| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the LRF Centre for Adult Leukaemia, Department of
Haematology, Imperial College School of Medicine, Hammersmith Campus;
the Ludwig Institute for Cancer Research and Section of Virology and
Cell Biology, Imperial College School of Medicine, St Mary's Campus;
and the Department of Haematological Medicine, Guy's, King's and St
Thomas' School of Medicine and Dentistry, King's Denmark Hill Campus,
London, United Kingdom.
This study investigated the influence of expression of proteins of
the INK4 family, particularly p16, on the growth and self-renewal kinetics of hematopoietic cells. First, retrovirus-mediated gene transfer (RMGT) was used to restore p16INK4a
expression in the p16INK4a-deficient lymphoid and myeloid
cell lines BV173 and K562, and it was confirmed that this inhibited
their growth. Second, to sequester p16INK4a and related
INK4 proteins, cyclin-dependent kinase 4 (CDK4) was retrovirally
transduced into normal human CD34+ bone marrow cells and
then cultured in myeloid colony-forming cell (CFC) assays. The growth
of CDK4-transduced colonies was more rapid; the cell-doubling time was
reduced; and, upon replating, the colonies produced greater yields of
secondary colonies than mock-untransduced controls. Third, colony
formation was compared by marrow cells from
p16INK4a Deletion of the tumor-suppressor gene
p16INK4a has been implicated in tumorigenesis in
general1 and in leukemogenesis in
particular.2-5 It has been found in 25% to 60% of cases
of acute leukemia and 20% to 50% of cases of lymphoma.6
Although deletion of the p16INK4a gene is
uncommon in acute myeloid leukemia, messenger RNA expression is
frequently undetectable, possibly as a result of DNA hypermethylation or mutations in the p16INK4a promotor
region.7 These observations raise the possibility that
p16INK4a expression plays an important role in the
regulation of normal hematopoiesis. There is ample evidence that
restoration of p16INK4a into p16INK4a-deficient
leukemic cell lines reduces their proliferation rate in liquid
culture and some evidence that it suppresses their ability to
form colonies in semisolid culture,8,9 but the effects of
p16INK4a expression on primary normal hematopoietic cell
proliferation have not been examined. In particular, it is not known
whether p16INK4a has any effects on the kinetics of
progenitor cell renewal and differentiation. This is important because
transformation of leukemic target cells must be associated with an
increase in self-renewal probability above the steady-state value of
0.5 before the leukemic clone can expand, become established, and
eventually predominate over normal hematopoiesis.10-12
The p16INK4a protein is the prototypic member of the INK4
family (p15INK4b, p16INK4a,
p18INK4c, and p19INK4d) of cyclin-dependent
kinase inhibitors (CKIs) and is part of a regulatory pathway consisting
of p16INK4a, cyclin D, cyclin-dependent kinase (CDK) 4/6,
retinoblastoma protein (pRB), and E2F.13 This pathway (the
pRB pathway) regulates the transition from G1 to S phase of
the cell cycle. The formation of complexes between cyclin D and CDK4 is
inhibited by p16INK4a through binding to CDK4/6. The cyclin
D-CDK4/6 complex phosphorylates pRB, resulting in the release of
transcription factors so that the genes necessary for cell cycle
progression can be transcribed.14
The pRB family of pocket proteins consists of pRB itself and the
structurally related proteins p107 and p130. They are negative regulators of cell cycle progression, and overexpression of individual pocket proteins can cause growth arrest in G1 phase of the
cell cycle. The cyclin D/CDK4 or 6 kinase complexes have been shown to
be able to phosphorylate all 3 pocket proteins and overcome the cell
cycle arrest imposed by the enforced expression of individual pocket
proteins. The ability of the pRB family of proteins to induce cell
cycle arrest is largely related to their interactions with the
transcription factor E2F.14-17 Phosphorylation plays an important part in controlling the interaction of pRB-related
pocket proteins with E2F as well as their ability to repress
transcription directly. Hypophosphorylated forms of pocket proteins
bind to E2F and repress E2F-dependent trancriptional activity, thus
repressing the transcription of genes essential for DNA synthesis
and/or cell cycle progression, including E2F-1, p107, pRB, cyclin
A, and cyclin E.14-17 Therefore,
overexpression of p16INK4a can down-regulate CDK4/6
activity, culminating in hypophosphorylation of pRB-related proteins,
repression of E2F activity, and cell cycle arrest.
We have investigated the effect of p16INK4a on cell
proliferation and renewal by transducing p16INK4a into the
p16INK4a-deficient lymphoid and myeloid leukemia cell lines
BV173 and K562. We have also studied the role of p16INK4a
in normal hematopoiesis using CDK4-transduced normal human bone marrow
CD34+ cells and bone marrow from
p16INK4a knockout mice. The results are
consistent with the action of INK4 proteins as growth suppressors in
normal hematopoiesis since INK4 deletion and abrogation increase the
growth rate of hematopoietic cell colonies and the multiplication of
hematopoietic progenitor cells in vitro, and facilitate the emergence
of cell lines from primary hematopoietic progenitor cells.
Cell lines and cell culture
Primary cell isolation and culture
Wild-type mice and mice with homozygously deleted p16INK4a gene exon 2 were maintained in the Imperial College animal facility.21 At 6 weeks of age, mice were killed by cervical dislocation; the femurs were dissected out; and the marrow was flushed from the femoral cavity with 5 mL MEM alpha medium (Gibco BRL) into a sterile container. Retrovirus-mediated gene transfer Wild-type p16INK4a complementary DNA (cDNA) was cloned into a retroviral shuttle vector, pBN, and transfected into GP+E-86 by calcium phosphate precipitation. Supernatant from the GP+E-86 was used to infect GP+envAM12 with retroviral particles. Wild-type CDK4 cDNA22 was cloned into pBN and then transfected into GP+E-86 by calcium phosphate precipitation, and the supernatant was used to infect GP+envAM12.23A Transwell system (Costar, High Wycombe, United Kingdom) was used for retrovirus-mediated transfer into K562 cells and primary cells.23 This system allows target cells to be incubated with producer cells without cell-to-cell contact and contamination. Amphotropic producer cells were plated in 6-well plates (Costar) at 1 day before the target cells were placed in the Transwell insert. K562 target cells (1 × 105 cells per Transwell) were suspended in medium containing a final concentration of 4 µg/mL polybrene, exposed to the producer cells for two 3-day cycles of infection, and then selected in G418-containing medium for 2 weeks prior to further study. Human CD34+ target cells were placed in the Transwell insert in medium containing 50 ng/mL interleukin 3 (IL-3), 100 ng/mL stem cell factor, 10 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF) (all from First Link, Brierley Hill, United Kingdom), and 4 µg/mL protamine sulfate. The CD34+ cells were harvested from the Transwell inserts after 2-day exposure to the producer cells. The selection of the CD34+ cells is described under "Colony assays and evaluation" below. Growth rate of BV173 and K562 cells BV173 and K562 cells were cultured at an initial concentration of 2 × 104 cells per milliliter. The p16INK4a-transduced and empty vector-transduced cells, but not the parent cells, were cultured in the presence of G418. Cell concentrations were measured by hemocytometry at daily intervals.Western blotting After 107 cells were pelleted by centrifugation in Eppendorf tubes, the supernatant was removed, and the cells were lysed in 120 µL RIPA buffer (1% NP40, 0.5% sodium deoxycholate, 0.3M NaCl, and Complete protease inhibitor cocktail [Boehringer Mannheim, Germany]). The protein concentration of the lysate was determined by means of a MicroProtein Determination kit (Sigma, Poole, United Kingdom). We electrophoresed 80 µg protein in 5%, 10%, and 15% (vol/vol) polyacrylamide gels (29:1 acrylamide to bisacrylamide) (Bio-Rad Laboratories, Hemel Hempstead, United Kingdom) and then blotted it onto a nitrocellulose membrane (Hybond-N) (Amersham, Little Chalfont, United Kingdom). The membrane was stained with antibodies to p16INK4a (Becton Dickinson, United Kingdom), pRB, E2F-1, p107, p130, p15, and p18 (Santa Cruz Biotechnology, CA), and the protein signals were visualized by electrochemiluminescence (ECL kit) (Amersham).Colony assays and evaluation Colony assayMyeloid (granulocyte-macrophage) colony formation by primary cells was assayed by plating 1 × 105 mouse bone marrow cells per milliliter, or 1 × 103 CD34+ human cells per milliliter in methylcellulose (Methocult H423, Metachem Diagnostics, Northampton, United Kingdom). The murine cells were stimulated by 20% (vol/vol) WEHI-3B cell-conditioned medium, and the human cells were stimulated by recombinant cytokines (50 ng/mL stem cell factor, 1 ng/mL GM-CSF, 10 ng/mL IL-3, and 100 ng/mL granulocyte CSF, all from First Link). In the case of retrovirally transduced cells, 1.5 mg/mL G418 was added. This concentration reduces the survival of cells that do not express neomycin resistance (neor) to 1.55%.23 Triplicate cultures in 35-mm petri dishes were incubated at 37°C in humidified 5% CO2 in air. Transgene expression Following the transduction procedure, the number of colonies that grew in the presence of G418 was half the number that grew in the absence of G418. This implies a transduction efficiency of approximately 50%. Nested polymerase chain reaction (PCR) was used to confirm the presence of neor in colonies grown for 14 days in the presence of G418. Individual colonies were plucked, and PCR was performed by means of specifically designed primers (first-step primers: CAAGCGAAACATCGCA-TCGAGCGA and GAAGAACTCGTCAAGAAGGCGATA; second-step primers: ATGGAAGCCGGTCTTGTCGAT and GATACCGTAAAGCACGAGGAA). Of 125 colonies analyzed by PCR, 95% expressed neor.Video recording to measure colony growth rate Colony-culture dishes were removed from the incubator at intervals of 1 to 2 days and placed on a grid that was designed so that the dish could be located in precisely the same position and orientation on each occasion. Whole-culture plates were filmed by moving the cultures past a video camera mounted on an inverted microscope and attached to a domestic video recorder. The entire plate was recorded, irrespective of whether a colony was present. The recordings were reviewed retrospectively, and the positions of the colonies and the numbers of cells they contained transferred to a paper replica of the grid.24Colony replating for secondary colony formation On the seventh day of culture, 120 colonies of more than 50 cells were individually plucked and replated into 100 µL methylcellulose plus serum and cytokines in the wells of flat-based 96-well microtiter plates. G418 was added to secondary cultures of colonies grown from retrovirally transduced cells that had been exposed to G418 during the primary culture. The numbers of colonies in each well were scored 7 days after replating, and the percentage of positive wells and the total number of secondary colonies were calculated. In addition, the data were plotted as the cumulative distribution of numbers of secondary colonies per primary colony, and the area under the curve (AUC) was calculated by means of the trapezium rule.25The main reason for calculating the AUC is that the distribution of secondary colonies per primary colony is highly skewed so that median rather than mean values should be used. However, when fewer than 50% of the primary colonies form secondary colonies, the median will be zero and the result will be uninformative. Thus, the AUC is used to provide an overall measure of amplification of the colony-forming cells regardless of the replating efficiency of the particular population under investigation.26 Generation of cell lines from p16INK4a / mouse marrow and 50 from cultures of wild-type mouse marrow. Each colony was transferred to
100 µL of medium plus serum and WEHI-3B cell-conditioned medium in
separate wells of a round-bottomed 96-well microtiter plate. Of the
p16INK4a / colonies, 15 colonies (30%), but
none of the wild-type colonies, expanded in the liquid culture and were
individually transferred to 48-well plates, 24-well plates, and finally
to 75-cm2 tissue-culture flasks. We recloned the 15 cell
lines by plating them at 104 cells per milliliter in the
granulocyte-macrophage colony-forming unit (CFU-GM) assay and then
plucking 10 individual colonies from each for expansion. At random, 2 expanded colonies were selected from each cell line and maintained in
medium with serum and WEHI-3B cell-conditioned medium. The remainder
were discarded.
Growth-factor independence We selected 4 of the cell lines at random and tested them for growth-factor independence either by immediately transferring them to medium lacking WEHI-3B cell-conditioned medium or by reducing the concentration stepwise (20%, 10%, 7.5%, 5%, 2.5%, 0%) at 4-day intervals. Trypan blue-excluding cells were counted at 2-day intervals with a hemocytometer.Statistical analysis Nonparametric statistical analysis (Mann-Whitney U test) was performed with StatView SE+Graphics software for the Macintosh computer (Abacus Concepts, Berkeley, CA). AUCs were calculated with an Excel5 (Microsoft, Seattle, WA) spreadsheet on a Macintosh computer.
Restoration of p16INK4a expression inhibits proliferation by BV173 and K562 cells The CKI p16INK4a was reintroduced into the p16INK4a-deficient BV173 and K562 cell lines by infection with p16INK4a -expressing retrovirus. Following the 2-week selection period, transduced cells were maintained in selection medium, and the parent cell lines were cultured without selection. BV173 and K562 cells transduced with the empty vector proliferated with the same kinetics as the respective parent cell lines. Successful transduction of the empty vector into BV173 cells and K562 cells was confirmed by RT-PCR for the Neor gene, which was positive in all cases. Neor expression was not detected in untransduced K562 and BV173 cells. These results show that the transduction procedure per se had no effect on cell proliferation.BV173 cells transduced with p16INK4a failed to grow at all
in any of 4 separate experiments (data not shown). Similarly, in 3 of 4 experiments on K562 cells, p16INK4a-expressing cells failed
to grow. In the fourth experiment, the p16INK4a-transduced
cells exhibited a gradual increase in number but showed a considerably
reduced growth rate compared with the parent cells and empty
vector-transduced controls (Figure 1A).
These results confirmed that p16INK4a expression inhibits
or prevents cell growth. This slow growth provided the opportunity to
accumulate sufficient cells for further investigations. The expression
of p16INK4a was confirmed by Western blotting after 16 passages after selection (Figure 1B).
Previous studies have demonstrated that p16INK4a requires a functional pRB pathway to induce cell cycle arrest.27-30 Also, it has been shown that p16INK4a prevents CDK4/6 from forming complexes with cyclin D, thereby suppressing phosphorylation of the pRB family of proteins.31,32 To demonstrate that the p16INK4a/pRB pathway is intact in K562 cells and that it responds to expression of p16, we studied the expression of downstream targets of p16INK4a by Western blotting. The results (Figure 1B) show that p16INK4a expression in K562 cells reduced phosphorylation of pRB and p107 and reduced expression levels of the E2F-regulated genes E2F-1, p107, and p130. Although there is an unexplained decrease in expression of E2F-1 by the vector-only controls, there was a complete disappearance of E2F-1 from the p16-transduced cells. These findings are consistent with previous results showing that the growth-suppressive properties of p16INK4a are accomplished by maintaining the pRB-related pocket proteins in their hypophosphorylated states and repressing the transcription of E2F target genes. Transduction of CDK4 into human CD34+ cells increases colony growth rate and replating ability Figure 2A shows that expression of CDK4 in human CD34+ cells increases the growth rate of colonies in clonogenic assays. Moreover, their ability to form secondary colonies upon replating was also significantly enhanced (Figure 2B, Table 1) in terms of the percentage of colonies forming secondary colonies upon replating (2.4-fold), the total number of secondary colonies (8.2-fold), and the AUC (5.2-fold).
These results indicate that expression of p16INK4a
may exert growth-suppressive effects on normal human myeloid progenitor
cell growth. However, CDK4 sequesters p15INK4b,
p18INK4c, and p19INK4d, as well as
p16INK4a, all of which can potentially function as
tumor-suppressor genes. The Western blot analysis of CD34+
cell lysates in Figure 3 shows expression
of p15INK4b, p18INK4c, and
p19INK4d, as well as p16INK4a. Thus, although
the effects of CDK4 transduction can be attributed to sequestration of
INK4-family proteins, they cannot be specifically attributed to the
abrogation of p16INK4a.
Deletion of p16INK4a increases myeloid progenitor cell proliferation in gene knockout mice There was an obvious increase in colony growth rate and size in cultures of p16INK4a knockout marrow compared with cultures of wild-type marrow. The data in Figure 4A show that the numbers of cells per colony increase more rapidly in cultures of p16INK4a knockout marrow compared with wild-type cultures and indicate a reduction in cell-doubling time from 15 hours to 12 hours (P = .003). Cytospin preparations of 50 p16INK4a knockout marrow colonies and 50 wild-type marrow colonies were examined to evaluate cell morphology. All colonies consisted of cells of the myeloid and/or monocyte lineage. There were no major differences in the lineage representation or stage of cell differentiation in colonies grown from p16INK4a knockout marrow compared with wild-type colonies.
The results of replating the colonies into secondary cultures showed
that the enhanced colony growth rate was associated with increased
multiplication of clonogenic cells within the developing colonies
(Table 1, Figure 4B). Deletion of p16INK4a
resulted in significant increases in the percentage of colonies that
formed secondary colonies upon replating (1.6-fold), in the total
number of secondary colonies (5.4-fold), and in the magnitude of the
AUC (3.5-fold). Retrovirus-mediated gene transfer (RMGT)-mediated resoration of p16INK4a into bone marrow cells of
2 of p16INK4a P16INK4a gene deletion facilitates cell line propagation in vitro None of the wild-type colonies expanded sufficiently to produce cell lines, and all cells were dead within 2 weeks of plucking the colonies. After recloning, the 15 p16INK4a / cell lines showed a
higher colony-forming efficiency than the p16INK4a / primary bone marrow
cells. Almost all of the colonies (96.7%) produced secondary colonies
upon replating, and there was also an increase in the level of the AUC
(Table 1).
Figure 5A-B shows the results of
immediate and stepwise growth-factor deprivation. When growth factor
was immediately withdrawn from 4 cell lines, 2 of them died out
rapidly, but the other 2 survived for 2 weeks and then grew at the same
rate as the controls in WEHI-3B cell-conditioned medium (Figure 5A).
When growth factor was withdrawn from the same cell lines over a period
of 2 weeks, all of the cell lines survived and were able to grow
without WEHI-3B cell-conditioned medium at the same rate as the
controls (Figure 5B).
We have used 3 in vitro model systems to investigate the influence
of p16INK4a on hematopoietic progenitor cell proliferation.
There were consistent increases in the growth rates and sizes of
colonies grown from p16INK4a knockout mouse bone
marrow and from CDK4-transduced normal human CD34+ cells.
These observations are in line with the reduced growth rate of K562
cells in which p16INK4a expression had been restored. The
assays of colonies for their content of progenitor cells, by
replating them into secondary cultures, revealed that colonies of
normal cells from which p16INK4a/INK4 proteins had
been deleted or abrogated contained increased numbers of clonogenic
cells and that this increase was counteracted by RMGT of
p16INK4a into
p16INK4a We found that, in most cases, restoration of p16INK4a expression in p16INK4-deleted lymphoid (BV173) and myeloid (K562) cell lines completely repress cell proliferation, indicating that p16INK4a has a role in controlling proliferation in these hematopoietic cells. Interestingly, we found in one experiment that expression of p16INK4a in K562 cells did not completely suppress cell growth in spite of the fact that most if not all of the cells stained with anti-p16 fluorescein isothiocyanate (data not shown). This result indicates that the effects of p16INK4a may vary, possibly according to the levels of p16INK4a protein in the cells. It has been reported that p16INK4a can induce cell cycle arrest only in cells with an intact and functional pRB pathway.27-30 Consequently, it was important to confirm that changes in the expression of p16INK4a can induce hypophosphorylation of pRB-related pocket proteins and repression of E2F activity. The p16INK4a-transduced K562 cells had increased levels of the hypophosphorylated forms of pRB and p107 compared with untransduced cells and cells transduced with empty expression vector. This observation is consistent with previous reports showing that p16INK4a represses the activity of cyclin D-dependent kinases, which are responsible for the phosphorylation of all 3 of these pocket proteins.33-36 We also found that restoration of p16INK4a was associated with down-regulation of pRB, p107, and a component of the E2F transcription factor family (E2F-1). This is attributable to the fact that pRB, p107, and E2F-1 are E2F-regulated genes33-35 and are repressed by the accumulation of dephosphorylated forms of the pocket proteins. Overall, these results imply that the pRB pathway in K562 cells is intact and that it responds to overexpression of p16INK4a. However, these cell line models cannot be used to evaluate changes in progenitor cell renewal and differentiation and do not provide information about the function of p16INK4a in untransformed primary cells. To characterize further the functional role of p16INK4a or related INK4 family proteins, we investigated the effects of sequestering p16INK4a/INK4-family proteins in primary human CD34+ cells. In the primary human CFU-GM model, we used CDK4 to sequester
p16INK4a and mimic the inactivation of
p16INK4a.30 This interaction between CDK4 and
p16INK4a occurs pathologically in glioma.22
CDK4 amplification has been shown to be an alternative to
p16INK4a homozygous gene deletion in glioma cell
lines and may be experimentally mimicked in vitro by
retrovirus-mediated transduction of CDK4.30 However,
overexpression of CDK4 eliminates all INK4 family members, and
p15INK4b, p18INK4c, and p16INK4d
can potentially function as tumor-suppressor genes. As confirmation in
other studies,37-39 we found that normal human
CD34+ cells express p15INK4b,
p18INK4c, and p19INK4d, in addition to
p16INK4a. Thus, on this evidence alone, we cannot attribute
the effects found in primary hematopoietic progenitor cells
specifically to abrogation of p16INK4a. To investigate the
role of p16INK4a itself, we also set up CFU-GM assays from
the bone marrow of p16INK4a The INK4a locus encodes 2 potential tumor suppressors with
different reading frames. P16INK4a is encoded by exons
1 Hematopoietic progenitor cells from
p16INK4a Overall, our results strongly implicate p16INK4a in the regulation of hematopoietic-progenitor cell kinetics although yet-to-be-defined roles for other members of the INK4 family cannot be ruled out entirely. They suggest a role for the INK4/CDK4/pRB pathway in regulating the kinetics of progenitor cell renewal and differentiation, and highlight their importance for clonal survival.
We thank Dr M. Serrano (Centro Nacional de Biotecnologia, Madrid, Spain) for the generous donation of the p16INK4a cDNA and the INK4a knockout mice, and Dr J. V. Melo for designing the PCR primers.
Submitted July 10, 2000; accepted January 5, 2001.
J.L.L. S.B.M., N.C.P.C., E.W.-F.L., J.G., and M.Y.G. are supported by the Leukaemia Research Fund of Great Britain; W.C. was the recipient of a PhD Studentship from the Siriraj Hospital, Government of Thailand; B.Z. was supported by the China Scholarship Council; and N.S.B.T. is supported by the Charles Wolfson Charitable Trust.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: M. Y. Gordon, LRF Centre for Adult Leukaemia, Imperial College School of Medicine, Hammersmith Campus, DuCane Rd, London W12 0NN, UK; e-mail: myrtle.gordon{at}ic.ac.uk.
1. Hall M, Peters G. Genetic alterations of cyclins, cyclin-dependent kinases, and Cdk inhibitors in human cancer. Adv Cancer Res. 1996;68:67-108[Medline] [Order article via Infotrieve]. 2. Nakamura K, Koda T, Kakinuma M, et al. Cell cycle dependent gene expressions and activities of protein phosphatases PP1 and PP2A in mouse NIH3T3 fibroblasts. Biochem Biophys Res Comm. 1992;187:507-514[CrossRef][Medline] [Order article via Infotrieve].
3.
Otsuki T, Clark HM, Wellmann A, Jaffe ES, Raffeld M.
Involvement of CDKN2 (p16INK4A/MTS1) and p15INK4b in human leukemias and lymphomas.
Cancer Res.
1995;55:1436-1440
4.
Quesnel B, Preudhomme C, Philippe N, et al.
p16 gene homozygous deletions in acute lymphoblastic leukemia.
Blood.
1995;85:657-663 5. Sill H, Aguiar CT, Schmidt H, Hochhaus A, Goldman JM, Cross NCP. Mutational analysis of the p15 and p16 genes in acute leukaemias. Br J Haematol. 1996;92:681-683[CrossRef][Medline] [Order article via Infotrieve].
6.
Hirama T, Koeffler HP.
Role of the cyclin-dependent kinase inhibitors in the development of cancer.
Blood.
1995;86:841-854 7. Nakamaki T, Kawamata N, Schwaller J, et al. Structural integrity of the cyclin-dependent kinase inhibitor genes p15, p16 and p18 in myeloid leukaemias. Br J Haematol. 1995;91:139-149[Medline] [Order article via Infotrieve]. 8. Quesnel B, Preudhomme C, Lepelley P, et al. Transfer of p16inka/CDKN2 gene in leukaemic cell lines inhibits cell proliferation. Br J Haematol. 1996;95:291-298[CrossRef][Medline] [Order article via Infotrieve].
9.
Urashima M, DeCaprio JA, Chauhan D, et al.
p16INK4A promotes differentiation and inhibits apoptosis of JKB acute lymphoblastic leukemia cells.
Blood.
1997;90:4106-4115 10. Gordon MY, Blackett NM. Some factors determining the minimum number of cells required for successful clinical engraftment. Bone Marrow Transplant. 1995;15:659-662[Medline] [Order article via Infotrieve]. 11. Gordon MY, Blackett NM. Reconstruction of the hematopoietic system after stem cell transplantation. Cell Transplant. 1998;7:339-344[CrossRef][Medline] [Order article via Infotrieve]. 12. Gordon MY, Goldman JM. Cellular and molecular mechanisms in chronic myeloid leukaemia: biology and treatment. Br J Haematol. 1996;95:10-20[Medline] [Order article via Infotrieve].
13.
Sherr CJ.
Cancer cell cycles.
Science.
1996;274:1672-1677 14. Weinberg RA. The retinoblastoma protein and cell cycle control. Cell. 1995;81:323-330[CrossRef][Medline] [Order article via Infotrieve]. 15. Lam EW-F, La Thangue NB. DP and E2F proteins: coordinating transcription with cell cycle progression. Curr Opin Cell Biol. 1994;6:859-866[CrossRef][Medline] [Order article via Infotrieve]. 16. Sardet, LeCam LE, Fabbrizio E, Vidal M. Oncogenes as transcriptional regulators. In: Ghysdael J,Yaniv M, eds. Oncogenes as Transcriptional Regulators Vol 2. Berlin, Germany: Birkhauser Verlag; 1997:1-63.
17.
Dyson N.
The regulation of E2F by pRB-family proteins.
Genes Dev.
1998;12:2245-2262 18. Pegoraro L, Matera L, Ritz J. Establishment of a Ph1-positive cell line, BV173. J Natl Cancer Inst. 1983;70:447-452. 19. Klein E, Ben-Bassat H, Neumann H, et al. Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int J Cancer. 1976;18:421-431[Medline] [Order article via Infotrieve]. 20. Chinswangwatanakul W. Role of p16 in chronic myeloid leukaemia and normal haemopoiesis [dissertation]. United Kingdom: University of London; 1999. 21. Serrano M, Lee H, Chin L, Cordon-Cardo C, Beach D, DePinho RA. Role of the INK4a locus in tumor suppression and cell mortality. Cell. 1996;85:27-37[CrossRef][Medline] [Order article via Infotrieve].
22.
He J, Allen JR, Collins VP, et al.
CDK4 amplification is an alternative mechanism to p16 gene homozygous deletion in glioma cell lines.
Cancer Res.
1994;54:5804-5807 23. Chinswangwatanakul W, Lewis JL, Manning M, Roberts IAG, Gordon MY. Use of G418 resistance to select cells retrovirally transduced with the NeoR gene. Exp Hematol. 1998;26:185-187[Medline] [Order article via Infotrieve]. 24. Lewis JL, Blackett NM, Gordon MY. The kinetics of colony formation by CFU-GM in vitro. Br J Haematol. 1994;88:440-442[Medline] [Order article via Infotrieve]. 25. Altman D. Practical statistics for medical research. Oxford, UK: Blackwell Scientific Publications; 1990:433.
26.
Gordon MY, Marley SB, Lewis JL, et al.
Treatment with interferon- 27. Koh J, Enders GH, Dynlacht BD, Harlow E. Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature. 1995;375:506-510[CrossRef][Medline] [Order article via Infotrieve]. 28. Lukas J, Parry D, Aagaard L, et al. Retinoblastoma-protein-dependent cell cycle inhibition by the tumor suppressor p16. Nature. 1995;375:503-506[CrossRef][Medline] [Order article via Infotrieve].
29.
Medena RH, Herrera RE, Lam F, Weinberg RA.
Growth suppression by p16 requires functional retinoblastoma protein.
Proc Natl Acad Sci U S A.
1995;92:6289-6293
30.
Serrano M, Gomez-Lahoz E, DePinho RA, Beach D, Bar-Sagi D.
Inhibition of ras-induced proliferation and cellular transformation by p16INK4.
Science.
1995;267:249-252
31.
Sherr CJ, Roberts JM.
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
1995;9:1149-1163
32.
Sherr CJ, Roberts JM.
CDK inhibitors: positive and negative regulators of G1-phase progression.
Genes Dev.
1999;13:1501-1512
33.
Li Y, Slansky JE, Myers DJ, Drinkwater NR, Kaelin WG, Farnham PJ.
Cloning, chromosomal location, and characterization of mouse E2F1.
Mol Cell Biol.
1994;14:1861-1869 34. Johnson DG. Regulation of E2F-1 gene expression by p130 (Rb2) and D-type cyclin kinase activity. Oncogene. 1995;11:1685-1692[Medline] [Order article via Infotrieve]. 35. Hu L, Xie E, Chang LS. Different roles of two tandem E2F sites in repression of the human p107 promoter by retinoblastoma and p107 proteins. Mol Cell Biol. 1995;15:3552-3562[Abstract].
36.
Dong F, Cress WD Jr, Agrawal D, Pledger WJ.
The role of cyclin D3-dependent kinase in the phosphorylation of p130 in mouse BALB/c 3T3 fibroblasts.
J Biol Chem.
1998;273:6190-6195 37. Tschan M, Peters U, Cajot JF, Betticher DC, Fey MF, Tobler A. The cyclin-dependent kinase inhibitors p18ink4c and p19ink4d are highly expressed in CD34+ progenitor and acute myeloid leukaemic cells but not in normal differentiated myeloid cells. Br J Haematol. 1999;106:644-651[CrossRef][Medline] [Order article via Infotrieve]. 38. Della Ragione F, Borriello A, Mastropietro S, et al. Expression of G1-phase cell cycle genes during hematopoietic lineage. Biochem Biophys Res Comm. 1997;231:73-76[CrossRef][Medline] [Order article via Infotrieve]. 39. Teofili L, Rutella S, Chiusolo P, et al. Expression of p15INK4b in normal human hematopoiesis. Exp Hematol. 1998;26:1133-1139[Medline] [Order article via Infotrieve]. 40. Quelle D, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell. 1995;83:993-1000[CrossRef][Medline] [Order article via Infotrieve]. 41. Duro D, Bernard O, Della Valle V, Berger R, Larsen CJ. A new type of p16ink4a/MTS1 gene transcript expressed in B-cell malignancies. Oncogene. 1995;11:21-29[Medline] [Order article via Infotrieve].
42.
Stone S, Jiang P, Dayananth P, et al.
Complex structure and regulation of the p16ink4a locus.
Cancer Res.
1995;55:2988-2994 43. Stott FJ, Bates S, James MC, et al. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J. 1998;17:5001-5014[CrossRef][Medline] [Order article via Infotrieve]. 44. Serrano M. The tumor suppresor gene p16INK4a. Exp Cell Res. 1997;237:7-13[CrossRef][Medline] [Order article via Infotrieve]. 45. Zhang Y, Xiong Y, Yarbrough WG. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus delection impairs both the Rb and p53 tumor suppression pathways. Cell. 1998;92:725-734[CrossRef][Medline] [Order article via Infotrieve]. 46. Pomerantz J, Schreiber-Agus N, Ligeois N, et al. The INK4a tumor suppressor gene product p19Arf interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell. 1998;92:713-723[CrossRef][Medline] [Order article via Infotrieve]. 47. Carnero A, Hudson JD, Price CM, Beach DH. P16INK4a and p19Arf act in overlapping pathways in cellular immortalization. Nat Cell Biol. 2000;2:148-155[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
T. E. Bullock, B. Wen, S. B. Marley, and M. Y. Gordon Potential of CD34 in the Regulation of Symmetrical and Asymmetrical Divisions by Hematopoietic Progenitor Cells Stem Cells, April 1, 2007; 25(4): 844 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Brown, C. R. Wilkinson, S. R. Waterman, C. H. Kok, D. G. Salerno, S. M. Diakiw, B. Reynolds, H. S. Scott, A. Tsykin, G. F. Glonek, et al. Genetic regulators of myelopoiesis and leukemic signaling identified by gene profiling and linear modeling J. Leukoc. Biol., August 1, 2006; 80(2): 433 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Torrano, I. Chernukhin, F. Docquier, V. D'Arcy, J. Leon, E. Klenova, and M. D. Delgado CTCF Regulates Growth and Erythroid Differentiation of Human Myeloid Leukemia Cells J. Biol. Chem., July 29, 2005; 280(30): 28152 - 28161. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Dimri The Search for Biomarkers of Aging: Next Stop INK4a/ARF Locus Sci. Aging Knowl. Environ., November 3, 2004; 2004(44): pe40 - pe40. [Abstract] [Full Text] |
||||
![]() |
A. Chandrashekran, M. Y. Gordon, and C. Casimir Targeted retroviral transduction of c-kit+ hematopoietic cells using novel ligand display technology Blood, November 1, 2004; 104(9): 2697 - 2703. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||