|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Department of Biomedical Sciences and Human
Oncology, University of Torino, Italy; IRCC, Institute for Cancer
Research and Treatment, Candiolo, Italy; and University Division of
Clinical Immunology and Hematology, Ospedale Mauriziano Umberto I,
Torino, Italy; and the Department of Pathology, University of Verona,
Policlinico Borgo Roma, Italy.
In B-cell chronic lymphocytic leukemia (B-CLL), defective apoptosis
causes the accumulation of mature CD5+ B cells in lymphoid
organs, bone marrow (BM), and peripheral blood (PB). These cells are
the progeny of a proliferating pool that feeds the accumulating
compartment. The authors sought to determine which molecular mechanisms
govern the proliferating pool, how they relate to apoptosis, and what
the role is of the microenvironment. To begin to resolve these
problems, the expression and modulation of the family of inhibitor of
apoptosis proteins (IAPs) were investigated, with consideration given
to the possibility that physiological stimuli, such as CD40 ligand
(CD40L), available to B cells in the microenvironment, might modulate
IAP expression. The in vitro data on mononuclear cells from PB or BM of
30 patients demonstrate that B-CLL cells on CD40 stimulation express
Survivin and that Survivin is the only IAP whose expression is induced by CD40L. Through immunohistochemistry, in vivo Survivin expression in
lymph node (LN) and BM biopsies was evaluated. In reactive LN, Survivin
was detected only in highly proliferating germinal center cells. In LN
from patients with B-CLL, Survivin was detected only in
pseudofollicles. Pseudofollicle Survivin+ cells were
actively proliferating and, in contrast to Survivin+ B
cells found in normal GC, were Bcl-2+. In B-CLL BM
biopsies, CD5+, Survivin+ cells were observed
in clusters interspersed with T cells. These findings establish that
Survivin controls the B-CLL proliferative pool interfacing apoptosis
and that its expression may be modulated by microenvironmental stimuli.
(Blood. 2001;97:2777-2783) B-cell chronic lymphocytic leukemia (B-CLL), the
most common leukemia in the Western world, is characterized by the
relentless accumulation of monoclonal mature CD5+ B cells
in lymphoid organs, bone marrow (BM), and peripheral blood
(PB).1 Virtually all circulating B-CLL lymphocytes are long-lived elements arrested in the G0/early G1 phase of the cell cycle,2 but focal aggregates of proliferating cells form
the so-called pseudofollicles in lymph nodes (LN)3 and are
scattered in the BM, which is a preferred site of
relapse.4
The progressive rise of lymphocytes, despite the very low
proportion proliferating cells, has led to the notion that B-CLL is
primarily related to defective apoptosis.1 Genetic defects of the neoplastic cell and external stimuli may both influence the
cell's abnormal behavior.5 Investigations on the
intrinsic ability of B-CLL cells to avoid apoptosis have been mainly
centered on the Bcl-2 gene family.6 Even if the
t(14;18) translocation is exceedingly rare, the Bcl-2 gene
product, which is the prototype antidote to apoptosis, is consistently
overexpressed in B-CLL cells7,8 together with high levels
of Mcl-1.9,10 The microenvironment likely plays a
prominent role because the malignant cells progressively accumulate in
vivo, whereas they rapidly undergo apoptosis when cultured in vitro. BM
stromal cells11,12 and follicular dendritic
cells13 may be involved in the natural history of the
disease, but the most attractive candidates are T lymphocytes. Their
numbers are increased in B-CLL patients, and activated
CD4+ T cells strikingly predominate in BM and
LN.14-16
All these considerations lead to the central issue of the disease. CLL
cells accumulate because of defective apoptosis that causes extended
survival. These cells are the progeny of a pool (albeit small) of
proliferating elements that feed the downstream accumulating
compartment. The questions are (1) which molecular mechanisms govern
the proliferating pool, (2) how are patients interfaced with apoptosis,
and (3) what, if any, is the role of the microenvironment. We have
approached these problems by investigating the expression and
modulation of the family of inhibitor of apoptosis proteins
(IAPs)17 and by considering the possibility that
physiological stimuli available to B cells in the microenvironment
might modulate IAP expression.
IAPs were originally identified in baculoviruses18 and are
highly conserved across species. Similar to their viral counterparts, expression of human IAP genes can inhibit apoptosis induced by a
variety of stimuli. Six human IAPs have been described so far: NAIP,19 cIAP1, cIAP2,20 XIAP,21
Survivin,22 and Apollon.23 They all appear to
suppress apoptosis by caspase and procaspase inhibition,24
therefore representing the last chance for a cell to escape its
apoptotic fate. Recent evidence suggests that in vivo caspases are
inactive in B-CLL cells, though they are functional when the
cells are cultured in vitro.25 Therefore, it is
conceivable to postulate a role for IAPs in maintaining the
disease. Among IAPs, Survivin not only controls apoptosis but also
participates in cell-cycle progression, thereby integrating
apoptosis and cell division.26
As for microenvironmental stimuli, the presence of CD4+ T
cells in involved BM and LN15 led us to focus on the
interactions between the B-cell-associated molecule CD40 and its
natural ligand (CD40L, CD154). CD40 belongs to the tumor necrosis
factor (TNF) receptor superfamily,27 and its stimulation
appears to rescue B-CLL cells from apoptosis and to induce
proliferation.28,29 CD40L is a member of the TNF family
that is expressed on activated T cells.30
Our experiments indicated that Survivin plays a role in the
pathophysiology of B-CLL for the following reasons: (1) B-CLL cells, on
CD40 stimulation, express Survivin; (2) Survivin is the only IAP whose
expression is induced in B-CLL cells by CD40L; (3) in vivo
Survivin+ cells are proliferating elements that
coexpress Bcl-2 and are confined within the LN pseudofollicles and
in clusters that gather in the BM, interspersed with T cells. These
data provide a link between microenvironmental factors, here
represented by CD4+ T cells, and the
proliferation/apoptosis dilemma of B-CLL cells.
Patients
We used tonsils, obtained as discarded tissues, from children
undergoing tonsillectomy. Retrieval of all tissue samples followed the
institutional guidelines at Ospedale Mauriziano Umberto I, Torino, Italy.
Cells
Flow cytometric analysis and cell sorting Surface staining of cells was performed using the following monoclonal antibodies (mAbs): fluorescein isothiocyanate (FITC)-labeled anti-CD19 (Beckman Coulter Instrumentation Laboratory, Milan, Italy); phycoerythrin (PE)-labeled anti-CD5, anti-CD23, and anti-CD38 (Becton Dickinson Bioscience, Milan, Italy); and tricolor-labeled anti-CD19 (Caltag Laboratories, San Francisco, CA). Polyclonal FITC-conjugated rabbit antihuman IgM, IgG, IgA, and IgD, antihuman light chain, and polyclonal PE-conjugated rabbit
antihuman  light chain were purchased from Southern Biotechnology
Associates, Birmingham, AL.
Intracellular staining was performed after fixation and permeabilization using the Fix & Perm kit (Caltag Laboratories) following the manufacturer's instructions. A mouse monoclonal antihuman Survivin (8E2 clone) was used (D. Altieri, unpublished data, January 2000). FITC-labeled goat antimouse immunoglobulin (SBA) was used as a secondary reagent. Flow cytometric analysis and cell sorting were performed on a
Facscalibur equipped with the sorter module using Cellquest research
software (Becton Dickinson). Germinal center B cells were sorted from
tonsils as CD19+ CD38+ IgD RNA preparation and RT-PCR Total RNA was extracted from 1 to 3 × 106 FACS sorted and unsorted cells and during the 7 days of culture using guanidinium thiocyanate method (RNAzol; Biotecx Laboratories, Houston, TX). The obtained RNA was reverse-transcribed into cDNA using 200 U Superscript II, Rnase H reverse transcription (Life Technologies Italia S.r.l., San Giuliano Milanese, Milan, Italy) and amplified by polymerase chain reaction (PCR). The PCR reaction was performed in 20 µL with 0.2 mM dNTPs, 1× GeneAmp buffer (PerkinElmer Italia, Monza, Italy), 0.5 U AmpliTaq DNA polymerase (PerkinElmer), and 10 pmol each specific primer for: cIAP1, forward 5' GAA GAC ATC TCT TCA TCG AGG 3'; reverse 5' CCA CAG GTG TAT TCA TCA TGA C 3'; cIAP2, forward 5' TCC TAG CTG CAG ATT CGT TC 3'; reverse 5' GGT AAC TGG CTT GAA CTT GAC 3'; NAIP, forward 5' AGG GAA TTC ATG GCC ACC CAG CAG AAA 3'; reverse 5'CTC CTC GAG CAG TAA TTG AGA AAG TTC ACC 3'; XIAP, forward 5' GGG AAT TCA TGA CTT TTA ACA GTT TTG AAG GAT 3'; reverse 5' CTC TCG AGC ATG CCT ACT ATA GAG TTA GA 3'; Survivin, forward 5'CTCTACATTCAAGAACTGGCC3'; reverse 5'TTGGCTCTTTCTCTGTCCAG3'.Cycling conditions were as follows: 1 cycle at 94°C for 2 minutes, 35 cycles at 94°C for 45 seconds, annealing temperature for 45 seconds (54°C for cIAP1, cIAP2, and Survivin and 52°C for NAIP and XIAP), 72°C for 45 seconds, and a final extension at 72°C for 10 minutes. Amplified products were resolved by electrophoresis on a 1.5% agarose gel. Quantitative assessment of apoptosis Binding of Annexin V-FITC was used to follow phosphatidylserine exposition on early apoptotic cells. Staining was performed according to the manufacturer's instructions using the Annexin V-based apoptosis detection kit (R&D Systems, Flanders, NJ). Briefly, 10 × 105 cells were incubated with saturating concentrations of Annexin V-FITC for 15 to 30 minutes at room temperature and were immediately analyzed on a Facscalibur (Becton Dickinson).Cell-cycle analysis Determination of the percentage of B-CLL cells at each stage of the cell cycle was made by an assessment of DNA content after staining with propidium iodide using DNA con3 kit (Consul T.S., Rivalta, Italy) according to the manufacturer's instructions. Propidium iodide incorporation was analyzed using a Facscalibur instrument (Becton Dickinson) equipped with the doublet discriminator module.Western blotting Whole cell protein extracts were prepared from 3 × 106 cells cultured with or without soluble CD40L using a lysis buffer containing 10 mM Tris-HCl (pH 7.6), 5 mM EDTA, 50 mM NaCl, aprotinin (5 µg/mL), pepstatin (1 µg/mL), soybean trypsin inihibitor (2 µg/mL), 1 mM phenylmethylsulfonyl fluoride, and 1% NP40 (Sigma).Cell lysates were separated by 12% gels in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene difluoride (Bio-Rad, Hercules, CA), and blocked in TTBS and milk 3% or in PBS and BSA 5% overnight. Immunoblottings were performed using mAb against Survivin (mouse mAb 1µg/mL; R&D Systems, Minneapolis, MN), Bcl-X (1:1000 rabbit polyclonal antiserum; Transduction Laboratories, Lexington, KY), Bcl-2 (mouse mAb 1:1500; DAKO, Glastrup Denmark), and Mcl-1 (mouse mAb 1:1000; Transduction Laboratories). Horseradish peroxidase-antimouse IgG (1:3000; Promega, Madison WI) and horseradish peroxidase-antirabbit IgG (1:5000, Promega) were used as secondary reagents. All immunoblots were revealed by enhanced chemiluminescence (Amersham, Buckinghamshire, United Kingdom). Immunohistochemistry Five-micrometer tissue sections of 4 reactive lymph nodes, 4 lymph nodes with diffuse infiltration of B-CLL, and 2 bone marrow trephine biopsies with heavy infiltration of B-CLL were cut on slides covered with adhesive. Sections were deparaffinized, and endogenous peroxidase was quenched with 1.5% hydrogen peroxidase in methanol (10 minutes). A series of antibodies was applied to characterize B-CLL cells (CD20, CD79a, CD5, CD23) and reactive T cells (CD3, CD8). All reagents were purchased from DAKO. Serial sections of the same cases were also immunostained with antibody recognizing molecules involved in cell proliferation, cell-cycle regulation, or apoptosis. These mAbs included anti-Bcl-2 (Ab124; DAKO), anti-p27kip1 (Transduction Laboratories), and anti-Ki-67 (MIB-1; DAKO). All sections were subjected, before immunostaining, to antigen retrieval (citrate buffer, pH 6.0) and developed using a sensitive avidin-streptavidin-peroxidase technique with semi-automated cell staining systems (Optimax; Biogenex, San Ramon, CA) and standardized procedures.For immunohistochemical analysis of Survivin, antigen retrieval was performed in a pressure cooker containing 1.5 L of 9 mM citrate buffer, pH 6.0, that had been brought to boil. The lid was secured, and heating was continued for approximately 6 minutes, until the pressure valve released. After gentle washing with water, slides were washed with PBS, pH 7.0. Staining was performed with mouse monoclonal antihuman Survivin (8E2 clone; D. Altieri, unpublished data, January 2000). Antibody was applied at a concentration of 0.5 mg/mL in PBS, pH 7.0, containing 0.5% BSA and 5% normal goat serum (Vector Laboratories) and incubated overnight at 4°C in a moist chamber. After washing with PBS, the slides were treated with an immunoperoxidase detection system (ABC kit; Immunotech, Marseille, France), according to the manufacturer's instructions, using 3,3'-diaminobenzidine as the chromogen. After immunostaining, the slides were lightly counterstained with hematoxylin and then cover-slipped.
IAP expression in freshly isolated B-CLL cells We analyzed mononuclear cells from PB or BM of 30 patients, 28 with B-CLL and 2 with B-PLL (Table 1). B-CLL cells coexpressed CD19, CD5, and CD23 and had weak surface immunoglobulin expression. B-PLL cells had a CD19+, CD5 , CD23 phenotype and expressed bright
surface immunoglobulin. In agreement with published
studies,9,10 Western blot analysis revealed that all the
patients had high levels of Bcl-2 and Mcl-1 and low levels of
Bcl-xL (data not shown).
The percentage of leukemic B cells ranged between 90% and 95% of mononuclear cells. In 5 patients with CLL, CD19+, CD5+ cells were also FACS-separated to a purity level greater than 97%. The expression of cIAP1, cIAP2, NAIP, XIAP, and Survivin was assessed by RT-PCR on both sorted and unsorted samples, and the results were identical. cIAP1, cIAP2, NAIP, and XIAP were consistently positive in all samples.
On the contrary, Survivin expression was undetectable in most patients
(25 of 30, 83%). In the remaining 5 patients (patients 5, 8, 9, 18, 25; Table 1) and in 2 CLL cell lines (MEC1 and MEC233),
Survivin mRNA was readily amplifiable. This evidence was confirmed at
the protein level by cytofluorometric and Western blot studies (Figures
1A, 2).
Cell-cycle analysis of some patients (Figure
3A) revealed that the proportion of
cycling cells was more pronounced than in Survivin+
patients. Although the number of patients is too small to allow clinical correlation, it is worth mentioning that all 5 Survivin+ patients had active disease, according to
National Cancer Institute criteria,36 and required
treatment. One of them (patient 9; Table 1) had B-PLL. In all the other
patients a proportion of larger, atypical cells, ranging between 20%
and 40%, was observed in PB smears. On the contrary, only 4 of the
remaining 25 patients who did not constitutively express Survivin had
active disease requiring treatment.
Survivin expression in CLL cells is modulated by CD40 engagement We next investigated the in vitro behavior of CLL cells. As expected, these cells started undergoing spontaneous apoptosis after 24 hours of culture in conventional medium. To assess the effect of CD40 stimulation, we set up time-course experiments with cells cultured in the presence or absence of human soluble CD40L. Viability and proliferation were tested every 24 hours up to 7 days.Two different populations of patients were observed: CD40L responders
and CD40L nonresponders. In 15 of 22 (68%) studied patients (Table 1;
patients 1-22), CD40L stimulation reduced the entity of spontaneous
apoptosis and improved cell viability by 20% to 38% after 48 to
96 hours of culture. These patients were considered CD40L responders.
The entity of response was identical irrespective of whether the cells
were exposed to monomeric or trimeric soluble CD40L. The
increased viability (Figure 4) resulted
in a higher number of cells in stimulated versus control cultures. The
increase in the proportion of proliferating cells, evaluated on the
basis of DNA content assay after 3 days of CD40 stimulation, ranged between 0.5% and 5.3% (Figure 3B) compared to unstimulated controls, indicating that a number, albeit small, of B-CLL cells entered the cell
cycle in response to CD40 ligation. The remaining patients (7 of 22, 31%) were considered CD40L nonresponders because both viability and
proliferative activity of cultured cells were unmodified after
stimulation.
Even if the number of patients studied is too small to draw any statistically significant clinical correlation, we evaluated the possibility that the response to CD40L might be related to a number of known clinical parameters. The response to CD40L did not correlate with stage or duration of disease, nor did it correlate with previous treatments. Also unrelated were disease activity, evaluated according to NCI guidelines,36 the number of atypical cells in PB smears, and the immunoglobulin isotype of the malignant clone (Table 1). Given that it has been shown that B-CLL patients can be divided into 2 groups with different prognoses on the basis of CD38 expression,37 we also evaluated the possibility of a correlation between the expression of CD38 on the cell surface and the response to CD40L. As shown in Table 1, no correlation was observed. No modification in the expression of Bcl-2, Mcl-1, and Bcl-xL proteins were observed in either CD40L responders or nonresponders (data not shown). We then evaluated the possibility that IAP expression in B-CLL might be
modulated by CD40L stimulation. The expression of cIAP1, cIAP2, NAIP,
and XIAP remained unmodified in both CD40L responders and CD40L
nonresponders. On the contrary, Survivin expression was up-regulated
after 48 to 96 hours of CD40 engagement in all CD40L responders.
Up-regulation was first observed by RT-PCR (Figure
5) and then confirmed at protein level by
cytofluorometric analysis (Figure 1B) and Western blot (data not
shown). Cells of patients who were already Survivin+ at day
0 maintained Survivin positivity throughout the culture period if they
were exposed to CD40L (Figure 1B). In the tested patients, Survivin
expression was irreversibly lost shortly after the beginning of in
vitro culture if the cells were cultured in medium alone. No modulation
of Survivin expression was observed in the cells of the 7 CD40L
nonresponders cultured for up to 7 days in the presence or absence of
CD40L.
Survivin expression in CLL lymph nodes and bone marrow As in vitro data were ascribing a role to Survivin, we evaluated its in vivo expression in LN and BM biopsies by immunohistochemical analysis. In reactive LN, Survivin was detected only in highly proliferating germinal center (GC) cells (Figure 6A-B). Immunohistochemical data were confirmed by RT-PCR analysis on FACS-purified GC cells (data not shown).
Lymph nodes from 4 patients with B-CLL were examined, and the findings
were consistent and reproducible. In B-CLL LN, Survivin was detected
only in pseudofollicles (Figure 6C-D). Pseudofollicle Survivin+ cells were actively proliferating, as documented
by the Ki67-positivity (Figure 7A). At
the same time they were uniformly and intensely Bcl-2+
(Figure 7B), indicating a remarkable resistance to undergo apoptosis. Only few elements in pseudofollicles expressed the cyclin kinase inhibitor p27kip1 (Figure 7C). The overwhelming majority of malignant cells invading LN outside pseudofollicles were p27kip1+,
Bcl2+ but Survivin
In the 2 B-CLL BM biopsies analyzed, CD5+,
Survivin+ large cells were observed in sparse clusters amid
a preponderance of CD5+, Survivin
The salient feature of B-CLL natural history is the in vivo accumulation of monoclonal resting B cells. Several defects in the induction of apoptosis, including the overexpression of Bcl-2 and Mcl-1,8,9 concur to create an accumulation compartment that progressively enlarges. More generally, the overall pattern of the expression of the Bcl-2 gene family favors the extended survival of B-CLL cells. On these grounds, B-CLL is considered a malignancy whose destiny is decisively influenced by absent or defective apoptosis. This interpretation has to be consistent with the obvious need for a proliferative compartment that supplies the accumulation compartment and with the contention that the B-CLL cell genetic abnormalities do not entirely account for all aspects of cell accumulation. The microenvironment presumably exerts a strong influence in vivo as malignant cells very rapidly undergo apoptosis once cultured in vitro. In this work, we demonstrate that Survivin expression in resting B-CLL cells is induced in vitro by CD40 stimulation, that Survivin is the only IAP whose expression is modulated by CD40L, and that in vivo Survivin+ cells are localized in LN pseudofollicles and in rare BM clusters interspersed with T cells. Survivin+ cells proliferate and, at the same time, express Bcl-2. These findings establish 2 major points. First, they indicate that Survivin has an important role in controlling the B-CLL proliferative pool and its ability to nourish the accumulation compartment. Second, they demonstrate that Survivin expression may be modulated by microenvironmental stimuli. A further ancillary point is that the constitutive expression of the antiapoptotic proteins NAIP, cIAP1, cIAP2, and XIAP by B-CLL cells circulating in the PB may contribute to their accumulation. Survivin is a protein that prevents apoptosis by blocking caspase
activity.38 Furthermore, it is expressed in the G2/M phase of the cell cycle, where it associates with the mitotic spindle microtubules.26 It has been suggested that caspase
activity occurs during each cell cycle and that Survivin functions to
block this activity.39 In fact, Survivin forms a
supramolecular assembly together with caspase-3 and the
cyclin-dependent kinase inhibitor p21waf1 within
centrosomes,40 thereby preventing apoptosis and preserving
p21waf1 integrity during normal mitotic progression.40 In
this way, Survivin interfaces cell survival and cell proliferation. By
immunostaining reactive LN, we demonstrate that in normal lymphoid tissues, the expression of Survivin is concentrated in GC that represent the B-cell proliferation compartment of lymphoid
follicles41 (Figure 6). This observation fits very well
with the intense Survivin positivity observed in highly aggressive
lymphomas of GC origin.22 In B-CLL the proliferating pool
is located in LN pseudofollicles, where proliferating B-CLL cells
coexpress both Survivin and Bcl-2 (Figures 6, 7). This is in striking
contrast with normal GC cells that are
Bcl-2 It may be asked why not all patients with B-CLL respond to CD40L stimulation. There are several possible answers. First, our in vitro stimulus may not be strong enough to detect all responsive cells. The number of circulating malignant cells inducible by CD40L may be variable, so that some occurrences are easily disclosed while others remain unnoticed. Second, CD40L might be one of a number of favoring microenvironmental stimuli. Other stimuli, perhaps provided by BM stromal cells12 or follicular dendritic cells,13 may be involved. Third, the term B-CLL probably does not indicate a single homogeneous disease but may cover a wider spectrum of disorders with different stimuli requirements. It has been shown that the presence of somatic mutations of IgV genes and of high percentages of CD38+ cells defines 2 groups of patients with B-CLL with significantly different prognoses.37,43 In this small series, the ability to respond to CD40L does not correlate with the expression of CD38 (Table 1) nor (P. Ghia et al, unpublished results, March 2000) with the presence or absence of immunoglobulin somatic mutations, and it remains to be established whether the responsiveness or unresponsiveness to CD40L may define more subclasses of CLL. Forthcoming clinical studies on a larger series of patients will address this issue and the issue of whether the constitutive expression of Survivin has a clinical correlate, and they may identify a subset of patients with a more aggressive form of the disease as recently shown in diffuse large B-cell lymphomas.44 Taken together, the data obtained lead to a model of B-CLL growth and
expansion in which a small proliferating pool within LN pseudofollicles
is governed by the expression of Survivin. These cells are bound to
accumulate because they also express Bcl-2. They leave the
pseudofollicle mircroenvironment, down-regulate Survivin expression,
and stop proliferating. During their long lifespans, they circulate and
may easily reach the BM, a privileged site of disease relapse and a
sanctuary for CD4+ T cells. In the BM, microenvironmental
stimuli such as the CD40 stimulation provided by activated
CD4+ T cells may recruit Survivin
We thank Prof P. C. Marchisio (DIBIT, Milan, Italy) for helpful discussions and Prof D. Altieri (Yale University, New Haven, CT) for providing the antihuman Survivin antibodies.
Submitted July 3, 2000; accepted November 29, 2000.
This study was supported in part by research funding from AIRC to F.C.C. and M.C. and by MURST 40% to F.C.C.
L.G. and P.G. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Federico Caligaris-Cappio, University Division of Clinical Immunology and Hematology, Ospedale Mauriziano Umberto I, Largo Turati 62, 10128 Torino, Italy; e-mail: fcaligaris{at}mauriziano.it.
1.
Caligaris-Cappio F, Hamblin TJ.
B-cell chronic lymphocytic leukemia: a bird of a different feather.
J Clin Oncol.
1999;17:399-408
2.
Andreeff M, Darzynkiewicz Z, Sharpless TK, Clarkson BD, Melamed MR.
Discrimination of human leukemia subtypes by flow cytometric analysis of cellular DNA and RNA.
Blood.
1980;55:282-293 3. Lennert K. Malignant lymphomas other than Hodgkin's disease: Histology, Cytology, Ultrastructure, Immunology. Berlin: Springer-Verlag; 1978:119-126.
4.
Rozman C, Montserrat E.
Chronic lymphocytic leukemia.
N Engl J Med.
1995;333:1052-1057 5. Ghia P, Caligaris-Cappio F. The nondispensable role of microenvironment in the natural history of low-grade B cell neoplasms. Adv Cancer Res. 2000;79:157-174[Medline] [Order article via Infotrieve]. 6. Reed JC. Molecular biology of chronic lymphocytic leukemia. Semin Oncol. 1998;25:11-18[Medline] [Order article via Infotrieve]. 7. Pezzella F, Tse AG, Cordell JL, Pulford KA, Gatter KC, Mason DY. Expression of the bcl-2 oncogene protein is not specific for the 14;18 chromosomal translocation. Am J Pathol. 1990;137:225-232[Abstract].
8.
Schena M, Larsson LG, Gottardi D, et al.
Growth- and differentiation-associated expression of bcl-2 in B-chronic lymphocytic leukemia cells.
Blood.
1992;79:2981-2989
9.
Kitada S, Andersen J, Akar S, et al.
Expression of apoptosis-regulating proteins in chronic lymphocytic leukemia: correlations with in vitro and in vivo chemoresponses.
Blood.
1998;91:3379-3389 10. Kitada S, Zapata JM, Andreeff M, Reed JC. Bryostatin and CD40-ligand enhance apoptosis resistance and induce expression of cell survival genes in B-cell chronic lymphocytic leukaemia. Br J Haematol. 1999;106:995-1004[CrossRef][Medline] [Order article via Infotrieve]. 11. Lagneaux L, Delforge A, De Bruyn C, Bernier M, Bron D. Adhesion to bone marrow stroma inhibits apoptosis of chronic lymphocytic leukemia cells. Leuk Lymphoma. 1999;35:445-453[Medline] [Order article via Infotrieve]. 12. Panayiotidis P, Jones D, Ganeshaguru K, Foroni L, Hoffbrand AV. Human bone marrow stromal cells prevent apoptosis and support the survival of chronic lymphocytic leukaemia cells in vitro. Br J Haematol. 1996;92:97-103[CrossRef][Medline] [Order article via Infotrieve]. 13. Chilosi M, Pizzolo G, Caligaris-Cappio F, et al. Immunohistochemical demonstration of follicular dendritic cells in bone marrow involvement of B-cell chronic lymphocytic leukemia. Cancer. 1985;56:328-332[CrossRef][Medline] [Order article via Infotrieve].
14.
Kay NE.
Abnormal T-cell subpopulation function in CLL: excessive suppressor (T gamma) and deficient helper (T mu) activity with respect to B-cell proliferation.
Blood.
1981;57:418-420
15.
Pizzolo G, Chilosi M, Ambrosetti A, Semenzato G, Fiore-Donati L, Perona G.
Immunohistologic study of bone marrow involvement in B-chronic lymphocytic leukemia.
Blood.
1983;62:1289-1296 16. Serrano D, Monteiro J, Allen SL, et al. Clonal expansion within the CD4+CD57+ and CD8+CD57+ T cell subsets in chronic lymphocytic leukemia. J Immunol. 1997;158:1482-1489[Abstract].
17.
Deveraux QL, Reed JC.
IAP family proteins
18.
Crook NE, Clem RJ, Miller LK.
An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif.
J Virol.
1993;67:2168-2174 19. Liston P, Roy N, Tamai K, et al. Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature. 1996;379:349-353[CrossRef][Medline] [Order article via Infotrieve]. 20. Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell. 1995;83:1243-1252[CrossRef][Medline] [Order article via Infotrieve]. 21. Duckett CS, Nava VE, Gedrich RW, et al. A conserved family of cellular genes related to the baculovirus IAP gene and encoding apoptosis inhibitors. EMBO J. 1996;15:2685-2694[Medline] [Order article via Infotrieve]. 22. Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 1997;3:917-921[CrossRef][Medline] [Order article via Infotrieve]. 23. Chen Z, Naito M, Hori S, Mashima T, Yamori T, Tsuruo T. A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun. 1999;264:847-854[CrossRef][Medline] [Order article via Infotrieve]. 24. Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC. The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 1997;16:6914-6925[CrossRef][Medline] [Order article via Infotrieve]. 25. Stoetzer OJ, Pogrebniak A, Scholz M, et al. Drug-induced apoptosis in chronic lymphocytic leukemia. Leukemia. 1999;13:1873-1880[CrossRef][Medline] [Order article via Infotrieve]. 26. Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature. 1998;396:580-584[CrossRef][Medline] [Order article via Infotrieve]. 27. Vogel LA, Noelle RJ. CD40 and its crucial role as a member of the TNFR family. Semin Immunol. 1998;10:435-442[CrossRef][Medline] [Order article via Infotrieve].
28.
Fluckiger AC, Rossi JF, Bussel A, Bryon P, Banchereau J, Defrance T.
Responsiveness of chronic lymphocytic leukemia B cells activated via surface Igs or CD40 to B-cell tropic factors.
Blood.
1992;80:3173-3181 29. Osorio LM, Aguilar-Santelises M. Apoptosis in B-chronic lymphocytic leukaemia. Med Oncol. 1998;15:234-240[Medline] [Order article via Infotrieve]. 30. Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol. 1998;16:111-135[CrossRef][Medline] [Order article via Infotrieve].
31.
Harris NL, Jaffe ES, Stein H, et al.
A revised European-American classification of lymphoid neoplasms: a proposal from the international lymphoma study group.
Blood.
1994;84:1361-1392 32. Matutes E, Owusi-Ankomah K, Morilla R, et al. The immunological profile of B-cell disorders and proposal of a scoring system for the diagnosis of CLL. Leukemia. 1994;8:1640-1645[Medline] [Order article via Infotrieve].
33.
Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS.
Clinical staging of chronic lymphocytic leukemia.
Blood.
1975;46:219-234
34.
Lane P, Brocker T, Hubele S, Padovan E, Lanzavecchia A, McConnell F.
Soluble CD40 ligand can replace the normal T cell-derived CD40 ligand signal to B cells in T cell-dependent activation.
J Exp Med.
1993;177:1209-1213 35. Stacchini A, Aragno M, Vallario A, et al. MEC1 and MEC2: two new cell lines derived from B-chronic lymphocytic leukaemia in prolymphocytoid transformation. Leuk Res. 1999;23:127-136[CrossRef][Medline] [Order article via Infotrieve].
36.
Cheson BD, Bennett JM, Grever M, et al.
National Cancer Institute-sponsored working group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment.
Blood.
1996;87:4990-4997
37.
Damle RN, Wasil T, Fais F, et al.
Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia [see comments].
Blood.
1999;94:1840-1847
38.
Tamm I, Wang Y, Sausville E, et al.
IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs.
Cancer Res.
1998;58:5315-5320 39. Guo M, Bruce AH. Cell proliferation and apoptosis. Curr Opin Cell Biol. 1999;11:745-752[CrossRef][Medline] [Order article |
Top
Abstract
Introduction
chain, was also used, kindly
provided by Dr P. Lane (Oxford, United Kingdom).
actin polyclonal antiserum
(bottom) was used as control. Samples at diagnosis from 1 Survivin
) or the absence (
) of
CD40L. Viability was assessed by cytofluorometric analysis of Annexin-V
staining at the indicated time points (days).
suppressors of apoptosis.
Genes Dev.
1999;13:239-252