| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the University of Texas M. D. Anderson Cancer
Center, Houston, TX; the Division of Medical Oncology I, Regina Elena
Cancer Institute, Rome, Italy; and Yale University School of Medicine,
New Haven, CT.
Survivin, a member of the inhibitors-of-apoptosis gene
family, is expressed in a cell-cycle-dependent manner in all the most common cancers but not in normal differentiated adult tissues. Survivin expression and regulation were examined in acute
myeloid leukemia (AML). Survivin was detected by Western
blot analysis in all myeloid leukemia cell lines and in 16 of 18 primary AML samples tested. In contrast, normal CD34+ cells
and normal peripheral blood mononuclear cells expressed no or very low
levels of survivin. Cytokine stimulation increased survivin expression in leukemic cell lines and in primary
AML samples. In cultured primary samples, single-cytokine stimulation substantially increased survivin expression in comparison
with control cells, and the combination of G-CSF, GM-CSF, and SCF
increased survivin levels even further. Conversely,
all-trans retinoic acid significantly decreased survivin
protein levels in HL-60, OCI-AML3, and NB-4 cells within 96 hours,
parallel to the induction of myelomonocytic differentiation. Using
selective pharmacologic inhibitors, the differential involvement of
mitogen-activated protein kinase kinase (MEK) and
phosphatidylinositol-3 kinase (PI3K) pathways were demonstrated in the
regulation of survivin expression. The MEK inhibitor
PD98059 down-regulated survivin expression in both resting
and GM-CSF-stimulated OCI-AML3 cells, whereas the PI3K inhibitor
LY294002 inhibited survivin expression only on GM-CSF
stimulation. In conclusion, these results demonstrate that
survivin is highly expressed and cytokine-regulated in
myeloid leukemias and suggest that hematopoietic cytokines exert their
antiapoptotic and mitogenic effects, at least in part, by
increasing survivin levels.
(Blood. 2001;97:2784-2790) Survivin, a member of the
inhibitors-of-apoptosis (IAP) family of proteins, is present during
fetal development but is undetectable in terminally differentiated
adult tissues. However, survivin is prominently expressed in
transformed cell lines, in all the most common human cancers, and in
approximately 50% of high-grade non-Hodgkin lymphomas.1-4
Survivin suppresses apoptosis induced by Fas, Bax, caspases,
and anticancer drugs.5 Conversely, the down-regulation of
survivin by antisense oligonucleotides induces apoptosis in
vitro.6,7 Although survivin protein lacks the ability to directly inhibit caspase-3,8 it binds
quantitatively to a new IAP-inhibiting protein,
Smac/Diablo,9,10 raising the possibility that it might
suppress caspases indirectly by freeing other IAP family members from
the constraints of this protein. Taken together, these studies support
the notion that survivin exerts an antiapoptotic effect.
Survivin expression is cell-cycle-dependent. In
proliferating cells, survivin is expressed at high levels in
the G2/M phase and is rapidly down-regulated after
cell-cycle arrest.11 Recent studies suggest that
survivin also plays a role in cell cytokinesis, and the same
function has been observed for the survivin-homologous ancient baculovirus IAP repeat (BIR)-family proteins in
Caenorhabditis elegans and yeast.12-14 The role
of survivin in cell division control is thought to involve
caspase-dependent loss of p21 and deregulation of mitotic
transition.12 Moreover, BIR-family proteins are required for the targeting of members of the Aurora family of kinases to metaphase chromosomes, thereby controlling chromosome segregation and
cytokinesis.15,16 On the basis of these collective
findings, therefore, survivin is considered to play a
pivotal role in linking cell death and cell
proliferation.17,18
Survival and growth of hematopoietic cells exquisitely depend on the
presence of appropriate cytokines that can be provided through either
autocrine production or paracrine secretion by stromal cells in the
bone marrow micro-environment.19 Cytokines contribute to
the regulation of the apoptotic threshold of normal and leukemic cells
by modulating the expression and function of different families of pro-
and antiapoptotic proteins.20,21 In particular,
granulocyte macrophage-colony-stimulating factor (GM-CSF) exerts its
biologic activity by binding its receptor, which in turn activates
multiple intracellular signal transduction pathways through the common
In the study reported here, we examined the regulation of
survivin expression in acute myeloid leukemia (AML). Our
results demonstrate that survivin is expressed in AML cell
lines and in primary AML samples and that expression is up-regulated by
hematopoietic cytokines and inhibited by all-trans retinoic acid
(ATRA). We further demonstrate that survivin expression is
regulated through MEK/ERK and PI3K pathways and can be modulated by
selective signal transduction inhibitors.
Cell lines and primary samples
Cell culture studies
Western blot analysis Cells were washed twice with phosphate-buffered saline (PBS) buffer and lysed at 4 × 104 cells/µL in cell lysis buffer (20 mM HEPES, pH 7.4, 0.25% NP-40 containing protease inhibitor cocktail; Boehringer Mannheim, Indianapolis, IN) for 10 minutes on ice. Equal amounts of lysate (equivalent to 5 × 105 cells) were subjected to SDS-PAGE to 12% polyacrylamide gels. Proteins were transferred to Hybond-P (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) membranes and reacted with polyclonal antibody against survivin for 2 hours at room temperature. After they were washed, membranes were probed with a horseradish peroxidase-conjugated secondary antibody and reacted with ECL reagent (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom). Anti- -actin blot was made in parallel as a loading control. Signals were detected by a
PhosphorImager (Storm 860, version 4.0; Molecular Dynamics, Sunnyvale,
CA) and quantified by Scion Image software (Scion, Frederick, MD).
Results were expressed as survivin/ -actin ratios.
Reverse transcription-polymerase chain reaction OCI-AML3 cells were treated with either PD98059 or LY294002, as described above, and RNA was isolated with STAT-60 solution (Tel-Test, Friendswood, TX). One microgram total RNA was reverse-transcribed with survivin reverse primer (5'TCTCCTTTCCTAAGACATT3') by AMV reverse transcriptase (Boehringer Mannheim) at 42°C for 1 hour. Polymerase chain reaction (PCR) amplification reaction mixtures (25 µL) contained cDNA, survivin forward primer (5'CACCACTTCCAGGGTTTA3'), the reverse primer, survivin probe (5'TGGTGCCACCAGCCTTCCTGTG3'), and TaqMan Universal PCR master mix (PE Applied Biosystems, Foster City, CA). Thermal cycle conditions included holding the reactions at 50°C for 2 minutes and at 95°C for 10 minutes and cycling for 40 cycles between 95°C for 15 seconds and 60°C for 1 minute. Results were collected and analyzed by an ABI Prism 7700 Sequence Detection System (PE Applied Biosystems).Cell-cycle analysis OCI-AML3 and HL-60 cells (0.5 × 106), cultured under various conditions, were harvested at different times, washed twice with cold PBS, and fixed with 2 mL ice-cold ethanol (70% vol/vol in water) for 1 hour at 4°C. After centrifugation, fixed cells were exposed to 500 µL propidium iodide (PI) staining solution (25 µg/mL PI, 180 U/mL RNase, 0.1% Triton X-100, and 30 mg/mL polyethylene glycol in 4 mM citrate buffer, pH 7.8; all from Sigma) for 1 hour at 4°C and analyzed using a FACScan flow cytometer (Becton Dickinson, San Jose, CA). Cell-cycle distribution was then analyzed using the ModFit LT software (Verity Software House, Topsham, ME).
Expression of survivin protein in leukemic cell lines and primary AMLs Survivin expression in myeloid leukemias has not yet been studied, though preliminary evidence that survivin mRNA is present in leukemic cell lines and in primary AML samples was reported from our group.32 Here we examined survivin protein expression by Western blot analysis. As shown in Figure 1, all leukemic cell lines tested (RC-2a, KG-1, HL-60, HL-60 DOX, OCI-AML3, Mo7e, NB-4, and K562) expressed survivin protein at comparable levels (1.26 ± 0.32, survivin/ -actin ratio; survivin/ -actin ratio
for OCI-AML3 = 1). Sixteen of 18 AML bone marrow samples
showed variable levels of survivin (Figure 1). The mean
survivin/ -actin ratio related to OCI-AML3 in these
samples (± SD) was 0.44 ± 0.31 (range, 0 to 1.17; Figure 1,
Table 1). Hence, as in other malignancies, survivin protein
is widely expressed in leukemic cell lines and primary AML blasts. We
also examined survivin protein expression in normal
CD34+ cells obtained by magnetic-bead sorting of 4 bone
marrows from normal donors and 3 peripheral blood mononuclear cell
samples obtained after G-CSF mobilization. Three bone marrow samples
were weakly positive, and all others were negative for
survivin expression (0.08 ± 0.11; Figure 1, Table 1).
Likewise, survivin protein expression was not detectable in
3 unseparated peripheral blood mononuclear cell samples (data
not shown).
Induction of survivin protein expression by cytokines Because survival and growth of leukemic cells largely depend on the presence of appropriate cytokines, we also tested the effect of different hematopoietic cytokines on survivin expression in human leukemic cell lines and primary AML blasts. As shown in Figure 2, survivin protein levels were 2-fold in GM-CSF (150 U/mL), 2.3-fold in G-CSF (80 ng/mL), and 1.8-fold in stem cell factor (SCF; 75 ng/mL)-treated OCI-AML3 cells compared to cells cultured in cytokine- and serum-free medium for 48 hours. Similar results were obtained in HL-60 cells (data not shown). In 3 AML bone marrow samples studied (patients 15, 17, 18; Table 1) survivin protein level decreased dramatically after 48-hour culture in cytokine- and serum-free medium (Figure 3). Treatment with GM-CSF (100 U/mL) and, to a lesser extent, G-CSF (50 ng/mL) and SCF (100 ng/mL) substantially increased survivin protein levels compared to control cells, and combinations of these cytokines resulted in the induction of higher survivin levels (Figure 3).
ATRA-induced differentiation and inhibition of survivin protein expression Like other antiapoptotic proteins, such as Bcl-2 and Mcl-1,33,34 survivin expression is likely to be differentially regulated during differentiation. We therefore examined the effect of ATRA-induced leukemia cell differentiation on survivin expression. HL-60 and OCI-AML3 cells were treated with ATRA (1 µM) for up to 96 hours, and survivin protein levels, cell-cycle status, and differentiation were determined. Survivin protein levels were significantly decreased in the ATRA-treated leukemic cells studied (Figure 4). In HL-60 cells, no significant effect was observed at 48 hours; however, at 72 hours, survivin levels were decreased by 67% and at 96 hours they were decreased by 96% compared to the levels in untreated control cells (Figure 4A). In OCI-AML3 cells, survivin levels decreased by 80% at 96 hours (Figure 4B). Concomitant with survivin down-regulation, ATRA-treated OCI-AML3 and HL-60 cells showed inhibition of cell- cycle progression and morphologic features of myelomonocytic differentiation (data not shown). Similarly, ATRA decreased survivin protein expression and induced differentiation in NB-4 cells. After 96 hours of culture in 1 µM ATRA, survivin protein levels were decreased by 65% compared to untreated cells (data not shown).
Regulation of survivin expression by the MEK/ERK and the PI3K signal transduction pathways We next examined the role of the MEK/ERK and the PI3K signal transduction pathways in the regulation of basal and cytokine-stimulated survivin expression in OCI-AML3 cells using their respective pharmacologic inhibitors PD98059 and LY294002.29-31 Treatment with PD98059, but not with LY294002, significantly decreased survivin levels in the absence of cytokine stimulation (Figure 5A). However, on stimulation with GM-CSF (100 U/mL), both PD98059 and LY294002 partially inhibited survivin expression (Figure 5A), suggesting that both pathways are involved in GM-CSF-mediated regulation of survivin. To examine whether survivin expression is regulated at the transcriptional level, RNAs from untreated and GM-CSF-stimulated OCI-AML3 cells, cultured in the presence or absence of PD98059 or LY294002, were analyzed by quantitative real-time RT-PCR with survivin-specific primers. Consistent with the protein expression data, survivin mRNA levels were reduced only by the MEK inhibitor PD98059 under basal conditions and by both the MEK and the PI3K inhibitors on GM-CSF stimulation (Figure 5B). Survivin expression in OCI-AML3 cells was also increased by treatment with the phosphatase inhibitor sodium orthovanadate (25 to 50 µM for 48 hours), and this increase was abrogated by pretreatment with either PD98059 or LY294002 (data not shown), further supporting a role for the MEK/ERK and the PI3K pathways in the regulation of survivin expression. We also assessed the effect of signal transduction inhibitors on the cell-cycle distribution of unstimulated and GM-CSF-stimulated OCI-AML3 cells. PD98059 profoundly inhibited the G1/S transition in both unstimulated and GM-CSF-stimulated cells (78% and 79% reduction in S phase, respectively), whereas treatment with LY294002 only slightly affected cell-cycle distribution in either culture condition (33% and 36% reduction in S phase, respectively) (data not shown). PD98059-induced cell- cycle arrest was time- and dose-dependent, and its kinetics and dose-response curve paralleled those of survivin expression (Figure 6). Taken together, our data indicate that survivin expression is differentially regulated by the MEK/ERK and the PI3K signal transduction pathways under basal and GM-CSF-stimulated conditions and suggest that the effect of MEK/ERK blockade may be mediated, at least in part, by the inhibition of cell-cycle progression.
In this study, we provide evidence that the recently described IAP family member survivin is widely expressed in myeloid leukemia cell lines and in almost all primary AML samples tested. Furthermore, we demonstrate that survivin expression in leukemic cells is regulated by cytokines and differentiation-inducing agents and that the modulation of major signal transduction pathways, such as the MEK/ERK and the PI3K pathways, can contribute to the regulation of survivin expression at the mRNA and protein levels. The induction of programmed cell death is the common outcome of successful cytotoxic therapy for many different types of cancer, including AML.35-40 Multiple genetic alterations that result in the disruption of the physiological regulation of apoptosis are thought to account for the ability of leukemic cells to grow autonomously and for their clinical resistance to therapy.41-44 Recently, a new family of downstream inhibitors of caspases, the IAP family, has emerged as a potential key player in the regulation of apoptosis in cancer,45,46 and we have already demonstrated that XIAP is expressed and has prognostic relevance in AML.47 Our present results demonstrate that another IAP family member, survivin, is constitutively expressed in both myeloid leukemia cell lines and in primary AML blasts and at significantly lower levels (P < .001) in normal CD34+ cells from bone marrow or G-CSF-stimulated peripheral blood. The latter finding extends to the hematopoietic progenitors the previous report of lack of survivin expression in normal bone marrow.17 Because survivin has been demonstrated to efficiently inhibit apoptosis induced by a variety of stimuli in vitro5 and its presence has been correlated in vivo with reduced apoptotic indices and poor prognosis in solid tumors,3,4,48-50 we are currently investigating its functional and prognostic relevance in AML. Acute myeloid leukemia is a heterogeneous disease characterized by the accumulation of leukemic blasts arrested at various stages of granulocytic and monocytic differentiation. Transcriptional modulation aimed at restoring the ability of AML cells to regulate the expression of genes resulting in differentiation is, therefore, an attractive therapeutic strategy that has proved effective in the treatment of patients with acute promyelocytic leukemia (APL).51 Our study shows that ATRA significantly down-regulates survivin expression in AML (HL-60, OCI-AML3) and APL (NB-4) cell lines, concomitant with the induction of cell differentiation. Whether other differentiation inducers such as DMSO, hexamethylene bisacetamide, vitamin D, and butyrate are also able to down-regulate survivin expression is unknown. Further studies are required to elucidate whether ATRA directly inhibits survivin transcription or whether it affects survivin expression primarily because of the cell-cycle arrest that accompanies differentiation. Regardless, together with previous evidence indicating that ATRA transcriptionally down-regulates Bcl-2 and Bcl-XL expression in leukemias,52 our findings suggest that ATRA may lower the apoptotic threshold by modulating multiple pathways, eventually rendering AML cells more susceptible to cytotoxic agents. The present study also provides unequivocal evidence that hematopoietic cytokines such as GM-CSF, G-CSF, and SCF, alone or in combination, strongly increase survivin expression in myeloid leukemia cell lines and, most important, in primary AML samples. Further evidence that IAP family members may function as growth factor-inducible antiapoptotic genes comes from the recent observation that survivin and XIAP expression are increased in endothelial cells in response to mitogenic growth factors, resulting in a decreased sensitivity to apoptotic stimuli.26,27 Previous studies from our group have also shown that quiescent, but not proliferating, leukemic progenitors overexpress Bcl-2 and Bcl-XL.53 This observation, together with the present finding of increased survivin expression in response to cytokines, raises the intriguing possibility that Bcl-2 and survivin may represent complementary survival pathways that are differentially regulated by the cell-cycle status of leukemic progenitors. Quiescent progenitors are protected from apoptosis and are restrained from entering the cell cycle by the expression of Bcl-2 (and possibly Bcl-XL). However, once recruited into the cell cycle, proliferating cells could switch to a survivin-mediated survival pathway that enables them to successfully complete mitosis and avoid a "default" induction of apoptosis at cell division.17 Consistent with this hypothesis, preliminary data indicate that AML cells that survive Bcl-2 antisense treatment in vitro express high levels of survivin (B.Z.C., unpublished results, December 1999). Interestingly, in the IL-3-dependent cell line BaF3, cytokine withdrawal-induced apoptosis was inhibited by the forced expression of either Bcl-2 or survivin,1 suggesting that, though they act at different levels, these 2 survival pathways may indeed function in concert to prevent cell death. Cytokine-mediated up-regulation of a survivin-dependent survival pathway might also explain the conflicting clinical results reported for cytokine "priming" strategies for the therapy of AML.54 The binding of GM-CSF to its receptor activates multiple signaling pathways, which in turn lead to the proliferation, differentiation, and survival of various hematopoietic cells.19,20,22 Here we provide the first evidence that, in addition to modulating the expression and function of Bcl-2 family members, GM-CSF-mediated activation of both the MEK/ERK and the PI3K signal transduction pathways regulates the expression of survivin at both the mRNA and the protein level. This finding is consistent with the notion that GM-CSF antiapoptotic activity relies on multiple and, in part, redundant pathways.55 Interestingly, we found that disruption of the MEK/ERK, but not of the PI3K, pathway also inhibited the constitutive expression of survivin (Figure 5), suggesting that the MEK/ERK pathway might be constitutively active in the cytokine-independent OCI-AML3 cell line. Consistent with this hypothesis, recent data from our group demonstrate that active ERK species are indeed detectable in OCI-AML3 cells in the absence of cytokine or serum stimulation (M.M., manuscript in preparation, May 2000). Regulation of mouse survivin expression requires integration
of typical CDE/CHR G1 repressor elements and basal
transcriptional activity by Sp1 sites, which results in a
cell-cycle-regulated expression in the G2/M
phase.56 Our data indicate that pharmacologic disruption
of the MEK/ERK kinase module in unstimulated and GM-CSF-stimulated cells profoundly inhibits the G1/S transition, suggesting
that the observed down-regulation of survivin expression may
be, at least in part, secondary to the inhibition of cell-cycle
progression. However, the early inhibition of survivin mRNA
transcription (at 2 hours) in the absence of any detectable cell-cycle
changes suggests that a direct transcriptional effect might also take
place. Likewise, a cell-cycle-independent transcriptional effect is
the most likely explanation for the inhibition of GM-CSF-stimulated
survivin expression observed in response to PI3K inhibition.
Support for this hypothesis comes further from the recent observation
that, in endothelial cell lines, treatment with angiopoietin-1
up-regulates survivin expression in a PI3K/AKT-dependent
fashion in the absence of any effect on cell
proliferation.57 Further studies are under way to
elucidate the potential involvement of PI3K- and MEK/ERK-dependent transcription factors in survivin gene expression. The
results reported here
We thank Rosemarie Lauzon for assisting in the manuscript preparation and Teresa McQueen for magnetic-bead sorting normal CD34+ cells.
Submitted June 20, 2000; accepted January 5, 2001.
Supported in part by grants from the National Institutes of Health (PO1 CA55164, PO1 CA49639, CA78810, and HL54131); by the Keck Foundation; and by an American Cancer Society International Fellowship for Beginning Investigators (M.M.). M.A. holds the Stringer Professorship for Cancer Treatment and Research.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Michael Andreeff, Section of Molecular Hematology and Therapy, Dept of Blood and Marrow Transplantation, University of Texas M. D. Anderson Cancer Center, Box 448, 1515 Holcombe Blvd, Houston, TX 77030; e-mail: mandreef{at}notes.mdacc.tmc.edu.
1. Ambrosini G, Adida C, Altieri DC. A novel antiapoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 1997;3:917-921[CrossRef][Medline] [Order article via Infotrieve]. 2. Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J, Altieri DC. Developmentally regulated expression of the novel cancer antiapoptosis gene survivin in human and mouse differentiation. Am J Pathol. 1998;152:43-49[Abstract].
3.
Kawasaki H, Altieri DC, Lu CD, Toyoda M, Tenjo T, Tanigawa N.
Inhibition of apoptosis by survivin predicts shorter survival rates in colorectal cancer.
Cancer Res.
1998;58:5071-5074
4.
Lu CD, Altieri DC, Tanigawa N.
Expression of a novel antiapoptosis gene, survivin, correlated with tumor cell apoptosis and p53 accumulation in gastric carcinomas.
Cancer Res.
1998;58:1808-1812
5.
Tamm I, Wang Y, Sausville E, et al.
IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs.
Cancer Res.
1998;58:5315-5320
6.
Ambrosini G, Adida C, Sirugo G, Altieri DC.
Induction of apoptosis and inhibition of cell proliferation by survivin gene targeting.
J Biol Chem.
1998;273:11177-11182 7. Grossman D, McNiff JM, Li F, Altieri DC. Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J Invest Dermatol. 1999;113:1076-1081[CrossRef][Medline] [Order article via Infotrieve]. 8. Verdecia MA, Huang H, Dutil E, Kaiser DA, Hunter T, Noel JP. Structure of the human antiapoptotic protein survivin reveals a dimeric arrangement [see comments]. Nat Struct Biol. 2000;7:602-608[CrossRef][Medline] [Order article via Infotrieve]. 9. Du C, Fang M, Li Y, Li L, Wang X. Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell. 2000;102:33-42[CrossRef][Medline] [Order article via Infotrieve]. 10. Verhagen AM, Ekert PG, Pakusch M, et al. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell. 2000;102:43-53[CrossRef][Medline] [Order article via Infotrieve]. 11. Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature. 1998;396:580-584[CrossRef][Medline] [Order article via Infotrieve]. 12. Li F, Ackermann EJ, Bennett CF, et al. Pleiotropic cell-division defects and apoptosis induced by interference with survivin function. Nat Cell Biol. 1999;1:461-466[CrossRef][Medline] [Order article via Infotrieve]. 13. Fraser AG, James C, Evan GI, Hengartner MO. Caenorhabditis elegans inhibitor of apoptosis protein (IAP) homologue BIR-1 plays a conserved role in cytokinesis. Curr Biol. 1999;9:292-301[CrossRef][Medline] [Order article via Infotrieve].
14.
Li F, Flanary PL, Altieri DC, Dohlman HG.
Cell division regulation by BIR1, a member of the inhibitor of apoptosis family in yeast.
J Biol Chem.
2000;275:6707-6711 15. Speliotes EK, Uren A, Vaux D, Horvitz HR. The survivin-like C elegans BIR-1 protein acts with the Aurora-like kinase AIR-2 to affect chromosomes and the spindle midzone. Mol Cell. 2000;6:211-223[CrossRef][Medline] [Order article via Infotrieve]. 16. Reed JC, Bischoff JR. BIRinging chromosome through cell division-and survivin' the experience. Cell. 2000;102:545-548[CrossRef][Medline] [Order article via Infotrieve]. 17. Altieri DC, Marchisio PC, Marchisio C. Survivin apoptosis: an interloper between cell death and cell proliferation in cancer [published erratum appears in Lab Invest 1999;79:1543]. Lab Invest. 1999;79:1327-1333[Medline] [Order article via Infotrieve]. 18. Reed JC, Reed SI. Survivin' cell-separation anxiety. Nat Cell Biol. 1999;1:E199-E200[CrossRef][Medline] [Order article via Infotrieve]. 19. Arai KI, Lee F, Miyajima A, Miyatake S, Arai N, Yokota T. Cytokines: coordinators of immune and inflammatory responses. Annu Rev Biochem. 1990;59:783-836[CrossRef][Medline] [Order article via Infotrieve]. 20. Blalock WL, Weinstein-Oppenheimer C, Chang F, et al. Signal transduction, cell cycle regulatory, and antiapoptotic pathways regulated by IL-3 in hematopoietic cells: possible sites for intervention with anti-neoplastic drugs. Leukemia. 1999;13:1109-1166[CrossRef][Medline] [Order article via Infotrieve].
21.
Lisovsky M, Estrov Z, Zhang X, et al.
Flt3 ligand stimulates proliferation and inhibits apoptosis of acute myeloid leukemia cells: regulation of Bcl-2 and Bax.
Blood.
1996;88:3987-3997 22. Sato N, Sakamaki K, Terada N, Arai K, Miyajima A. Signal transduction by the high-affinity GM-CSF receptor: two distinct cytoplasmic regions of the common beta subunit responsible for different signaling. EMBO J. 1993;12:4181-4189[Medline] [Order article via Infotrieve]. 23. McCubrey JA, May WS, Duronio V, Mufson A. Serine/threonine phosphorylation in cytokine signal transduction. Leukemia. 2000;14:9-21[CrossRef][Medline] [Order article via Infotrieve]. 24. Townsend KJ, Trusty JL, Traupman MA, Eastman A, Craig RW. Expression of the antiapoptotic MCL1 gene product is regulated by a mitogen activated protein kinase-mediated pathway triggered through microtubule disruption and protein kinase C. Oncogene. 1998;17:1223-1234[CrossRef][Medline] [Order article via Infotrieve].
25.
Huang HM, Huang CJ, Yen JJ.
Mcl-1 is a common target of stem cell factor and interleukin-5 for apoptosis prevention activity via MEK/MAPK and PI-3K/Akt pathways [In Process Citation].
Blood.
2000;96:1764-1771 26. Tran J, Rak J, Sheehan C, et al. Marked induction of the IAP family antiapoptotic proteins survivin and XIAP by VEGF in vascular endothelial cells. Biochem Biophys Res Commun. 1999;264:781-788[CrossRef][Medline] [Order article via Infotrieve].
27.
O'Connor DS, Schechner JS, Adida C, et al.
Control of apoptosis during angiogenesis by survivin expression in endothelial cells.
Am J Pathol.
2000;156:393-398
28.
Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS Jr.
NF-
29.
Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR.
PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo.
J Biol Chem.
1995;270:27489-27494
30.
Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR.
A synthetic inhibitor of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci U S A.
1995;92:7686-7689
31.
Vlahos CJ, Matter WF, Hui KY, Brown RF.
A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002).
J Biol Chem.
1994;269:5241-5248 32. Segall H, Zhao S, Xie Z, et al. Expression of the inhibitor of apoptosis protein (IAP) family in acute and chronic leukemia blasts [abstract]. Blood. 1998;92:201.
33.
Delia D, Aiello A, Soligo D, et al.
Bcl-2 proto-oncogene expression in normal and neoplastic human myeloid cells.
Blood.
1992;79:1291-1298
34.
Kozopas KM, Yang T, Buchan HL, Zhou P, Craig RW.
MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2.
Proc Natl Acad Sci U S A.
1993;90:3516-3520 35. Barry MA, Behnke CA, Eastman A. Activation of programmed cell death (apoptosis) by cisplatin, other anticancer drugs, toxins and hyperthermia. Biochem Pharmacol. 1990;40:2353-2362[CrossRef][Medline] [Order article via Infotrieve]. 36. Sen S, D'Incalci M. Apoptosis: biochemical events and relevance to cancer chemotherapy. FEBS Lett. 1992;307:122-127[CrossRef][Medline] [Order article via Infotrieve].
37.
Ling YH, Priebe W, Perez-Soler R.
Apoptosis induced by anthracycline antibiotics in P388 parent and multidrug-resistant cells.
Cancer Res.
1993;53:1845-1852
38.
Thompson CB.
Apoptosis in the pathogenesis and treatment of disease.
Science.
1995;267:1456-1462
39.
Los M, Herr I, Friesen C, Fulda S, Schulze-Osthoff K, Debatin KM.
Cross-resistance of CD95- and drug-induced apoptosis as a consequence of deficient activation of caspases (ICE/Ced-3 proteases).
Blood.
1997;90:3118-3129
40.
Hannun YA.
Apoptosis and the dilemma of cancer chemotherapy.
Blood.
1997;89:1845-1853 41. Russell NH, Hunter AE, Bradbury D, Zhu YM, Keith F. Biological features of leukemic cells associated with autonomous growth and reduced survival in acute myeloblastic leukemia. Leuk Lymphoma. 1995;16:223-229[Medline] [Order article via Infotrieve]. 42. Smith BD, Bambach BJ, Vala MS, et al. Inhibited apoptosis and drug resistance in acute myeloid leukaemia. Br J Haematol. 1998;102:1042-1049[CrossRef][Medline] [Order article via Infotrieve]. 43. Bailly JD, Skladanowski A, Bettaieb A, Mansat V, Larsen AK, Laurent G. Natural resistance of acute myeloid leukemia cell lines to mitoxantrone is associated with lack of apoptosis. Leukemia. 1997;11:1523-1532[CrossRef][Medline] [Order article via Infotrieve]. 44. Norgaard JM, Jensen PD, Bendix K, Clausen N, Palshof T. Relevance of in vitro leukemia cell survival to short- and long-term clinical outcome in AML. Leuk Lymphoma. 1999;32:327-337[Medline] [Order article via Infotrieve]. 45. LaCasse EC, Baird S, Korneluk RG, MacKenzie AE. The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene. 1998;17:3247-3259[CrossRef][Medline] [Order article via Infotrieve]. 46. Uren AG, Coulson EJ, Vaux DL. Conservation of baculovirus inhibitor of apoptosis repeat proteins (BIRPs) in viruses, nematodes, vertebrates and yeasts. Trends Biochem Sci. 1998;23:159-162[CrossRef][Medline] [Order article via Infotrieve].
47.
Tamm I, Segall H, Kitada S, et al.
Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias.
Clin Cancer Res.
2000;6:1796-1803 48. Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC. Anti-apoptosis gene, survivin, and prognosis of neuroblastoma [letter]. Lancet. 1998;351:882-883[CrossRef][Medline] [Order article via Infotrieve]. 49. Tanaka K, Iwamoto S, Gon G, Nohara T, Iwamoto M, Tanigawa N. Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res. 2000;6:127-134 |