| |
|
|
|
|
|
|
|||
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Platelet Biology and the Product Development
Departments, American Red Cross, Rockville, MD.
Experimental and clinical data suggest the presence of multiple
types of adenosine diphosphate (ADP) receptors, one coupled to
ligand-gated cation channels (P2X) and others coupled to
G-protein-coupled (P2Y) receptors. This report
identifies cDNA for a structurally altered
P2X1-like receptor in megakaryocytic cell lines (Dami and
CMK 11-5) and platelets that, when transfected into nonresponsive 1321 cells, confers a specific sensitivity to ADP with the pharmacologic rank order of ADP > > ATP > > > Adenosine diphosphate (ADP) is known to play a key
role in the development and extension of arterial thrombosis, the
deposition of platelets onto collagen under flow conditions,
collagen-induced aggregation, and the stabilization of thrombin-induced
human platelet aggregates independent of fibrinogen binding to
GPIIb/IIIa, and it plays an important role in irreversible aggregation
induced by PAR-1.1-5 Reduced thrombus formation is
observed when platelets from patients with storage pool deficiency are
exposed to vascular subendothelium and when removal of ADP from
blood-perfusing damaged arteries results in increased bleeding
times.4,6 Platelet aggregation is impaired in 2 patients
with a congenital defect of platelet response to ADP,1,7
further demonstrating that released ADP plays an important role in
platelet activation though the mechanism of activation has not been
elucidated. Significantly, inhibitors of ADP-induced aggregation are
effective antithrombotic drugs.8,9
Two subclasses of purinergic receptors have been described:
P2Y metabotropic receptors coupled to heterotrimeric
G-proteins and P2X ion channel receptors. Evidence has been
provided for 2 distinct G-protein-coupled receptors in human
platelets, one coupled to the inhibition of stimulated adenylate
cyclase (the P2YAC receptor) and the other a
P2Y1 receptor (the P2TPLC receptor) coupled to
the activation of phospholipase C.10-12 The
P2TAC (or P2YAC) receptor, now termed the
P2Y12 receptor, has been recently identified.13 AR-C69096, an adenosine triphosphate (ATP)
analog, is a selective inhibitor of ADP-induced platelet aggregation
that antagonizes ADP-induced activation through the P2Y12
receptor.14 ATP is a competitive inhibitor of ADP-induced
aggregation and adenylyl cyclase inhibition.15 A model for
the activation of platelets by ADP involving a 3-receptor model has
been proposed10-12 and is a refinement of the
model16 involving rapid calcium influx mediated by a
receptor-operated Ca++ channel, whereas adenylyl cyclase
inhibition and intracellular Ca++ mobilization are mediated
by a single P2Y receptor involving multiple G proteins. The
crucial role of heterotrimeric G proteins has been demonstrated by
using platelets from P2Y1-null mice17,18 and
in G In platelets, the presence of P2X1 receptors and mRNA has
been reported using polymerase chain reaction (PCR), Fura-2-measured Ca++ influx, protein blotting,21-26 and
activation by We have previously demonstrated that ADP and ADP- Reagents and solutions
RNA isolation and polymerase chain reaction
amplification
Specific amplification of the P2X1del cDNA from platelets To selectively amplify P2X1del cDNA, 2 primers were used sense primer 711ACATCCCGCGC-ATCAGCT (the dashes
indicate where the 51-bp-deleted cDNA sequence would be observed in
the P2X1wt receptor) and the antisense primer
1082GCCTGGCAAACCTGAAGTTG. The first primer contains a 5'
11-base sequence and a 3' 7-base sequence that span the deleted
51-base sequence and are found only in the P2X1del cDNA. An
expected PCR amplicon is calculated to measure 371 bp (Figure
1C). This PCR primer pair was used to
amplify a 371 bp band from cDNA isolated from platelets and from a
400-bp partial P2X1del cDNA sequence (amplified using the
primers described in the preceding paragraph) inserted into the pCRII
plasmid. For high-stringency conditions, 35 PCR cycles using the
annealing temperature of 60°C were performed.
In vitro transcription-translation 35S-methionine-labeled receptors were prepared from the P2X1wt and P2X1del pcDNA3.1 plasmids using a coupled TnT (Promega, Madison, WI) transcription-translation (reaction time, 75 minutes) and were immunoprecipitated with the MAP anti-P2X1 antibody (described below) or subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography. Both glycosylated and nonglycosylated receptor forms generated from both plasmids using the TnT (Promega) system were immunoprecipitated with the anti-hP2X1 antibody, which is directed against a common GKAKRK peptide sequence (data not shown).Preparation of anti-human P2X1 receptor antibody An octavalent core matrix of a multiple antigenic peptide (human, [h]) was used to generate an anti-GKAKRKAQGIRTGF polyclonal antibody (anti-hP2X1 pAb) and was used directly for injection as the immunogen. Analysis of the purity of the peptide by reversed phase high-performance liquid chromatography confirmed the stoichiometry of the composite amino acids. Rabbits (male New Zealand White) were bled (preinjection sample) before intradermal injections of 200 µg emulsified MAP antigen in 600 µL PBS mixed with 600 µL Freund complete adjuvant. After booster injections at 14, 28, 56, and 84 days, total IgG was isolated using protein G-Sepharose columns, and IgG was eluted with 0.1 M glycine, pH 2.5, and 0.15 M NaCl and immediately neutralized with 1.0 M Tris, pH 8.0. Before use, antibodies were dialyzed against PBS.Immunoprecipitation and Western blot analysis of P2X receptors For immunoprecipitation experiments, surface-biotinylated (20 µM sulfo-NHS-biotin-SO3 (Pierce, Rockford, IL) 1321 cells transfected with either the P2X1wt or P2X1del receptors were solubilized in RIPA buffer (0.05 M Tris-HCl, pH 7.4, 150 mM NaCl, 1.0% Nonidet P-40, 0.25% deoxycholate, 1 mM EDTA, 1 mM EGTA, 1 mM PMSF, 200 mM Na3VO4, and 1 µg/mL each of aprotonin, leupeptin, and pepstatin). Native Dami, CMK 11-5, or CMK cells were treated similarly. Surface-labeled receptors were immunoprecipitated with the anti-P2X1 pAb (5 µg total IgG) and complexed with protein A/G beads, and supernatants were analyzed under reducing conditions on 7% SDS-PAGE gels. After overnight electrophoretic transfer to nitrocellulose (30 mA, 18 hours; 300 mA, 2-3 hours), surface-labeled and precipitated antigens were detected by a streptavidin-horseradish peroxidase (1:20 000 dilution) enhanced chemiluminescence method. For Western blotting experiments, proteins on nitrocellulose membranes were recognized with 2.5 µg/mL anti-C-terminus anti-P2X1 receptor antibody.21 Bound antibody was visualized by a goat-antirabbit-HRP-conjugated secondary antibody and the enhanced chemiluminescence method. Protein molecular weights were compared to Rainbow (Amersham, Arlington Heights, IL) prestained markers.Flow cytometry Flow cytometry36 confirmed the surface expression of a P2X1 receptor(s) using both the anti-hP2X1 antibody (described above) and an anti-rat P2X1 antibody (kindly provided by Dr Julian Barden, University of Sydney, Australia) directed against an identical amino acid sequence in the human receptor. Both Dami cells and CMK 11-5 cells demonstrated binding of both antibodies (data not shown).Cell transfection Astrocytoma cells (1321N1; kindly provided by Dr Myron Toews, University of Nebraska) were maintained in a low-glucose (1 g/L) Dulbecco modified Eagle medium (DMEM) buffer (Gibco-BRL) supplemented with 3.7 g NaHCO3/L at 37°C and 5% CO2. Transfection reactions in the presence of Opti-MEM (Gibco-BRL) used 2 µg circular plasmid DNA and 10 µL Lipofectamine (Gibco-BRL) for 12 hours at 37°C. Complete medium was added for 24 hours. Cells were then removed with trypsin-EDTA for replating onto 100-mm Petri dishes (Falcon 3803), and 600 µg/mL Geneticin (G418) was added for selection. After selection for 12 to 30 days, individual colonies of cells were isolated using cloning cylinders. Stably transfected 1321 cells, maintained in 240 µg/mL G418, were grown to 100% confluency for 2 to 5 days on coverslips coated with 0.2% gelatin (Bio-Rad, Hercules, CA) dissolved in PBS. Four P2X1wt clones (W1, W2, W3, W4) and 5 P2X1del clones (DL1, DL2, DL3, DL4, DL5) were further characterized in this report.Intracellular Ca++ influx For Ca++ influx studies, adherent cells on coverslips were incubated for 30 to 60 minutes at 37°C in 1 mL DMEM media with 2.5 µM Fura-2 acetoxymethyl ester dissolved in dimethyl sulfoxide before a single exchange of DMEM-Tyrode-HEPES buffer as previously described.21,22,24,25,37,38 Ca++ influx was measured with single monolayers (0.6 × 1.1 cm) of adherent nontransfected or transfected 1321 cells in a Time Drive program with a PerkinElmer LS50B fluorometer ( ex 340 nm
and em 510 nm, slit widths 10 nm in matched quartz
cuvettes). This program is approximately 10 times more sensitive than
the Intracellular Biochemistry program (Perkin Elmer, Buckinghamshire,
England) and has been validated in work with the P2X1
receptor.21,22,24-26 Ca++ influx is shown in
arbitrary linear units of Fura-2 emission measured at 510 nm.
Fura-2-labeled cells in 1.2 mL Tyrode-HEPES, pH 7.4 buffer were
incubated with 2 mM Ca++ before the addition of reagents
under high-stirring conditions (approximately 1000 rpm). Of importance,
there was no Ca++ influx to ADP or ATP in the absence of
exogenous Ca++ or using nontransfected 1321 cells,
demonstrating that Ca++ influx with transfected cells
results only from the activation of expressed receptors. Purinergic
receptor inhibitors were incubated with cells for 1 minute before the
addition of nucleotides. Results show qualitative comparisons between
P2X1wt and P2X1del receptors and the
concentrations of nucleotides used to activate the receptors. In all
experiments (200-240 seconds), nucleotide agonists were sequentially
added, and then 50 µM carbachol, a muscarinic agonist, was added to
elicit a positive standard response from its endogenous receptor. The
addition of digitonin, as used in previous
experiments32,36-38 to permeabilize cells to obtain
maximal Ca++ concentrations for calibration curves, removed
adherent cells from the coverslips and therefore maximum and minimum
Ca++ concentrations were not determined.
This Ca++ influx method measures the total cumulative Ca++ signal for the entire population of adherent cells, not for an individual cell as in the electrophysiological method. Although the method is incapable of resolving the kinetics of influx of Ca++ through the opening and closing of individual receptor gates, the method is capable of measuring the cumulative signals from many adherent activated cells. Our expectations are that the action potentials generated by the Fura-2 method and the electrophysiological method would be different because Fura-2 measures the mass action of Ca++ influx by averaging the values from many intact cells. Fura-2 is distributed in the cytoplasm and is not localized as the electrophysiological measurements. Therefore, it is expected that the Fura-2 method will be slower in the time-course of activation, and this reflects the slower diffusion of the agonist over the cell surfaces. Because we are using Fura-2 to relate qualitative differences (and are not measuring quantitative kinetic results), this method is valid to measure Ca++ influx from many cells. In addition, the Fura-2 method has been successfully used and reported for comparative studies of P2X1 receptors.21,22,25,26,30,31 Traces in Figures 4C and 4D show only the initial activation time of 30 seconds, whereas in other studies,21,22,25,26 the figures are displayed over 200 to 300 seconds; these different presentations result in significant differences in the appearance of the activation profiles.
PCR amplification of P2X1 homologs PCR amplification was carried out using mRNA from Dami cells, CMK, CMK 11-5 cells, and platelets in reactions containing nondegenerate primers based on a human urinary bladder P2X1 receptor (accession number, X83688).27 Primers (5' sense 603ATCCGCACGGGCAAGTGTGT and 3' antisense 1059GCCTGGCAAACCTGAAGTTG) were selected to amplify approximately one third of the 1200-bp open-reading frame (ORF) in the extracellular portion of the P2X1 wild-type (P2X1wt) receptor (450 bp) and, in addition, yielded a band of 400 bp. Subcloning and sequencing (Figure 1A) revealed these 2 related clones27,28 and, most important, directly demonstrated the presence of multiple mRNAs for these receptors in these cells (Figure 1B). The 400-bp band (designated the P2X1 deletion clone or P2X1del) has a 51-bp in-frame deletion and would correspond to the deletion of 17 amino acids PALLREAENFTLFIKNS (calculated MWt, 1961) in the extracellular domain. This region is flanked by 5' and 3' ORF sequences identical to the P2X1wt receptor (Figure 1A). PCR amplification of CMK 11-5-derived mRNA (and mRNA from Dami cells; data not shown) showed equal or slightly greater amplification of the 450-bp (P2X1wt clone) than the 400-bp P2X1del band. In contrast, platelets demonstrated a greater proportion of the P2X1del 400-bp amplicon (Figure 1B) with apparent, but reduced, P2X1wt 450-bp amplicon levels.Using the primer pair identified in "Materials and methods" (Figure 1C), a single band of approximately 350 to 375 bp (expected size, 371 bp) was amplified using platelet cDNA (Figure 1D, lane 1) or with a pcDNA3.1 plasmid containing a partial 400-bp P2X1del cDNA (Figure 1D, lane 2). In the P2X1wt cDNA, the 11- and 7-base sequences comprising the sense primer (Figure 1C) are separated by 51 bases that have been deleted in the P2X1del cDNA (Figure 1C); therefore, the 11- and 7-base sequences form a linear 18-base sequence for primer annealing only in P2X1del cDNA. When pcDNA3.1 plasmids containing the entire ORF of the
P2X1wt and P2X1del clones were transcribed and
translated in vitro, differences were observed in the molecular
size of translated protein, whether in the presence of microsomes to
effect glycosylation (Figure 2;
P2X1wt +, lane 1; P2X1del +, lane 2) or in
their absence (P2X1wt
P2X1wt and P2X1del receptors are surface expressed A single band of 67 kd was immunoprecipitated from stably transfected 1321 cells expressing either P2X1wt (Figure 3, lane 2) or P2X1del (Figure 3, lanes 4 and 6) receptors using a polyclonal anti-hP2X1 antibody, and this apparent molecular size was identical to that found in identically prepared surface-biotinylated Dami cells (Figure 3, lane 8), CMK 11-5 cells (lane 10), or CMK cells (lane 11). Most important, no apparent size difference was observed between the single protein that was immunoprecipitated from these preparations. These experiments demonstrated the specificity of the antibody receptor interaction (lanes 2, 4, 6, 8, 10, 11). Proteins were not immunoprecipitated using preimmune antisera (lanes 1, 3, 5, 7, 9); these immunoprecipitation results were corroborated using an anti-rat P2X1 antibody39 (data not shown). These results are from different SDS-PAGE gels, but chromatography of biotin-labeled P2X1wt and P2X1del receptors in adjacent lanes showed no significant differences in size.
P2X1wt and P2X1del receptors are equivalent in molecular size In addition, Western blot analysis with an anti-human P2X1 polyclonal antibody directed against the C terminus of the human P2X1 receptor21 (kindly provided by Drs George Dubyak and Karen Parker, Case Western Reserve University, Cleveland, OH) showed an identically sized 60-kd band comparing Dami cells with P2X1wt- and P2X1del-transfected 1321 cells, whereas nontransfected 1321 cells were negative (data not shown). As with the immunoprecipitation experiments (Figure 3), no apparent differences were noted in the molecular size of the single blotted protein band.Selective activation of Ca++ influx by ADP in P2X1del receptors Both ATP and ADP activated Ca++ influx to comparable levels, as shown in dose-response curves of P2X1wt-receptor transfectants (Figure 4A). In contrast, a direct comparison of dose-response curves using 1321 cells expressing the P2X1del receptor demonstrated a 10- to 30-fold increased sensitivity of the P2X1del receptor to ADP when compared to activation by ATP (Figure 4B); 2-methylthio-ADP (30 µM) caused Ca++ influx to a similar extent as for ADP (data not shown). The rightward shift in the dose-response curve for the activation by ATP resulted from both the reduced amount of Ca++ influx and the increased time required to reach peak influx. Differences in the rate of Ca++ influx between ATP and ADP demonstrated the increased sensitivity of the P2X1del receptor to activation by ADP and was particularly evident at concentrations as low as 3 µM (Figure 4B).
No activation by ATP is apparent until 3 µM or greater (Figure 4C), although activation of P2X1del-transfected cells is apparent at 0.3 and 1 µM ADP (Figure 4D, curves 1 and 2). A marked delay (relative to ADP) is observed during ATP activation that is only partially reduced by increasing the nucleotide concentration to 10 µM (Figure 4C) or even 30 µM (not shown). These results were observed for 4 P2X1del clones. Note that these profiles show the first 30 seconds of Ca++ influx. Sequential exposure of P2X1wt receptors (shown for the W1 clone) to nucleotides (Figure 4E) demonstrated that the addition of both ATP (30 µM) and ADP (30 µM) activated Ca++ influx. In contrast, activation of P2X1del receptors (shown for the DL4 clone) by ADP (30 µM) was not followed by any Ca++ influx elicited by ATP (30 µM) (Figure 4F). Carbachol (C) was added to confirm Fura-2 labeling of the adherent monolayers. P2X1del receptors are not activated by
, -methylene-ATP (100 µM,
column 5) before ADP (30 µM, column 6). Data in Figure 5, expressed
as the rate of influx, is summarized for 3 individual P2X1del receptor clones (designated DL1, DL2, and DL5)
expressed in 1321 cells. ADP (30 µM) induced a rapid peak of
Ca++ influx (column 1), yet a secondary addition of ATP (30 µM) or ADP (30 µM) was completely ineffective at causing further
Ca++ influx. Primary exposure to ATP (column 3) acted as a
weak agonist, but this maximal activation required an increased time
compared to the more rapid peak influx of Ca++ by ADP
(Figure 4C). In contrast to the absent secondary activation by ATP
after the addition of ADP (column 2), a secondary addition of ADP after
the primary addition of ATP (column 4) continued to be effective at
causing the influx of a secondary but significantly reduced peak of
Ca++. In experiment 3 and in contrast to the results
observed with the primary addition of ATP (column 3), the primary
addition of , -methylene-ATP (100 µM) was completely ineffective
at causing Ca++ influx (column 5). In addition, this prior
exposure of the cells to , -methylene-ATP did not affect the
Ca++ influx elicited by 30 µM ADP (column 6).
2-Methylthio-ADP at 30 µM caused Ca++ influx with a
potency equivalent to that of ADP using the P2X1del transfected cells (data not shown).
It must be noted that despite the weak activation of the
P2X1del receptor by higher concentrations of ATP, as shown
in Figure 4C, the rate of ATP-induced activation (expressed as the peak Ca++ mobilization measured at 510 nm [arbitrary units]
divided by the time required for maximum activation or expressed as
U/s) was significantly prolonged compared with activation by ADP
(Figure 4D). ADP-induced Ca++ influx is more rapid than
ATP-induced Ca++ influx; the latter requires 2- to 3-fold
more time, and this is reflected in rate values only approximately one
third of the ADP-induced maximum rate. For example, with the
P2X1del receptor, the activation rate for 30 µM ADP
(7.2 ± 2.0 U/s) is significantly greater than that observed with 30 µM ATP (1.1 ± 0.67 U/s), reflecting both the increased time
required for ATP activation and the reduced overall peak of
Ca++ influx (Figure 5). Prior exposure to 30 µM ATP
decreased the secondary activation of Ca++ influx by 30 µM ADP to 1.3 ± 1.0 U/s, a reduction of 85%. The nonhydrolyzable
ATP analog These quantitative differences are not the result of differences in the surface expression of the transfected receptors, in contrast to results with a P2X2 receptor, in which densensitization40 or surface expression41 is dependent on the extent of glycosylation. In the current study, using equivalent cell numbers, the intensity of the immunoprecipitated band at 67 kd and the Western blotted band at 60 kd were similar, demonstrating that similar levels of P2X1wt and P2X1del receptors were surface expressed. Purinergic receptor antagonists block Ca++ influx induced by ADP To compare the pharmacology of Ca++ mobilization by the P2X1del receptors, experiments were conducted in the presence of suramin (a P2 antagonist), PPADS (a P2X antagonist), or SK&F 96365 (which antagonizes fast, responsive ion channels)42,43 (Figure 6). Prior exposure of P2X1del or P2X1wt-transfected cells to PPADS, suramin, or SK&F 96365 neither of which caused Ca++ influx resulted in
reduced responses to activation by ADP for P2X1del (Figure
6) and ATP for P2X1wt (data not shown) receptors. For the
P2X1del receptor, SK&F 96365 at 80 µM inhibited
Ca++ influx by 30 µM ADP (column 1) by 95% or more
(Figure 6, column 2), whereas PPADS (at 30 µM and 100 µM) inhibited
30 µM ADP-induced peak Ca++ influx by 75% and 96%
(columns 3 and 4), respectively. Suramin at 100 µM
inhibited Ca++ influx by 75% (Figure 6, column 5). As with
intact platelets,37 Ca++ mobilization was
inhibited by 30 µM ATP- -S which, by itself, induced a slow
increase in rate of activation, comparable to that for ATP (data
not shown).
The current study shows that several megakaryocytic cell lines contain a P2X1-like receptor in which there is a deletion of a 17-amino acid extracellular sequence. We have termed this the P2X1del receptor. Expression of the P2X1del receptor in 1321 cells confers a selective sensitivity to ADP and 2-methylthioADP, in contrast to expression of the P2X1wt receptor in which both ATP and ADP induce Ca++ influx. These pharmacologic changes may reflect conformational changes in the P2X1del receptor resulting from the loss of the 17-amino acid extracellular sequence normally observed in the P2X1wt receptor. The loss of the N708FT glycosylation site and the amino acid sequence that separates 2 species-conserved extracellular cysteine-folding domains in the deleted peptide, based on amino acid sequence alignment of 7 known members of the rat P2X receptor family,39 may result in these changes. Antagonism of Ca++ influx (Figure 6) demonstrates that the structure of the P2X1del receptor retains the ability to interact with purinergic receptor inhibitors (PPADS,44 suramin,45,46 or SK&F 9636542), despite structural changes that result in altered pharmacologic responses. Peptide-sequence alignment of known P2X2 and P2X7 receptors also revealed that the deleted PALLREAENFTLFIKNS sequence corresponds to exon 6 and may be a naturally occurring variant of P2X1 receptors possibly generated by alternative splicing, as observed in the pituitary and cochlea.47 These conformational changes in the P2X1del receptor may affect the oligomerization of the receptor subunits, but they do not affect its quantitative expression because P2X1wt and P2X1del receptors are expressed in equal amounts in transfected 1321 cells. Using PCR primers restricted to the 5' region of the P2X1wt
receptor, we have identified P2X1del and P2X1wt
receptor RNA in megakaryocytic cell lines and platelets and showed by
DNA sequencing that the latter is identical to the previously described
P2X1wt receptor.27,28 These results differ
from those previously obtained using PCR primers designed to amplify
cDNA corresponding to the entire extracellular domain of the
P2X1wt receptor that indicate the preferential
amplification of a P2X1wt receptor.26 ATP and Although it is possible that the P2X1 ADP receptors
expressed on megakaryocytes consist of both P2X1wt and
P2X1del subunits, it is clear from the current study that
expression of the P2X1del receptor alone in 1321 cells is
sufficient to effect sensitive and preferred activation by ADP. The
inability of Pharmacologic evidence indicates that platelets express several types
of nucleotide receptors. The P2Y1 (or the
P2TPLC) receptor is coupled to Gq proteins,
activates Ca++ mobilization, and mediates platelet shape
change and aggregation.10-12 The involvement of the
P2Y1 receptor and the pathway involving the Gq
protein in ADP-induced platelet activation was investigated using
knockout mice for the P2Y1 receptor and the
G We propose that previous reports of P2X1 receptors on platelets21,22,24-26 have actually been recognizing both the P2X1wt receptor and the P2X1del receptor identified in this report: (1) the P2X1wt (399 amino acids) and P2X1del (382 amino acids) receptors in glycosylated form have identical electrophoretic mobilities and are not distinguishable by Western blotting or immunoprecipitation techniques using surface-biotinylated native megakaryocytic cell lines or transfected cells containing P2X1wt or P2X1del receptors; and (2) the available anti-P2X1 receptor antibodies target amino acid sequences that are common to both receptor forms and, therefore, fail to differentiate between the P2X1wt and P2X1del receptors. In the literature, slight size differences between P2X1wt receptors and cross-reactive proteins have been previously noted.21,24 Specifically, an antibody recognizing a 60-kd P2X1 receptor with transiently transfected 293T cells cross-reacts with a more abundant smaller protein of 55 to 57 kd in purified human platelets.24 Similarly, the rat vas deferens P2X1wt receptor is larger than the cross-reactive human platelet protein, even though the rat and the human P2X1 receptors have identical (399-amino acid) ORFs. We hypothesize that in both of these reports, the smaller protein recognized by the anti-P2X1 antibody is the P2X1del receptor identified in the current study. In summary, the current study shows that stable expression of the P2X1del receptor in 1321 cells confers a preferential activation by ADP resulting in Ca++ influx and that this receptor is expressed in megakaryocytic cell lines and platelets and may be involved in ADP-induced platelet activation.
The authors express their appreciation for the generous contributions of their colleagues, including Drs H. Tran, M. Rinaudo, E. Gubina, R. Friesel, and W. Burgess; Sharon Brown; Donna Sobieski; E. Szylobryt (for MAP peptide synthesis); and Ni Yasong.
Submitted June 5, 2000; accepted February 12, 2001.
Supported by United States Public Health Service Merit Award HL 39438 (G.A.J.). Supported in part by the A. Bianchi Bonomi Foundation, Milan, Italy (G.T.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Nicholas J. Greco, Jerome H. Holland Laboratories, American Red Cross, 15601 Crabbs Branch Way, Rockville, MD 20855; e-mail: greco{at}usa.redcross.org.
1.
Cattaneo M, Canciani MT, Lecchi A, et al.
Released adenosine diphosphate stabilizes thrombin-induced human platelet aggregates.
Blood.
1990;75:1081-1086
2.
Trumel C, Payrastre B, Plantavid M, et al.
A key role of adenosine diphosphate in the irreversible platelet aggregation induced by the PAR-1 activating peptide through the late activation of phosphoinositide 3-kinase.
Blood.
1999;94:4156-4165 3. Cattaneo M, Gachet C. ADP receptors and clinical bleeding disorders. Arterioscler Thromb Vasc Biol. 1999;10:2281-2285. 4. Cattaneo M. Hereditary defect of the platelet ADP receptor(s). Platelets. 1998;8:161-164[CrossRef]. 5. Cusack NJ, Hourani SM. Platelet P2 receptors: from curiosity to clinical targets. J Auton Nerv Syst. 2000;81:37-43[CrossRef][Medline] [Order article via Infotrieve]. 6. Rao AK. Congenital disorders of platelet function: platelets in health and disease. Hematol Oncol Clin North Am 1990;4:65-82[Medline] [Order article via Infotrieve]. 7. Levy-Toledano S, Maclouf J, Rosa JP, et al. Abnormal tyrosine phosphorylation linked to a defective interaction between ADP and its receptor on platelets. Thromb Haemost. 1998;80:463-468[Medline] [Order article via Infotrieve]. 8. Schror K. The basic pharmacology of ticlopidine and clopidogrel. Platelets. 1993;4:252-261[CrossRef]. 9. Humphries RG, Robertson MJ, Leff P. A novel series of P2T purinoceptor antagonists: definition of the role of ADP in arterial thrombosis. Trends Pharmacol Sci. 1995;16:179-181[CrossRef][Medline] [Order article via Infotrieve].
10.
Daniel JL, Dangelmaier C, Jin J, Ashby B, Smith JB, Kunapuli SP.
Molecular basis for ADP-induced platelet activation, I: evidence for three distinct ADP receptors on human platelets.
J Biol Chem.
1998;273:2024-2029
11.
Jin J, Daniel JL, Kunapuli SP.
Molecular basis for ADP-induced platelet activation, II: the P2Y1 receptor mediates ADP-induced intracellular calcium mobilization and shape change in platelets.
J Biol Chem.
1998;273:2030-2034 12. Kunapuli SP. Multiple P2 receptor subtypes on platelets: a new interpretation of their function. Trends Pharmacol Sci. 1998;19:391-394[CrossRef][Medline] [Order article via Infotrieve]. 13. Hollopeter G, Jantzen H-M, Vincent D, et al. Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature. 2001;409:202-207[CrossRef][Medline] [Order article via Infotrieve]. 14. Humphries RG, Tomlinson W, Ingall AH, Cage PA, Leff P. FPL 66096: a novel, highly potent and selective antagonist at human platelet P2T-purinoceptors. Br J Pharmacol. 1994;113:1057-1063[Medline] [Order article via Infotrieve].
15.
Macfarlane DE, Mills DCB.
The effects of ATP on platelets: evidence against the central role of released ADP in primary aggregation.
Blood.
1975;46:309-320 16. Hourani SM, Hall DA. Receptors for ADP on human blood platelets. Trends Pharmacol Sci. 1994;15:103-108[CrossRef][Medline] [Order article via Infotrieve]. 17. Fabre J-E, Nguyen MT, Latour A, et al. Decreased platelet aggregation, increased bleeding time and resistance to thromboembolism in P2Y1-deficient mice. Nat Med. 1999;5:1199-1202[CrossRef][Medline] [Order article via Infotrieve]. 18. Leon C, Hechler B, Freund M, et al. Defective platelet aggregation and increased resistance to thrombosis in purinergic P2Y1 receptor-null mice. J Clin Invest. 1999;104:1731-1737[Medline] [Order article via Infotrieve].
19.
Offermanns S, Toombs CF, Hu YH, Simon MI.
Defective platelet activation in G
20.
Ohlmann P, Eckly A, Freund M, Cazenave J-P, Offermanns S, Gachet C.
ADP induces partial platelet aggregation without shape change and potentiates collagen-induced aggregation in the absence of G
21.
Clifford EE, Parker K, Humphreys BD, Kertesy SB, Dubyak GR.
The P2X1 receptor, an adenosine triphosphate-gated cation channel, is expressed in human platelets but not in human blood leukocytes.
Blood.
1998;91:3172-3181
22.
MacKenzie AB, Mahaut-Smith MP, Sage SO.
Activation of receptor-operated cation channels via P2X1 not P2T purinoceptors in human platelets.
J Biol Chem.
1996;271:2879-2881 23. Greco NJ, Chen W, Tonon G. Identification of alternative forms of a P2X1 receptor in platelets and megakaryocytic cells [abstract]. Blood. 1997;90:284. 24. Scase TJ, Heath MF, Allen JM, Sage SO, Evans RJ. Identification of a P2X1 purinoceptor expressed on human platelets. Biochem Biophys Res Comm. 1998;242:525-528[CrossRef][Medline] [Order article via Infotrieve].
25.
Sun B, Li J, Okahara K, Kambayashi JI.
P2X1 purinoceptor in human platelets: molecular cloning and functional characterization after heterologous expression.
J Biol Chem.
1998;273:11544-11547 26. Vial C, Hechler B, Leon C, Cazenave JP, Gachet C. Presence of P2X1 purinoceptors in human platelets and megakaryocytic cell lines. Thromb Haemost. 1997;78:1500-1504[Medline] [Order article via Infotrieve]. 27. Valera S, Hussy N, Evans RJ, et al. A new class of ligand-gated ion channel defined by P2X receptor for extracellular ATP. Nature. 1994;371:516-519[CrossRef][Medline] [Order article via Infotrieve]. 28. Brake AJ, Wagenbach MJ, Julius D. New structural motif for ligand-gated ion channels defined by an ionotropic ATP receptor. Nature. 1994;371:519-523[CrossRef][Medline] [Order article via Infotrieve]. 29. Sage SO, Reast R, Rink TJ. ADP evokes biphasic Ca2+ influx in fura-2-loaded human platelets. Biochem J. 1990;265:675-680[Medline] [Order article via Infotrieve]. 30. Rolf MG, Mahaut-Smith MP. Functional roles of P2X1 purinoceptors in human platelets. Biophys J. 2000;78:PO423. 31. Mahaut-Smith MP, Ennion SJ, Rolf MG, Evans RJ. ADP is not an agonist at P2X(1) receptors: evidence for separate receptors stimulated by ATP and ADP on human platelets. Br J Pharmacol. 2000;131:108-114[CrossRef][Medline] [Order article via Infotrieve].
32.
Greco NJ.
Functional expression of a P2T ADP receptor in Xenopus oocytes injected with megakaryocyte (CMK 11-5) RNA.
Arterioscler Thromb Vasc Biol.
1997;17:769-777 33. Newman PJ, Gorski J, White GC II, Gidwitz S, Cretney CJ, Aster RH. Enzymatic amplification of platelet-specific messenger RNA using the polymerase chain reaction. J Clin Invest. 1988;82:739-743.
34.
Greenberg SM, Rosenthal DS, Greeley TA, Tantravahi R, Handin RI.
Characterization of a new megakaryocytic cell line: the Dami cell.
Blood.
1988;72:1968-1977
35.
Handin RI.
DAMI cell line.
Blood.
1997;89:4238
36.
Greco NJ, Tandon NN, Jones GD, et al.
Contributions of glycoprotein Ib and the seven transmembrane domain receptor to increases in platelet cytoplasmic [Ca2+]i induced by
37.
Greco NJ, Yamamoto N, Jackson BW, Tandon NN, Moos M, Jamieson GA.
Identification of a nucleotide binding site on glycoprotein Ib: relationship of ADP-induced platelet activation.
J Biol Chem.
1991;266:13627-13633
38.
Greco NJ, Tandon NN, Jackson BW, Jamieson GA.
Low structural specificity for nucleotide triphosphates as antagonists of ADP-induced platelet aggregation.
J Biol Chem.
1992;267:2966-2970 39. Hansen MA, Barden JA, Balcar VJ, Keay KA, Bennett MR. Structural motif and characteristics of the extracellular domain of P2X receptors. Biochem Biophys Res Comm. 1997;236:670-675[CrossRef][Medline] [Order article via Infotrieve]. 40. Brandle P, Spielmanns R, Osteroth J, et al. Desensitization of the P2X2 receptor controlled by alternative splicing. FEBS Lett. 1997;404:294-298[CrossRef][Medline] [Order article via Infotrieve]. 41. Torres GE, Egan TM, Voigt MM. N-linked glycosylation is essential for the functional expression of the recombinant P2X2 receptor. Biochemistry. 1998;37:14845-14851[CrossRef][Medline] [Order article via Infotrieve]. 42. Merritt JE, Armstrong WP, Benham CD, et al. SK&F 96365, a novel inhibitor of receptor-mediated calcium entry. Biochem J. 1990;271:515-522[Medline] [Order article via Infotrieve].
43.
Mahaut-Smith MP, Sage SO, Rink TJ.
Rapid ADP-evoked currents in human platelets recorded with the nystatin permeabilized patch technique.
J Biol Chem.
1992;267:3060-3065 44. Windscheif U, Radziwon P, Breddin HK, Baumert HG, Lambrecht G, Mutschler E. Two different inhibitory effects of pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid on adenosine diphosphate-induced human platelet aggregation. Arzneimittelforschung. 1995;45:994-999[Medline] [Order article via Infotrieve]. 45. Hourani SM, Hall DA, Nieman CJ. Effects of the P2-purinoreceptor antagonist, suramin, on human platelet aggregation induced by adenosine 5'-diphosphate. Br J Pharmacol. 1992;105:453-457[Medline] [Order article via Infotrieve]. 46. Hall DA, Hourani SM. Effects of suramin on increases in cytosolic calcium and on inhibition of adenylate cyclase induced by adenosine 5'-diphosphate in human platelets. Biochem Pharmacol. 1994;47:1013-1018[CrossRef][Medline] [Order article via Infotrieve]. 47. Housley GD, Greenwood D, Bennett T, Ryan AF. Identification of a short form of the P2X1R1-purinoceptor subunit produced by alternative splicing in the pituitary and cochlea. Biochem Biophy Res Comm. 1995;212:501-508[CrossRef][Medline] [Order article via Infotrieve]. 48. Sage SO, MacKenzie AB, Jenner S, Mahaut-Smith MP. Purinoceptor-evoked calcium signalling in human platelets. Prostaglandins Leukot Essent Fatty Acids. 1997;57:435-438[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
K. Kawa Discrete but simultaneous release of adenine nucleotides and serotonin from mouse megakaryocytes as detected with patch- and carbon-fiber electrodes Am J Physiol Cell Physiol, January 1, 2004; 286(1): C119 - C128. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Rosa P2X1: definitely not an ADP receptor Blood, November 15, 2003; 102(10): 3466 - 3467. [Full Text] [PDF] |
||||
![]() |
C. Vial, S. J. Pitt, J. Roberts, M. G. Rolf, M. P. Mahaut-Smith, and R. J. Evans Lack of evidence for functional ADP-activated human P2X1 receptors supports a role for ATP during hemostasis and thrombosis Blood, November 15, 2003; 102(10): 3646 - 3651. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. North Molecular Physiology of P2X Receptors Physiol Rev, October 1, 2002; 82(4): 1013 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Oury, E. Toth-Zsamboki, J. Vermylen, M. F. Hoylaerts ;, N. J. Greco, G. Tonon, W. Chen, X. Luo, R. Dalal, and G. A. Jamieson Does the P2X1del variant lacking 17 amino acids in its extracellular domain represent a relevant functional ion channel in platelets? Blood, March 15, 2002; 99(6): 2275 - 2277. [Full Text] [PDF] |
||||
![]() |
S. G. Brown, A. Townsend-Nicholson, K. A. Jacobson, G. Burnstock, and B. F. King Heteromultimeric P2X1/2 Receptors Show a Novel Sensitivity to Extracellular pH J. Pharmacol. Exp. Ther., February 1, 2002; 300(2): 673 - 680. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||