure
1C,D). Each box in the top mesh grid was scored for the presence or
absence of vessels to give a proportion of positive boxes/total boxes
counted (referred to as the angiogenesis score).
Immunofluorescent staining of tissue sections
Reverse transcription-polymerase chain reaction Collagen implants were dissected from the CAM and snap-frozen in liquid nitrogen. Total RNA was purified from the implants using a Total RNA Isolation Kit (Invitrogen, Carlsbad, CA). Total RNA (1 µg) was reverse transcribed to first-strand complementary DNA (cDNA) in 20 µL 0.01 M Tris-HCl (pH 8.4), 0.05 M KCl, 5 mM MgCl2, 1 mM dNTP, 0.01 M DTT, 25 µM random hexamer primers, and 10 U/µL Superscript II reverse transcriptase (Life Technologies, Grand Island, NY). The reactions were incubated at 42°C for 50 minutes. After cDNA synthesis, the polymerase chain reaction (PCR) was carried out by the following program: incubation at 94°C for 5 minutes, followed by 35 cycles of 30 seconds at 94°C for denaturation, 30 seconds at 50°C for annealing, and 30 seconds at 72°C for elongation. To produce specific PCR product for chicken MT3-MMP (cMMP-16)30 and chicken MMP-13 (cMMP-13),31 specific primers were designed based on the reported sequences. For cMMP-16, the forward primer is 5' AGAATCACCCCAGGGAGCCTTTGT 3' (position 1572-1595 bp) and the reverse primer is 5' GATCTCACCCACTCTTGCATAGAGCGT 3' (position 1917-1944 bp). The PCR product is 375 bp. For cMMP-13, the forward primer is 5' GGTCAGATGATTCTAGAGGGT 3' (position 341-361 bp) and the reverse primer is 5' CAACTATGTCATAGCCATTCATAG 3' (position 787-810 bp). The PCR product is 469 bp. The PCR samples were analyzed by 2% agarose gel and visualized by ethidium bromide staining.Collagen digestion Lyophilized WT and homozygous mutant collagenase-resistant (r/r) collagens were resuspended in 0.5 N acetic acid and centrifuged to remove insoluble material. Purified TIMP-free chicken MMP-2 was isolated by gelatin-Sepharose chromatography as described previously.32 Triple-helical collagen cleavage assays were performed in calcium assay buffer (CAB), composed of 50 mM Tris (pH 7.5), 200 mM NaCl, 10 mM CaCl2, 0.05% Brij-35. Twenty micrograms WT or r/r mouse collagen was incubated for 18 hours at 24°C in the presence or absence of 0.5 µg purified chick MMP-2 or human MMP-1 (Chemicon, Temecula, CA), activated for 1 hour with 2 mM p-aminophenylmercuric acetate (APMA) at 37°C. For gelatin cleavage, WT or r/r collagens were heated to 60°C for 15 minutes for denaturation (gelatinization) prior to incubation with chick MMP-2 (0.05 µg). Gelatinolytic cleavage was performed at 37°C and reactions were stopped by addition of EDTA to 50 mM. Samples were analyzed by reducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by Coomassie staining.Statistical analysis The SPSS Base 9.0 (SPSS, Chicago, IL) was used for data analysis. The Wilcoxon signed-rank test was used for comparisons of embryo-matched angiogenesis scores between treatment conditions. Group means and SEs were used for graphical depiction of the data. For quantitation of total cellularity, microscopic images were analyzed using Metamorph software (Universal Imaging, Downingtown, PA). A Mann-Whitney U test for nonparametric data was used for statistical comparison of image analysis data of total cellularity.
Growth factor stimulation of blood vessel growth using a modified angiogenesis assay Angiogenesis assays were performed by modifying a technique25 in which a fibrillar type I collagen gel is cast around 2 layers of nylon mesh and implanted onto the CAM of chick embryos as described in "Materials and methods" (Figure 1A,B). This procedure, unlike other techniques using the CAM, unambiguously eliminates the interference of preexisting blood vessels, one of the major confounding variables in many studies of angiogenesis in vivo.24 A large number of new microvessels (5-40 µm in diameter) that actually can be viewed in the live embryo (Figure 1C,D) were very apparent in a growth factor-treated implant, compared to those treated with buffer alone. Underlying vessels, preexisting in the CAM before implantation, are barely visible and out of the plane of focus by a distance of more than 200 µm (open circles in Figure 1C,D). These preexisting vessels are not scored in this assay system but may be counted erroneously in the more commonly used CAM angiogenesis assays23,24 that do not require growth into a new plane of focus. The well-delineated neovessels (arrowheads in Figure 1D), which are easily scored within the grids of the nylon mesh, provide for quantitation in the assay.In initial experiments using the modified CAM assay, we found that a
significant angiogenic response occurred when bFGF alone (~4-fold
stimulation) was added to the collagen implants (Figure 2). Under similar conditions, the
original methodology yielded only a 2- to 2.5-fold stimulation with
bFGF added to the collagen implant.25 VEGF alone added to
the implant results in a 2-fold stimulation. However, maximal
angiogenesis (7- to 10-fold) occurs when bFGF is combined with VEGF
(Figure 2). The original description of this angiogenesis assay did not
report any utilization of combined growth factors.25 Thus,
the effect of the combined growth factors was significantly greater
than that of either one alone. These data are consistent with reports
of the synergistic, angiogenic effects of bFGF and VEGF in
vivo.33,34 We therefore chose to use a combination of bFGF
and VEGF in subsequent experiments.
An array of cell types, both endothelial and stromal, invade the collagen implants To examine new blood vessel growth in more detail, immunostaining of the collagen implants and underlying CAM tissue was carried out using an antibody to avian VEGF-R2, a specific endothelial cell and hemangioblast marker.29 In sections through samples harvested after only 24 hours on the CAM, neither positively staining, vessel-like structures nor isolated endothelial cells were observed within the implants (Figure 3A,B). A network of fine capillaries, the subectodermal vascular plexus, stained positively and was delineated just below the interface between the implant and the CAM (asterisks in Figure 3A,B). Deep in the CAM mesoderm, large vessels with a circumscribed lumen (lu) also stained positively. After 48 hours, the subectodermal plexus appeared distorted giving rise to the first endothelial sprouts entering the implants (arrows in Figure 3C,D). The sprouts appeared with greater frequency and in a more upward position vertically in the bFGF/VEGF-treated implants. By 66 hours, the time at which angiogenesis scores were measured, a substantial increase in the number of positively stained vessels was observed in the upper grid of the growth factor-treated implant (Figure 3E,F). It is clear from this time course that the visual scoring technique in the assay (Figure 1) accurately reflects a rapid and extensive infiltration of newly formed endothelium into fibrillar collagen in response to bFGF and VEGF.
To examine the overall cellular content of the vascularized collagen
implants, further histologic analysis was performed on cryosections
through the implants. In tissues stained with hematoxylin and eosin, we
observed extensive cellular invasion into the collagen implants, and an
array of nonendothelial cell types was consistently found (data not
shown). Abundant fibroblast-like cells, likely myofibroblasts, were
apparent, as indicated by labeling with an antibody to
Growth factor-induced vascularization of collagen implants depends on MMP activity Remodeling of interstitial matrix proteins, such as type I collagen, is thought to be important in many forms of angiogenesis and is mediated to a significant extent by members of the MMP family.4,36 Therefore, we wanted to determine if in vivo vascularization of the collagen implants requires metalloproteinase activity. We first tested a broadly acting, synthetic metalloproteinase inhibitor, BB-3103. Repeated doses (0.2-1.4 µg) of the inhibitor were given because in the shell-less embryo system, topical application of experimental compounds can be conducted with relative ease. Under these conditions, the addition of BB-3103 resulted in a large (> 65%) decrease in the amount of stimulated angiogenesis (Figure 5A). We also examined the effects of a natural MMP inhibitor, TIMP-1, as an alternative to the synthetic inhibitor. Collagen implants were treated with a recombinant C-terminally truncated form of TIMP-1 (N-TIMP-1) that retains MMP-inhibitory activity.27 In the presence of growth factors and N-TIMP-1, angiogenesis scores also were substantially (> 60%) reduced (Figure 5B). These results provide evidence that one or more MMPs are involved in the observed neovascularization.
Because CAM angiogenesis appears to depend in part on MMP activity, it
was of interest to determine which MMPs may contribute to the observed
requirement. Several approaches were used for the detection within
CAM/implant tissue of chicken MMPs, for which suitable species-specific
reagents are not widely available. Our laboratory had originally cloned
chicken MMP-237 and recombinant expression of this enzyme
allowed for the production of an antibody highly specific for chicken
MMP-2. Immunostaining of 66-hour CAM tissue/implants with the
antichicken MMP-2 revealed that MMP-2 was indeed present in the
angiogenic tissue and was confined almost exclusively to the upper part
of the implant (Figure 6A). This predominance of signal in the upper region of the implant and near
absence in the lower CAM tissue is similar to the distribution of the
marker for myofibroblasts (Figure 4A). However, the anti-MMP-2 staining does not appear to be confined solely to a specific cell type,
but mostly appears pericellular, more associated with fibril-like structures of the collagen implant tissue (inset, Figure 6A). The
pattern of staining for MMP-2 appeared similar in implants that were
not treated with bFGF/VEGF (data not shown) and thus MMP-2 does not
appear specifically in the implants in response to angiogenic growth
factors.
Our laboratory has recently detected, cloned, and purified an MMP-9-like, 75-kd gelatinase.28 This chicken MMP was shown to be present only in bone marrow cells, some tissue monocytes, and most heterophils, the avian equivalent of PMNs. When a specific antibody to the enzyme was used to probe CAM/implant tissue, immunostaining was primarily associated with cells that possessed multilobed nuclei (Figure 6B). These heterophils appeared mainly in the upper portion of the implant and more sparsely throughout the entire CAM tissue. Some immunostaining for the 75-kd gelatinase also appeared extracellularly on fibril-like structures (Figure 6B, inset). In contrast to MMP-2, immunostaining for the 75-kd gelatinase does appear to be more intense in the bFGF/VEGF-treated implants and also does appear as early as 24 hours (data not shown). The specificity of the staining for the MMP-2 and the MMP-9-like gelatinase is demonstrated by the absence of stain following absorption of the respective antibody with purified enzymes (Figure 6C,D). Three other chicken MMP family members have been characterized and
cloned, namely, chicken MMP-13,31 MMP-16
(MT3-MMP),30 and MMP-22.38 Unfortunately, no
highly specific antibodies for these enzymes are yet available. To
determine if these MMPs are present in the angiogenic CAM tissue,
reverse transcription- polymerase chain reaction (RT-PCR) was
carried out on RNA isolated from 66-hour CAM implants. Enzyme-specific
primers were designed based on the reported sequences for the chicken
MMPs. The results demonstrate that the messenger RNA (mRNA) for both
chicken MMP-13 and MMP-16 are present in CAM tissue at the time of new
vessel scoring (Figure 7), whereas no PCR
signal was observed for chicken MMP-22 (data not shown). Furthermore,
the mRNA levels for both enzymes increase from 24 to 66 hours after
placement of the collagen implant, and bFGF/VEGF treatment also appears
to enhance the levels of the respective mRNAs (data not shown).
Collagenase-resistant collagen constitutes a defective substratum for angiogenesis in vivo To address the specific substrate preferences of the proteolytic activities required for growth factor-stimulated angiogenesis, a unique, genetically engineered variant of the type I collagen substrate was used. Collagen from homozygous mutant r/r mice contains (I)
chains bearing helix-stabilizing amino acid changes in the triple
helical cleavage site.22 We first asked whether the r/r collagen was resistant to MMP-2, previously shown to have interstitial collagenase activity.32 MMP-1 also was examined as the
prototypical interstitial collagenase. A collagen cleavage assay was
performed using triple-helical, native, dermal collagen (Figure
8A). At a temperature of 24°C,
treatment of WT collagen with either recombinant MMP-2 or recombinant
MMP-1 yielded the characteristic three-quarter length fragment (Figure
8A, lanes 2-3). The r/r collagen was resistant to cleavage by both
MMP-1 (lane 6) and MMP-2 (lane 5). These data not only verify that
the r/r collagen is collagenase resistant but affirm that MMP-2
can function as an interstitial collagenase and cannot cleave
r/r collagen.
To verify that the helix-stabilizing amino acid changes in the r/r collagen would not affect proteolysis at other sites within the collagen molecule, a gelatinase assay was performed using heat-denatured WT and r/r collagens (Figure 8B). Treatment of WT (lanes 1-5) and r/r (lanes 6-10) denatured collagen (gelatin) with MMP-2 at 37°C yielded a similar time course and a similar pattern of gelatin cleavage products. These data, demonstrating equal susceptibility of WT and r/r collagens to gelatinases, indicate that the specificity of the r/r mutant resides in its unique resistance only to interstitial collagenases. It was found previously that the melting point of the collagenase-resistant collagen also does not differ from WT.21 Furthermore, at the light microscopic level, the density and pattern of formed fibrils appeared identical. The 2 collagen variants were also indistinguishable at the ultrastructural level, indicating no difference in morphology of individual fibrils (data not shown). These data indicate that the collagenase-resistant mutant is otherwise identical to WT. Either collagenase-resistant type I collagen or the strain-matched WT
control was used to prepare implants for the angiogenesis assay.
Immunohistochemical analysis of these tissues, using antibodies to the
endothelial marker, von Willebrand factor, revealed numerous nascent
vessels in bFGF/VEGF-treated WT collagen implants (Figure 9A) but scant vessels in
bFGF/VEGF-treated collagenase-resistant implants (Figure 9B). Not only
were there fewer newly formed vessels in the r/r implants, but the
influx of cells labeling with the endothelial marker appeared to be
diminished throughout the r/r implants. We therefore decided to look at
the large set of embryos bearing WT or r/r implants. Relative to buffer
controls, WT mouse collagen stimulated with bFGF/VEGF was an effective
substratum for neovascularization (Figure 9C), yielding a mean score of
35% vessel-positive grids. However, significantly reduced levels of new blood vessel growth (19% vessel-positive grids) were observed in
collagenase-resistant collagen implants in response to stimulation by
growth factors. Background levels of vascularization in buffer-treated, r/r mutant implants were slightly reduced compared to WT, but this
effect was not statistically significant.
To examine whether the observed deficiency of angiogenesis in r/r
implants could be simply due to the inability of cells in general to
invade a noncleavable matrix, we performed a multicellular histologic
analysis of WT and collagenase-resistant implants that had been treated
with bFGF/VEGF (Figure 10). Although
endothelial staining in the implants was clearly decreased in the r/r
compared to WT (Figure 10A), this was not the case for other cell types examined. Similar numbers of heterophils, as indicated by staining for
the chicken 75-kd gelatinase (Figure 10C,D), myofibroblasts, as
indicated by staining for
Although a broad role has been established for the MMPs in angiogenesis, little direct evidence in vivo suggests that the cleavage of individual matrix components, such as collagen, is required during this process. Under experimental conditions in which a rapid, robust angiogenic effect was observed, we found that growth factor-induced vascularization was highly dependent on MMP activity. This dependence was indicated by the pronounced blockade of new vessel formation by both synthetic and natural inhibitors of MMPs. Several MMPs were detected in the implants and may contribute to the collagen remodeling that is required for angiogenesis. Furthermore, multiple cell types were identified in the newly vascularized collagen implants, raising the possibility that the MMPs necessary for blood vessel growth may derive from, or act through, a number of different nonendothelial cellular sources. Finally, our results suggests that cleavage at the specific triple-helical site of type I collagen must occur for the growth factor effect on blood vessel growth to be fully manifested. In the presence of a noncleavable collagen matrix, only endothelial cells, but not other cell types, were deficient in the implants. To our knowledge, growth factor-induced angiogenesis in vivo has not been shown previously to depend on such a specific matrix-remodeling event. Because a multiplicity of pathways is thought to contribute to proteolytic remodeling during angiogenesis, a highly controlled in vivo model system of angiogenesis may be best suited to address the mechanism by which MMP inhibitors block blood vessel growth. Despite the fact that the chick embryo has been widely applied for studies of angiogenic stimulators and inhibitors, only recently was an assay developed25 that provides a relatively fast, quantitative measure of new blood vessel growth and eliminates the interpretive difficulties of assessing stimulatory or inhibitory effects on the preexisting vasculature within the CAM. We modified this assay system, which involves type I collagen polymerized around nylon meshes that are implanted on the CAM. Importantly, this system ensures that only newly formed blood vessels are quantitated, because the vessels are microscopically focused and scored only if they appear in the upper nylon mesh, a distance of 200 to 500 µm above the plane of the CAM with its dense, underlying network of preexisting vessels. A histologic study of the engrafted collagen implants revealed that multiple cell types, in addition to endothelial cells, invaded the collagen during the incubation on the CAM. Perhaps not surprisingly, the cell types that were found have been previously implicated in angiogenesis in other contexts. A large number of myofibroblasts were observed; these represent the activated, contractile mesenchymal cells that are characteristic of dynamic tissues that are undergoing active remodeling.39 This population of cells may be important to the angiogenic milieu of the collagen implants because fibroblastic cells have been shown to be important sources of VEGF in angiogenic tissues in vivo.40 Two other cells types, macrophages and PMNs, both known to be intimately involved in angiogenesis, in part, through growth factor secretion,41,42 were also constituents of the collagen implants. It is not clear whether these cells appear coincident to the endothelial cells or whether they are major mediators of the angiogenesis we observe. Because a specific MMP activity (ie, cleavage of native collagen) appears to be necessary for angiogenesis, these infiltrating cells also may contribute to the enzymic content of angiogenic tissues, as macrophages, PMNs, and activated fibroblasts are well known producers of MMPs.43,44 A requirement for MMP activity in the induction of angiogenesis by bFGF and VEGF was demonstrated using 2 different types of MMP inhibitors: a synthetic, hydroxamate-based compound (BB3103) and TIMP-1, a natural MMP inhibitor. Based on the fact that both reagents are distinct but highly effective inhibitors of MMP activity27,45 and that natural inhibitors like the TIMPs have no known toxic or side effects, the most logical explanation for their similar inhibitory effects on angiogenesis is that they block MMP-mediated proteolysis. However, because BB-3103 and TIMP-1 can both block a broad range of MMPs,45,46 we cannot directly predict from these data which specific enzymes are the relevant targets in the observed inhibition of blood vessel growth. Selective inhibitors of individual MMPs are not yet available. Of note, we have detected in the implants both chicken MMP-2 and a chicken MMP-9-like enzyme that is associated with PMNs and at least 2 other MMPs, chicken MMP-13 and MMP-16. At least 3 of these 4 MMPs are candidates for the interstitial collagenolytic activity manifested in our angiogenesis system. We will be attempting to raise neutralizing (anticatalytic) antibodies specific to each of these enzymes, to test directly their functional role in angiogenesis. This will help circumvent the aforementioned lack of natural and synthetic MMP inhibitors that exclusively target individual MMPs. An alternative approach to examining the role of MMP-mediated proteolysis in angiogenesis is to manipulate the enzyme substrate, as opposed to using enzyme inhibitors. Based on the substantial in vitro data in support of an important role for interstitial collagen in angiogenesis,47 we felt that type I collagen was an ideal candidate substrate to examine in vivo. Furthermore, a unique reagent, collagenase-resistant type I collagen, has been created and characterized22 that provides a means of testing whether the first cleavage in the extracellular degradation of type I collagen is essential for angiogenesis. Our results demonstrate that the full angiogenic effect cannot be manifested if this first proteolytic step is prevented. The reduced vascularization of the implants composed of noncleavable collagen raises a number of provocative questions relating to the function of the triple-helical cleavage reaction and the more general dependence of angiogenesis on MMP activity. First, it remains an important issue whether "path clearing" is a major function of proteolysis during cell invasion in vivo.3 We did not observe a general decrease in total cellularity, however, between WT and r/r implants treated with growth factors (Figure 10). This suggests that cell invasion is not globally impaired by the presence of noncleavable collagen. Endothelial cells, however, were significantly reduced in r/r implants. Different cell types may exhibit varied proteolytic requirements for movement through extracellular matrix; keratinocytes, for example, have been shown to require the triple-helical cleavage for migration in vitro on a type I collagen matrix.48 Specific alterations to the extracellular matrix, such as the proteolytic cleavage of type I collagen and its subsequent unfolding, may also modulate both diffusible and matrix-associated cues to the invading endothelial cells and perhaps the supporting cell types. Evidence has been found that fragments of type I collagen are chemotactic for some of the cell types we identified.49,50 The r/r collagen may generate only reduced levels of such fragments. The macromolecular structure of the collagen matrix may be crucial for delivering an orchestrated series of cues to cells, through direct activation of receptor tyrosine kinases51,52 and through integrin-mediated attachment and signaling.53-56 In fact, the presence of intact, fibrillar collagen versus denatured collagen significantly affects both of these pathways.51,52,57 Therefore, balanced proteolysis of collagen may be of critical importance during cell invasion and vascular morphogenesis and may involve sequential attachment and loosening of matrix contacts in a directional manner,48 with appropriate signals being generated at each step. The r/r collagen would not undergo such balanced proteolysis. Although basement membrane degradation has been postulated as a major function of MMPs during angiogenesis in vivo,36 our results suggests that specific proteolysis of interstitial collagen may also be a rate-limiting step. Future studies to address the role of MMPs in angiogenesis may be well served by accounting quantitatively not only for the enzyme but also the substrate. Such a complementary approach may yield more precise targets in the development of antiangiogenic agents.
We thank Drs Stephen M. Krane and Michael H. Byrne (Massachusetts General Hospital) for generously providing mouse collagens, Dr Steven R. Van Doren (University of Missouri) for N-TIMP-1, Dr Judith Abraham (Scios) for bFGF, and Dr Anne Eichmann (CNRS) for antibody 5H6. We also thank Wen-Hui Feng (UMIC, SUNY at Stony Brook) for her superb cryostat work.
Submitted May 30, 2000; accepted December 12, 2000.
Supported by National Institutes of Health Grant CA55852 and HL31950 (J.P.Q.), training grants T32-HL07195 (R.T.A.) and T32-HL07695 (D.Z.). The work also represents part of the doctoral thesis dissertation of M.S. conducted under the Molecular and Cellular Biology Graduate Program of SUNY at Stony Brook.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: James P. Quigley, Department of Vascular Biology, The Scripps Research Institute, 10550 N Torrey Pines Rd/VB1, La Jolla, CA 92037; e-mail: jquigley{at}scripps.edu.
1.
Folkman J.
Seminars in Medicine of the Beth Israel Hospital, Boston. Clinical applications of research on angiogenesis.
N Engl J Med.
1995;333:1757-1763 2. Zetter BR. Angiogenesis and tumor metastasis. Annu Rev Med. 1998;49:407-424[CrossRef][Medline] [Order article via Infotrieve]. 3. Murphy G, Gavrilovic J. Proteolysis and cell migration: creating a path? Curr Opin Cell Biol. 1999;11:614-621[CrossRef][Medline] [Order article via Infotrieve]. 4. Stetler-Stevenson WG. Matrix metalloproteinases in angiogenesis: a moving target for therapeutic intervention. J Clin Invest. 1999;103:1237-1241[Medline] [Order article via Infotrieve].
5.
Nagase H, Woessner JFJ.
Matrix metalloproteinases.
J Biol Chem.
1999;274:21491-21494
6.
Bergers G, Javaherian K, Lo KM, Folkman J, Hanahan D.
Effects of angiogenesis inhibitors on multistage carcinogenesis in mice.
Science.
1999;284:808-812 7. Koivunen E, Arap W, Valtanen H, et al. Tumor targeting with a selective gelatinase inhibitor. Nat Biotechnol. 1999;17:768-774[CrossRef][Medline] [Order article via Infotrieve].
8.
Lozonschi L, Sunamura M, Kobari M, Egawa S, Ding L, Matsuno S.
Controlling tumor angiogenesis and metastasis of C26 murine colon adenocarcinoma by a new matrix metalloproteinase inhibitor, KB-R7785, in two tumor models.
Cancer Res.
1999;59:1252-1258 9. Valente P, Fassina G, Melchiori A, et al. TIMP-2 over-expression reduces invasion and angiogenesis and protects B16F10 melanoma cells from apoptosis [published erratum appears in Int J Cancer 1999;80:485]. Int J Cancer. 1998;75:246-253[CrossRef][Medline] [Order article via Infotrieve]. 10. Wylie S, MacDonald IC, Varghese HJ, et al. The matrix metalloproteinase inhibitor batimastat inhibits angiogenesis in liver metastases of B16F1 melanoma cells. Clin Exp Metastasis. 1999;17:111-117[CrossRef][Medline] [Order article via Infotrieve].
11.
Moses MA, Sudhalter J, Langer R.
Identification of an inhibitor of neovascularization from cartilage.
Science.
1990;248:1408-1410 12. Johnson MD, Kim HR, Chesler L, Tsao-Wu G, Bouck N, Polverini PJ. Inhibition of angiogenesis by tissue inhibitor of metalloproteinase. J Cell Physiol. 1994;160:194-202[CrossRef][Medline] [Order article via Infotrieve]. 13. Hiraoka N, Allen E, Apel IJ, Gyetko MR, Weiss SJ. Matrix metalloproteinases regulate neovascularization by acting as pericellular fibrinolysins. Cell. 1998;95:365-377[CrossRef][Medline] [Order article via Infotrieve].
14.
Itoh T, Tanioka M, Yoshida H, Yoshioka T, Nishimoto H, Itohara S.
Reduced angiogenesis and tumor progression in gelatinase A-deficient mice.
Cancer Res.
1998;58:1048-1051 15. Holmbeck K, Bianco P, Caterina J, et al. MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell. 1999;99:81-92[CrossRef][Medline] [Order article via Infotrieve]. 16. Vu TH, Shipley JM, Bergers G, et al. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell. 1998;93:411-422[CrossRef][Medline] [Order article via Infotrieve]. 17. Madri JA, Pratt BM, Yannariello-Brown J. Endothelial cell-extracellular matrix interactions: matrix as a modulator of cell function. In: Simionescu N,Simionescu M, eds. Endothelial Cell Biology in Health and Disease. New York: Plenum Press; 1988:167-188.
18.
Madri JA, Williams SK.
Capillary endothelial cell cultures: phenotypic modulation by matrix components.
J Cell Biol.
1983;97:153-165 19. Jeffrey JJ. Interstitial collagenases. In: Mecham RP,Parks WC, eds. Matrix Metalloproteinases. San Diego, CA: Academic Press; 1998:15-42.
20.
Birkedal-Hansen H, Moore WG, Bodden MK, et al.
Matrix metalloproteinases: a review.
Crit Rev Oral Biol Med.
1993;4:197-250
21.
Wu H, Byrne MH, Stacey A, et al.
Generation of collagenase-resistant collagen by site-directed mutagenesis of murine pro alpha 1(I) collagen gene.
Proc Natl Acad Sci U S A.
1990;87:5888-5892
22.
Liu X, Wu H, Byrne M, Jeffrey J, Krane S, Jaenisch R.
A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling.
J Cell Biol.
1995;130:227-237
23.
Auerbach R, Auerbach W, Polakowski I.
Assays for angiogenesis 24. Jain RK, Schlenger K, Hockel M, Yuan F. Quantitative angiogenesis assays: progress and problems. Nat Med. 1997;3:1203-1208[CrossRef][Medline] [Order article via Infotrieve]. 25. Nguyen M, Shing Y, Folkman J. Quantitation of angiogenesis and antiangiogenesis in the chick embryo chorioallantoic membrane. Microvasc Res. 1994;47:31-40[CrossRef][Medline] [Order article via Infotrieve]. 26. Scott PS, Vrba LK, Wilks JW. A simple vessel for the culture of chicken embryos used in angiogenesis assays. Microvasc Res. 1993;45:324-327[CrossRef][Medline] [Order article via Infotrieve]. 27. Huang W, Suzuki K, Nagase H, Arumugam S, Van DS, Brew K. Folding and characterization of the amino-terminal domain of human tissue inhibitor of metalloproteinases-1 (TIMP-1) expressed at high yield in E. coli. FEBS Lett. 1996;384:155-161[CrossRef][Medline] [Order article via Infotrieve].
28.
Hahn-Dantona EA, Aimes RT, Quigley JP.
The isolation, characterization and molecular cloning of a 75 kDa gelatinase B-like enzyme, a member of the matrix metalloproteinase family.
J Biol Chem.
2000;275:40827-40838
29.
Eichmann A, Corbel C, Nataf V, Vaigot P, Breant C, Le Douarin NM.
Ligand-dependent development of the endothelial and hemopoietic lineages from embryonic mesodermal cells expressing vascular endothelial growth factor receptor 2.
Proc Natl Acad Sci U S A.
1997;94:5141-5146
30.
Yang M, Hayashi K, Hayashi M, Fujii JT, Kurkinen M.
Cloning and developmental expression of a membrane-type matrix metalloproteinase from chicken.
J Biol Chem.
1996;271:25548-25554
31.
Lei H, Furth EE, Kalluri R, et al.
Induction of matrix metalloproteinases and collagenolysis in chick embryonic membranes before hatching.
Biol Reprod.
1999;60:183-189
32.
Aimes RT, Quigley JP.
Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific 3/4- and 1/4-length fragments.
J Biol Chem.
1995;270:5872-5876 33. Asahara T, Bauters C, Zheng LP, et al. Synergistic effect of vascular endothelial growth factor and basic fibroblast growth factor on angiogenesis in vivo. Circulation. 1995;92:11365-11371. 34. Goto F, Goto K, Weindel K, Folkman J. Synergistic effects of vascular endothelial growth factor and basic fibroblast growth factor on the proliferation and cord formation of bovine capillary endothelial cells within collagen gels [see comments]. Lab Invest. 1993;69:508-517[Medline] [Order article via Infotrieve]. 35. Jeurissen SH, Janse EM, Koch G, de Boer GF. The monoclonal antibody CVI-ChNL-68.1 recognizes cells of the monocyte-macrophage lineage in chickens. Dev Comp Immunol. 1988;12:855-864[CrossRef][Medline] [Order article via Infotrieve]. 36. Mignatti P, Rifkin DB. Plasminogen activators and matrix metalloproteinases in angiogenesis. Enzyme Protein. 1996;49:117-137[Medline] [Order article via Infotrieve]. 37. Aimes RT, French DL, Quigley JP. Cloning of a 72 kDa matrix metalloproteinase (gelatinase) from chicken embryo fibroblasts using gene family PCR: expression of the gelatinase increases upon malignant transformation. Biochem J. 1994;300:729-736.
38.
Yang M, Kurkinen M.
Cloning and characterization of a novel matrix metalloproteinase (MMP), CMMP, from chicken embryo fibroblasts. CMMP, Xenopus XMMP, and human MMP19 have a conserved unique cysteine in the catalytic domain.
J Biol Chem.
1998;273:17893-17900 39. Sappino AP, Schurch W, Gabbiani G. Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations. Lab Invest. 1990;63:144-161[Medline] [Order article via Infotrieve]. 40. Fukumura D, Xavier R, Sugiura T, et al. Tumor induction of VEGF promoter activity in stromal cells. Cell. 1998;94:715-725[CrossRef][Medline] [Order article via Infotrieve]. 41. Polverini PJ. Role of the macrophage in angiogenesis-dependent diseases. In: Goldberg ID,Rosen EM, eds. Regulation of Angiogenesis. Basel, Switzerland: Birkhause Verlag; 1997:11-28.
42.
Gaudry M, Bregerie O, Andrieu V, El Benna J, Pocidalo MA, Hakim J.
Intracellular pool of vascular endothelial growth factor in human neutrophils.
Blood.
1997;90:4153-4161 43. Owen CA, Campbell EJ. The cell biology of leukocyte-mediated proteolysis. J Leukoc Biol. 1999;65:137-150[Abstract]. 44. Alexander DS, Aimes RT, Quigley JP. What structure and function of avian plasminogen activator and matrix metalloproteinase-2 reveal about their counterpart mammalian enzymes, their regulation and their role in tumor invasion. Enzyme Protein. 1996;49:38-58[Medline] [Order article via Infotrieve]. 45. Beckett RP, Davidson AH, Drummond AH, Huxley P, Whittaker M. Recent advances in matrix metalloproteinase inhibitor research. Drug Discovery Today. 1996;1:16-26. 46. Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP. Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol. 1997;74:111-122[Medline] [Order article via Infotrieve].
47.
Haas TL, Davis SJ, Madri JA.
Three-dimensional type I collagen lattices induce coordinate expression of matrix metalloproteinases MT1-MMP and MMP-2 in microvascular endothelial cells.
J Biol Chem.
1998;273:3604-3610
48.
Pilcher BK, Dumin JA, Sudbeck BD, Krane SM, Welgus HG, Parks WC.
The activity of collagenase-1 is required for keratinocyte migration on a type I collagen matrix.
J Cell Biol.
1997;137:1445-1457 49. Albini A, Adelmann-Grill BC. Collagenolytic cleavage products of collagen type I as chemoattractants for human dermal fibroblasts. Eur J Cell Biol. 1985;36:104-107[Medline] [Order article via Infotrieve]. 50. Malone JD, Richards M, Jeffrey JJ. Recruitment of peripheral mononuclear cells by mammalian collagenase digests of type I collagen. Matrix. 1991;11:289-295[Medline] [Order article via Infotrieve]. 51. Vogel W, Gish GD, Alves F, Pawson T. The discoidin domain receptor tyrosine kinases are activated by collagen. Mol Cell. 1997;1:13-23[CrossRef][Medline] [Order article via Infotrieve]. 52. Shrivastava A, Radziejewski C, Campbell E, et al. An orphan receptor tyrosine kinase family whose members serve as nonintegrin collagen receptors. Mol Cell. 1997;1:25-34[CrossRef][Medline] [Order article via Infotrieve].
53.
Elices MJ, Hemler ME.
The human integrin VLA-2 is a collagen receptor on some cells and a collagen/laminin receptor on others.
Proc Natl Acad Sci U S A.
1989;86:9906-9910
54.
Senger DR, Claffey KP, Benes JE, Perruzzi CA, Sergiou AP, Detmar M.
Angiogenesis promoted by vascular endothelial growth factor: regulation through alpha1beta1 and alpha2beta1 integrins.
Proc Natl Acad Sci U S A.
1997;94:13612-13617 55. Eliceiri BP, Cheresh DA. The role of alpha v integrins during angiogenesis. Mol Med. 1998;4:741-750[Medline] [Order article via Infotrieve]. 56. Gullberg D, Gehlsen KR, Turner DC, et al. Analysis of alpha 1 beta 1, alpha 2 beta 1 and alpha 3 beta 1 integrins in cell-collagen interactions: identification of conformation dependent alpha 1 beta 1 binding sites in collagen type I. EMBO J. 1992;11:3865-3873[Medline] [Order article via Infotrieve]. 57. Davis GE. Affinity of integrins for damaged extracellular matrix: alpha v beta 3 binds to denatured collagen type I through RGD sites. Biochem Biophys Res Commun. 1992;182:1025-1031[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
V. C. Ardi, P. E. Van den Steen, G. Opdenakker, B. Schweighofer, E. I. Deryugina, and J. P. Quigley Neutrophil MMP-9 Proenzyme, Unencumbered by TIMP-1, Undergoes Efficient Activation in Vivo and Catalytically Induces Angiogenesis via a Basic Fibroblast Growth Factor (FGF-2)/FGFR-2 Pathway J. Biol. Chem., September 18, 2009; 284(38): 25854 - 25866. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. C. Ardi, T. A. Kupriyanova, E. I. Deryugina, and J. P. Quigley Human neutrophils uniquely release TIMP-free MMP-9 to provide a potent catalytic stimulator of angiogenesis PNAS, December 18, 2007; 104(51): 20262 - 20267. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Krishnan, J. B. Hoying, H. Nguyen, H. Song, and J. A. Weiss Interaction of angiogenic microvessels with the extracellular matrix Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3650 - H3658. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Yana, H. Sagara, S. Takaki, K. Takatsu, K. Nakamura, K. Nakao, M. Katsuki, S.-i. Taniguchi, T. Aoki, H. Sato, et al. Crosstalk between neovessels and mural cells directs the site-specific expression of MT1-MMP to endothelial tip cells J. Cell Sci., May 1, 2007; 120(9): 1607 - 1614. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Licht, O. T. Pein, L. Florin, B. Hartenstein, H. Reuter, B. Arnold, P. Lichter, P. Angel, and M. Schorpp-Kistner JunB is required for endothelial cell morphogenesis by regulating core-binding factor {beta} J. Cell Biol., December 18, 2006; 175(6): 981 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chan, J. K. Burgess, J. C. Ratoff, B. J. O'Connor, A. Greenough, T. H. Lee, and S. J. Hirst Extracellular Matrix Regulates Enhanced Eotaxin Expression in Asthmatic Airway Smooth Muscle Cells Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 379 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Varon, F. Tatin, V. Moreau, E. Van Obberghen-Schilling, S. Fernandez-Sauze, E. Reuzeau, I. Kramer, and E. Genot Transforming Growth Factor {beta} Induces Rosettes of Podosomes in Primary Aortic Endothelial Cells. Mol. Cell. Biol., May 1, 2006; 26(9): 3582 - 3594. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mitola, B. Brenchio, M. Piccinini, L. Tertoolen, L. Zammataro, G. Breier, M. T. Rinaudo, J. den Hertog, M. Arese, and F. Bussolino Type I Collagen Limits VEGFR-2 Signaling by a SHP2 Protein-Tyrosine Phosphatase-Dependent Mechanism 1 Circ. Res., January 6, 2006; 98(1): 45 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zijlstra, M. Seandel, T. A. Kupriyanova, J. J. Partridge, M. A. Madsen, E. A. Hahn-Dantona, J. P. Quigley, and E. I. Deryugina Proangiogenic role of neutrophil-like inflammatory heterophils during neovascularization induced by growth factors and human tumor cells Blood, January 1, 2006; 107(1): 317 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-O Deguchi, E. Aikawa, P. Libby, J. R. Vachon, M. Inada, S. M. Krane, P. Whittaker, and M. Aikawa Matrix Metalloproteinase-13/Collagenase-3 Deletion Promotes Collagen Accumulation and Organization in Mouse Atherosclerotic Plaques Circulation, October 25, 2005; 112(17): 2708 - 2715. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Peng, D. Lai, T. T.-B. Nguyen, V. Chan, T. Matsuda, and S. J. Hirst Multiple {beta}1 Integrins Mediate Enhancement of Human Airway Smooth Muscle Cytokine Secretion by Fibronectin and Type I Collagen J. Immunol., February 15, 2005; 174(4): 2258 - 2264. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T.-B. Nguyen, J. P. T. Ward, and S. J. Hirst {beta}1-Integrins Mediate Enhancement of Airway Smooth Muscle Proliferation by Collagen and Fibronectin Am. J. Respir. Crit. Care Med., February 1, 2005; 171(3): 217 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, Y. Wang, Z. Chen, M. D. Sternlicht, M. Hidalgo, and B. Steffensen Matrix Metalloproteinase-2 Contributes to Cancer Cell Migration on Collagen Cancer Res., January 1, 2005; 65(1): 130 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inada, Y. Wang, M. H. Byrne, M. U. Rahman, C. Miyaura, C. Lopez-Otin, and S. M. Krane Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification PNAS, December 7, 2004; 101(49): 17192 - 17197. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-H. Chun, F. Sabeh, I. Ota, H. Murphy, K. T. McDonagh, K. Holmbeck, H. Birkedal-Hansen, E. D. Allen, and S. J. Weiss MT1-MMP-dependent neovessel formation within the confines of the three-dimensional extracellular matrix J. Cell Biol., November 22, 2004; 167(4): 757 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Blazquez, L. Gonzalez-Feria, L. Alvarez, A. Haro, M. L. Casanova, and M. Guzman Cannabinoids Inhibit the Vascular Endothelial Growth Factor Pathway in Gliomas Cancer Res., August 15, 2004; 64(16): 5617 - 5623. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zijlstra, R. T. Aimes, D. Zhu, K. Regazzoni, T. Kupriyanova, M. Seandel, E. I. Deryugina, and J. P. Quigley Collagenolysis-dependent Angiogenesis Mediated by Matrix Metalloproteinase-13 (Collagenase-3) J. Biol. Chem., June 25, 2004; 279(26): 27633 - 27645. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Sweeney, G. DiLullo, S. J. Slater, J. Martinez, R. V. Iozzo, J. L. Lauer-Fields, G. B. Fields, and J. D. S. Antonio Angiogenesis in Collagen I Requires {alpha}2{beta}1 Ligation of a GFP*GER Sequence and Possibly p38 MAPK Activation and Focal Adhesion Disassembly J. Biol. Chem., August 15, 2003; 278(33): 30516 - 30524. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tamarat, J.-S. Silvestre, M. Huijberts, J. Benessiano, T. G. Ebrahimian, M. Duriez, M.-P. Wautier, J. L. Wautier, and B. I. Levy Blockade of advanced glycation end-product formation restores ischemia-induced angiogenesis in diabetic mice PNAS, July 8, 2003; 100(14): 8555 - 8560. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zijlstra, R. Mellor, G. Panzarella, R. T. Aimes, J. D. Hooper, N. D. Marchenko, and J. P. Quigley A Quantitative Analysis of Rate-limiting Steps in the Metastatic Cascade Using Human-specific Real-Time Polymerase Chain Reaction Cancer Res., December 1, 2002; 62(23): 7083 - 7092. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Netzel-Arnett, D. J. Mitola, S. S. Yamada, K. Chrysovergis, K. Holmbeck, H. Birkedal-Hansen, and T. H. Bugge Collagen Dissolution by Keratinocytes Requires Cell Surface Plasminogen Activation and Matrix Metalloproteinase Activity J. Biol. Chem., November 15, 2002; 277(47): 45154 - 45161. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zaragoza, E. Soria, E. Lopez, D. Browning, M. Balbin, C. Lopez-Otin, and S. Lamas Activation of the Mitogen Activated Protein Kinase Extracellular Signal-Regulated Kinase 1 and 2 by the Nitric Oxide-cGMP-cGMP-Dependent Protein Kinase Axis Regulates the Expression of Matrix Metalloproteinase 13 in Vascular Endothelial Cells Mol. Pharmacol., October 1, 2002; 62(4): 927 - 935. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rivilis, M. Milkiewicz, P. Boyd, J. Goldstein, M. D. Brown, S. Egginton, F. M. Hansen, O. Hudlicka, and T. L. Haas Differential involvement of MMP-2 and VEGF during muscle stretch- versus shear stress-induced angiogenesis Am J Physiol Heart Circ Physiol, October 1, 2002; 283(4): H1430 - H1438. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.C. Weston, I. Haviv, and P.A.W. Rogers Microarray analysis of VEGF-responsive genes in myometrial endothelial cells Mol. Hum. Reprod., September 1, 2002; 8(9): 855 - 863. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Silvestre, Z. Mallat, R. Tamarat, M. Duriez, A. Tedgui, and B. I. Levy Regulation of Matrix Metalloproteinase Activity in Ischemic Tissue by Interleukin-10: Role in Ischemia-Induced Angiogenesis Circ. Res., August 3, 2001; 89(3): 259 - 264. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||