|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Department of Pathology and Laboratory
Medicine, University of Pennsylvania, Philadelphia, and the Department
of Medicine and Howard Hughes Medical Institute, University of
California, San Francisco.
CD28 is the major costimulatory molecule on T cells. CD28
activation, in conjunction with T-cell receptor engagement,
up-regulates transcription of several cytokines, including
interleukin-2 (IL-2), through transcriptional activation of the
RE/AP composite element. Although CD28 is not normally
expressed on B cells or plasma cells, more than 90% of extramedullary
myelomas (a late stage B-cell neoplasm) express CD28. The functional
significance of this is unknown. The results of this study demonstrate
that CD28 stimulates transcriptional activation of RE/AP-based
reporters in B cells and myeloma cells. However, CD28 stimulation does
not up-regulate IL-2 production in myeloma cell lines, demonstrating
that the IL-2 promoter may not be a relevant RE/AP-containing target of CD28 in myelomas. Instead, an RE/AP composite element has been identified within the promoter of the IL-8 gene, a
chemokine that promotes angiogenesis. Furthermore, stimulation of
endogenous CD28 expressed by 3 myeloma cell lines increased IL-8
production. Therefore, the study demonstrates that CD28 is functional
in myelomas to up-regulate transcription of endogenous genes, including
IL-8. The proposal is made that aberrant expression of CD28
may play a role in the progression of multiple myeloma.
(Blood. 2001;98:187-193) Myelomas are monoclonal B-cell malignancies,
arising from a late stage differentiated B cell, and share many
characteristics with immunoglobulin-secreting plasma cells (reviewed in
references 1 and 2). Multiple myeloma accounts for approximately 1% of
annual deaths from cancer each year.1 Myelomas are
initially limited to the bone marrow, most likely due to a growth
requirement for interleukin-6 (IL-6), which is produced by bone marrow
stromal cells (BMSC)1 in patients with
myeloma.3-5 Direct interaction between BMSC and myeloma
cells induces IL-6 secretion by BMSC.6 In addition to
IL-6, BMSC from myeloma patients also aberrantly secrete the chemokine
IL-8,7 although the function of IL-8 secreted by BMSC on
myelomas is not known. IL-8 belongs to the family of ELR-CXC
chemokines, which have angiogenic activity.8,9 It is
possible that the aberrant production of IL-8 by the BMSC of patients
with myeloma does not have a direct effect on myeloma growth and
survival per se, but may instead function to promote angiogenesis.
However, in later stages of the disease, myeloma cells can be found
outside of the bone marrow (extramedullary growth), suggesting that
they no longer require cytokines/chemokines produced by the BMSC.
Extramedullary myelomas, therefore, must either produce their own
cytokines/chemokines or become independent of them for growth
and survival.
Interestingly, a majority of myeloma samples from patients with
advanced disease (as defined by a relapse after initial treatment, failure of initial treatment, or extramedullary growth) express the
cell surface protein CD28, whereas CD28 is not expressed on normal B
cells or plasma cells.10,11 At initial diagnosis, CD28 can
be expressed on myeloma cells in some patients; however, more than 90%
of extramedullary myelomas (which by definition have metastasized from
the bone marrow and can grow into palpable masses in soft tissues)
express CD28.12,13 Thus, expression of CD28 by myelomas
correlates with metastasis, rather than the initial tumorigenesis.
Because myelomas develop independently of CD28 expression, CD28 may not
function by directly stimulating growth of myeloma cells, but rather
may be involved in promoting metastasis. CD28 has also been found on
the surface of almost all human myeloma cell lines.10-15
CD28 is the only cell surface marker identified to date that correlates
with an advanced state of multiple myeloma in humans. CD28 is not
normally expressed in B cells,10,11 but is found on T
cells where it plays an important role in T-cell
activation.16,17
Stimulation of T cells through the antigen receptor is insufficient for
T-cell activation. A second, costimulatory signal is also required,
which is primarily produced by engagement of CD28 with its ligands CD80
or CD86 on the surface of antigen-presenting cells
(APCs).18,19 CD28 costimulation leads to increased
proliferation and up-regulation of several genes, including
IL-2, by both an increase in their transcription
and an increase in their messenger RNA (mRNA)
stability.20-22 Transcriptional activation of the
IL-2 gene requires the RE/AP composite element,
which is located approximately 160 nucleotides upstream of the
transcription start site.23 RE/AP contains both a nuclear
factor (NF)- Because CD28 expression correlates with advanced disease in myeloma,
signal transduction through CD28 may play a role in disease progression. It has been demonstrated that stimulation of CD28 in
myeloma cell lines induced association of the cytoplasmic tail of CD28
with the p85 subunit of phosphatidyl inositol 3-kinase (PI3K).27 The functional role of PI3K in CD28 activation
in T cells is controversial. Mutation of the PI3K binding site in CD28
had minimal effect on the ability of CD28 to up-regulate IL-2
production or transcription in one cell line,28,29 but eliminated CD28 function in another.30 Recent studies have
suggested a possible role for Akt, a serine/threonine kinase, which is
regulated by the products of PI3K in mediating NF- Here, we provide evidence that CD28 is able to couple to downstream
signaling pathways that up-regulate gene expression in myelomas. CD28
is shown to up-regulate transcription of the RE/AP composite element
from the IL-2 promoter in 2 different myeloma cell lines that express
CD28 endogenously. However, CD28 stimulation does not up-regulate IL-2
production in myeloma cell lines, demonstrating that the IL-2 promoter
may not be a relevant RE/AP-containing target of CD28 in myelomas.
Interestingly, we found that there is a sequence similar to RE/AP
within the IL-8 promoter. This RE/AP-like sequence within the IL-8
promoter functions as a true composite element, because both the RE
(NF- Plasmids
5' AAATCGTGGAATTTCCTCTACAAATATGAAAA 3'
3' TTTAGCACCTTAAAGGAGATGTTTATACTTTT 5'
The choice of mutated nucleotides was based on the mutagenesis of the
IL-2 RE/AP reporter construct, which eliminated activation when either
the NF- IL-8 RE/AP: 5' TCGAGAAATCGTGGAATTTCCTCTGACATAATG- 3' CTTTAGCACCTTAAAGGAGACTGTATTACTTTCCAGCT 5'
IL-8 m/AP:5'
TCGAGAAATCGTGGACCTCGATCTGACATAATG- 3' CTTTAGCACCTGGAGCTAGACTGTATTACTTTCCAGCT 5'
IL-8 RE/m:5'
TCGAGAAATCGTGGAATTTCCTCTACAAATATGA- 3' CTTTAGCACCTTAAAGGAGATGTTTATACTTTCCAGCT 5'
IL-8 m/m: 5'
TCGAGAAATCGTGGACCTCGATCTACAAATATGAAAAG
3'
3'
CTTTAGCACCTGGAGCTAGATGTTTATACTTTCCAGCT
5'
These mutations were based on the original mutations generated in the
IL-2 RE/AP sequence that abolished activation.24 The reporter constructs were verified by sequencing.
Cell lines
Transfections Transfections into Jurkat, RPMI 8226, Bal17, and S194/5.XXO cell lines were performed as previously described for Jurkat cell line transfections.35 Transfections into DT40 cells were performed as previously described.36Stimulations and luciferase assays Twenty to 28 hours after transfections, 105 live cells were stimulated as described in the figure legend. For activation of RE/AP reporter constructs in B-cell lines and myeloma cell lines (Figures 1, 2, and 4), cells were stimulated for 6 hours as used previously in T-cell lines.24 Longer time points in B-cell lines and myeloma cell lines do not increase RE/AP activation (data not shown). PMA and ionomycin were purchased from Calbiochem (San Diego, CA), and used at a concentration as described in the figure legends for each cell line. C305 is a monoclonal antibody (mAb) against the Jurkat clonotypic TCR and was used at a 1:1000 dilution of miniperm material (Heraeus, Newtown, CT). Antihuman CD28 15E8 antibodies were purchased from Caltag (Burlingame, CA), and used at a final concentration of 1 µg/mL. Antimouse CD28 ascites 37.51 was a gift from Jim Allison (University of California, Berkeley, CA) and used at a final concentration of 1:1000. As an antibody control, MOPC315 (mouse immunoglobulin G1 (IgG1), isotype matched to anti-human CD28 mAb 15E8) was purchased from Cappel (Costa Mesa, CA) and used at a final concentration of 1 µg/mL. CD8 stimulation was performed using 1:1000 dilution of OKT8 ascites, which was generated from a hybridoma purchased from ATCC. FK506 (tacrolimus, purchased from the University of California, San Francisco, pharmacy) was used at a final concentration of 100 ng/mL, and added 15 minutes prior to stimulation. Luciferase assays were performed as previously described.35
FACS analysis For FACS analysis of murine myeloma cell lines, phycoerythrin-conjugated antimurine CD28 (BD-Pharmingen, San Diego, CA) and phycoerythrin-conjugated mouse-Ig G1 (BD-Pharmingen) were used as per the manufacturer's instructions.IL-8 enzyme-linked immunosorbent assay A matched antibody pair for performing human IL-8 enzyme-linked immunosorbent assays (ELISAs) was purchased from Pierce-Endogen (Woburn, MA). ELISAs were performed using 50 µL supernatant from stimulated cell cultures as per the manufacturer's instructions.
CD28 activates an RE/AP reporter in B cells Stimulation of CD28, in conjunction with TCR engagement, leads to the expression of several genes, including the IL-2 gene, through an increase in transcription as well as an increase in mRNA stability.20-22 Transcriptional up-regulation of the IL-2 gene by CD28 occurs through the RE/AP composite element within the IL-2 promoter.24-26 If CD28 is functional in multiple myeloma cells, then CD28 might be expected to up-regulate transcription of an RE/AP reporter in B-lineage cells. Bal17 murine and DT40 chicken B cells were transfected with a chimeric molecule containing the extracellular and transmembrane regions of CD8 and the cytoplasmic tail of CD28. A chimeric molecule was used to avoid any interaction and subsequent constitutive activation that could occur between CD28 and its ligands CD80 and CD86, which are normally expressed on B cells. As shown in Figure 1, CD8/CD28 chimera stimulation, in conjunction with PMA, activated transcription from the RE/AP reporter in both B-cell lines. This is consistent with CD28 stimulation in T cells CD28 alone is insufficient to activate RE/AP transcription and
requires a second signal such as TCR stimulation or PMA. This up-regulation was dependent on the cytoplasmic tail of CD28, because a
truncation of CD8 lacking the CD28 cytoplasmic tail did not activate
RE/AP in either the Bal17 or DT40 cell lines (Figure 1). In addition,
activation of RE/AP by PMA and CD28 was resistant to FK506 treatment,
demonstrating that CD28 signaling in B cells, as in T cells, is
resistant to FK506 (Figure 2). This is in
marked contrast to responses seen with an NFAT transcriptional
reporter. FK506 inhibited activation of an NFAT reporter in these B
cells after stimulation with PMA and ionomycin (Figure 2). RE/AP is a
composite element composed of NF- B and an adjacent AP-1 site; both
sites are required for activation in T cells.24 Similarly, both sites were also required for RE/AP activation in Bal17 and DT40
(data not shown). Therefore, CD28 is functional to up-regulate transcription in B-lineage cells and CD28-mediated activation of RE/AP
in B- and T-cell lines is similar because (1) a second signal is
required, (2) the cytoplasmic tail of CD28 is required, (3) activation
by CD28 is resistant to FK506, and (4) both the NF-B and AP-1 sites
of RE/AP are required for activation.
CD28 is expressed on murine myeloma cell lines If aberrant expression of CD28 functions in the progression of multiple myeloma in humans, then it might be expected that murine myelomas would also express CD28. Seven different murine myeloma cells were examined for expression of CD28. As shown in Figure 3, 4 of the 7 cell lines, J558, SP2/0 Ag14, P3X63Ag8.653 and S194/5.XXO had substantial amounts of CD28 on the cell surface. The other 3 cells lines were only slightly positive for CD28. Therefore, CD28 may play a role in multiple myeloma, because as previously shown in human myelomas12,13 and as shown here, at least some mouse myelomas aberrantly express CD28.
Endogenous CD28 activates RE/AP transcription in myeloma cell lines To examine whether CD28 functions in myeloma cells to up-regulate transcription, 2 CD28-expressing myeloma cell lines (human myeloma cell line RPMI 822611,12 and murine myeloma cell line S194/5.XXO) were transfected with an IL-2-derived RE/AP luciferase reporter construct and examined for endogenous CD28-mediated RE/AP activation. As shown in Figure 4, CD28 engagement alone did not activate RE/AP, but CD28 could further activate RE/AP transcription in the presence of PMA and ionomycin in both myeloma cell lines. These increases, although not as large as those seen in T cells, were significant (with P < .01 for both cell lines). Therefore, endogenous CD28 expressed in human and mouse myeloma cell lines is capable of up-regulating transcription through an RE/AP element derived from the IL-2 gene.
CD28 stimulation up-regulates IL-8 production in a myeloma cell line Because CD28 is capable of activating transcription in B cells and myeloma cells, and the expression of CD28 correlates well with extramedullary myelomas that have metastasized from the bone marrow, CD28 stimulation leading to gene expression may play a functional role in multiple myeloma progression. However, although CD28 stimulation in myeloma cells up-regulates transcription of the RE/AP element from the IL-2 promoter, it is unlikely that IL-2 is the target of CD28 in myeloma cells because CD28 stimulation failed to up-regulate IL-2 production in all myeloma cell lines we examined (n = 4, data not shown). It is possible that other genes with RE/AP elements within their promoters are the relevant targets of CD28 in myeloma.Newly diagnosed multiple myeloma is restricted to the bone marrow, most
likely due to a requirement for cytokines/chemokines produced by the
BMSC for growth and survival. For myelomas to metastasize and grow
outside of the bone marrow, these extramedullary myelomas must have
become independent of BMSC factors, or they must produce their own.
BMSC from myeloma patients aberrantly produce IL-6 and
IL-8.7 Interestingly, both the IL-6 and IL-8 promoters are
responsive to CD28 in T cells,37,38 dependent on NF-
Interleukin 8 is a member of the ELR-CXC chemokines with angiogenic
activity, whose promoter has been demonstrated in T cells to be
up-regulated by CD28.38 We tested whether this sequence from the IL-8 promoter functions as a composite transcriptional element
similar to IL-2 RE/AP. A reporter construct containing multimerized
copies of the IL-8 RE/AP element behaved similarly to an IL-2 RE/AP
reporter with respect to requiring 2 signals for activation in T cells
(Figure 6A and data not shown).
Mutagenesis of the IL-8 RE/AP reporter, as well as mutagenesis of the
intact IL-8 promoter, demonstrate that CD28 responsiveness of the IL-8 promoter is due to a true RE/AP composite element, because both the RE
(NF-
We provide the first evidence that CD28 expressed on
myeloma cells is functional to up-regulate gene transcription, using an
RE/AP reporter. The activation of the RE/AP reporter by CD28 in 2 B-cell lines, DT40 and Bal17, establishes that CD28 can mediate signals
in B-cell lineage cells to up-regulate promoters containing this
composite element. Moreover, the signals induced are similar to those
previously characterized for the activation of RE/AP in T cells because
CD28-mediated up-regulation (1) required its cytoplasmic tail, (2)
required a second signal, (3) was resistant to FK506, and (4) required
both the NF- Interleukin 8 is an ELR-containing CXC chemokine with angiogenic activity. The best correlation with CD28 expression on myelomas is with metastasis and growth of myelomas outside the bone marrow (extramedullary myelomas). The initial growth and development of myelomas can occur independently of CD28, because CD28 is not commonly found on myelomas from patients at diagnosis.12,13 Although extramedullary myelomas are not particularly vascularized, there must be some angiogenesis for the growth and survival of extramedullary myelomas that can form palpable masses a few centimeters in diameter. Perhaps CD28 functions in extramedullary myelomas to induce tumor-promoting angiogenic factors. Because IL-8 has angiogenic activity, and the aberrant expression of CD28 by human myelomas correlates well with metastasis, CD28 may play a functional role in the progression of multiple myeloma. Indeed, the expression of IL-8 has been shown to regulate tumor metastasis in 2 other human cancers, melanoma and prostate cancer, using animal models.39,40 Therefore, it is possible that IL-8 secretion induced through CD28 functions in metastasis, which is the reason more than 90% of metastasized, extramedullary myelomas express CD28.12 It is interesting to note that the ligands for CD28, CD80 and CD86, can be found on the surface of myeloma cells12,15,41 and are normally expressed by B cells. Therefore, CD28 expressed by multiple myeloma cells could potentially be constitutively stimulated, by CD80 or CD86 or both expressed on neighboring myeloma cells, or potentially even on the same cell. Although we have demonstrated that stimulation of endogenous CD28 can up-regulate IL-8 production by myeloma cells, it does not preclude the involvement of additional targets of CD28 in myeloma cells or show that IL-8 is the critical gene up-regulated by CD28 that leads to multiple myeloma metastasis. Also, IL-8 may be the relevant target of CD28 in a subset, but not all, myelomas. For example, IL-6 may be a relevant target in others. CD28 up-regulates the IL-6 promoter in T cells.38 We were unable to demonstrate up-regulation of IL-6 in myeloma cell lines (n = 15, data not shown), or that stimulation or inhibition of CD28 could enhance or slow the growth of myeloma cell lines (n = 5, data not shown). Nevertheless, it is still possible that this may occur in a different subset of myelomas in vivo. However, because we have demonstrated that CD28 is capable of up-regulating endogenous genes in myelomas, future work will focus on whether myelomas freshly isolated from patient samples up-regulate IL-8 in response to CD28 stimulation, whether IL-8 can promote myeloma metastasis and whether any other CD28-responsive genes may also be up-regulated in myelomas. Our data also suggest new forms of therapy for advanced multiple myeloma, based on CD28 expression and function in extramedullary disease. Although newly diagnosed multiple myelomas respond to current chemotherapy, a relapse in which the cells are resistant to intervention almost always occurs, with fatal consequences. It is possible that the aberrant expression of CD28 plays a causative role in multiple myeloma disease progression. We have demonstrated that endogenous CD28 expressed by myeloma cells is capable of up-regulating transcription of an RE/AP reporter, and that CD28 stimulation up-regulates production of the RE/AP-containing gene, IL-8. If CD28 plays a functional role in multiple myeloma disease progression, then inhibition of CD28 function may slow the progress of disease.
We thank Drs. Michael Shapiro, Jeanne Baker, and Tim Finco for critical reading of the manuscript. V.S.S. is a Special Fellow of the Leukemia and Lymphoma Society.
Submitted August 29, 2000; accepted March 1, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Arthur Weiss, Box 0795, Rm U330, University of California, San Francisco, San Francisco, CA 94143; e-mail: aweiss{at}medicine.ucsf.edu.
1.
Bataille R, Harousseau J-L.
Multiple myeloma.
N Engl J Med.
1997;336:1657-1664 2. Epstein J, Hoover R, Kornbluth J, Barlogie B. Biological aspects of multiple myeloma. Baillierres Clin Haematol. 1995;8:721-734.
3.
Klein B, Zhang X, Jourdan M, et al.
Paracrine rather than autocrine regulation of myeloma-cell growth and differentiation by interleukin-6.
Blood.
1989;73:517-526
4.
Lichtenstein A, Berenson J, Norman D, Chang MP, Carlile A.
Production of cytokines by bone marrow stromal cells obtained from patients with multiple myeloma.
Blood.
1989;74:1266-1273
5.
Caligaris-Cappio F, Bergui L, Gregoretti MG, et al.
Role of bone marrow stromal cells in the growth of human multiple myeloma.
Blood.
1991;77:2688-2693
6.
Uchiyama H, Barut BA, Mohrbacher AF, Chauhan D, Anderson KC.
Adhesion of human myeloma-derived cell lines to bone marrow stromal cells stimulates interleukin-6 secretion.
Blood.
1993;82:3712-3720 7. Merico F, Bergui L, Gregoretti MG, et al. Cytokines involved in the progression of multiple myeloma. Clin Exp Immunol. 1993;92:27-31[Medline] [Order article via Infotrieve]. 8. Rossi D, Zlotnik A. The biology of chemokines and their receptors. Ann Rev Immunol. 2000;18:217-243[CrossRef][Medline] [Order article via Infotrieve]. 9. Streiter RM, Polverini PJ, Arenberg DA, et al. Role of C-X-C chemokines as regulators of angiogenesis in lung cancer. J Leuk Biol. 1995;57:752-762[Abstract]. 10. Kozbor D, Moretta A, Messner HA, Moretta L, Croce CM. Tp44 molecules involved in antigen-independent T cell activation are expressed on human plasma cells. J Immunol. 1987;138:4128-4132[Abstract].
11.
Zhang X-g, Gaillard JP, Robillard N, et al.
Reproducible obtaining of human myeloma cell lines as a model for tumor stem cell study in human multiple myeloma.
Blood.
1994;83:3654-3663 12. Robillard N, Jego G, Pellat-Deceunynck C, et al. CD28, a marker associated with tumoral expansion in multiple myeloma. Clin Cancer Res. 1998;4:1521-1526[Abstract].
13.
Pellat-Deceunynck C, Bataille R, Robillard N, et al.
Expression of CD28 and CD40 in human myeloma cells: a comparative study with normal plasma cells.
Blood.
1994;84:2597-2603 14. Westendorf JJ, Ahmann GJ, Greipp PR, et al. Establishment and characterization of three myeloma cell lines that demonstrate variable cytokine responses and abilities to produce interleukin-6. Leukemia. 1996;10:866-876[Medline] [Order article via Infotrieve]. 15. Drexler HG, Matsuo Y. Malignant hematopoetic cell lines: in vitro models for the study of multiple myeloma and plasma cell leukemia. Leuk Res. 2000;24:681-703[CrossRef][Medline] [Order article via Infotrieve]. 16. Green JM, Noel PJ, Sperling AI, et al. Absence of B7-dependent responses in CD28-deficient mice. Immunity. 1994;1:501-508[CrossRef][Medline] [Order article via Infotrieve].
17.
Shahinian A, Pfeffer K, Lee KP, et al.
Differential T cell costimulatory requirements in CD28-deficient mice.
Science.
1993;261:609-612 18. Chambers CA, Allison JP. Co-stimulation in T cell responses. Curr Opin Immunol. 1997;9:396-404[CrossRef][Medline] [Order article via Infotrieve]. 19. Jenkins MK. The ups and downs of T cell costimulation. Immunity. 1994;1:443-446[CrossRef][Medline] [Order article via Infotrieve]. 20. Jain J, Loh C, Rao A. Transcriptional regulation of the IL-2 gene. Curr Opin Immunol. 1995;7:333-342[CrossRef][Medline] [Order article via Infotrieve]. 21. Riegel JS, Corthesy B, Flanagan WM, Crabtree GR. Regulation of the interleukin-2 gene. Chem Immunol. 1992;51:266-298[Medline] [Order article via Infotrieve]. 22. Umlauf SW, Beverly B, Kang S-M, et al. Molecular regulation of the IL-2 gene: rheostatic control of the immune system. Immunol Rev. 1993;133:177-197[CrossRef][Medline] [Order article via Infotrieve].
23.
Shapiro VS, Mollenauer MN, Weiss A.
Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP.
J Immunol.
1998;161:6455-6458 24. Shapiro VS, Truitt KE, Imboden JB, Weiss A. CD28 mediates transcriptional upregulation of the interleukin-2 (IL-2) promoter through a composite element containing the CD28RE and NF-IL-2B AP-1 sites. Mol Cell Biol. 1997;17:4051-4058[Abstract]. 25. McGuire KL, Iacobelli M. Involvement of Rel, Fos, and Jun proteins in binding activity to the IL-2 promoter CD28 response element/AP-1 sequence in human T cells. J Immunol. 1997;159:1319-1327[Abstract].
26.
Butscher WG, Powers C, Olive M, Vinson C, Gardner K.
Coordinate transactivation of the interleukin-2 response element by c-Rel and ATF-1/CREB2.
J Biol Chem.
1998;273:552-560 27. Zhang X-G, Olive D, Devos J, et al. Malignant plasma cell lines express a functional CD28 molecule. Leukemia. 1998;12:610-618[CrossRef][Medline] [Order article via Infotrieve]. 28. Truitt KE, Shi J, Gibson S, et al. CD28 delivers costimulatory signals independently of its association with phosphatidylinositol 3-kinase. J Immunol. 1995;155:4702-4710[Abstract]. 29. Crooks MEC, Littman DR, Carter RH, et al. CD28-mediated co-stimulation in the absence of phosphatidylinositol 3-kinase association and activation. Mol Cell Biol. 1995;15:6820-6828[Abstract]. 30. Cai YC, Cefai D, Schneider H, et al. Selective CD28pYMNM mutations implicate phosphatidylinositol 3-kinase in CD86-CD28-mediated costimulation. Immunity. 1995;3:417-426[CrossRef][Medline] [Order article via Infotrieve]. 31. Kane LP, Shapiro VS, Stokoe D, Weiss A. Induction of NF-kB by the Akt/PKB kinase. Curr Biol. 1999;9:601-604[CrossRef][Medline] [Order article via Infotrieve].
32.
Durand DB, Bush MR, Morgan JG, Weiss A, Crabtree GR.
A 275 basepair fragment at the 5' end of the interleukin 2 gene enhances expression from a heterologous promoter in response to signals from the T cell antigen receptor.
J Exp Med.
1987;165:395-407
33.
Irving BA, Chan AC, Weiss A.
Functional characterization of a signal transducing motif present in the T cell antigen receptor zeta chain.
J Exp Med.
1993;177:1093-1103
34.
Stein PH, Fraser JD, Weiss A.
The cytoplasmic domain of CD28 is both necessary and sufficient for costimulation of interleukin-2 secretion and association with phosphatidylinositol 3'-kinase.
Mol Cell Biol.
1994;14:3392-3402
35.
Shapiro VS, Mollenauer MN, Greene WC, Weiss A.
c-Rel regulation of IL-2 gene expression may be mediated through activation of AP-1.
J Exp Med.
1996;184:1663-1669 36. Zhao Q, Weiss A. Enhancement of lymphocyte responsiveness by a gain-of-function mutation of ZAP-70. Mol Cell Biol. 1996;16:6765-6774[Abstract].
37.
Civil A, Rensink I, Aarden LA, Verweij CL.
Functional disparity of distinct CD28 response elements towards mitogenic responses.
J Biol Chem.
1999;274:34369-34374 38. Wechsler AS, Gordon MC, Dendorfer U, LeClair KP. Induction of IL-8 expression in T cells uses the CD28 costimulatory pathway. J Immunol. 1994;153:2515-2523[Abstract]. 39. Luca M, Huang S, Gershenwald JE, et al. Expression of interleukin-8 by human melanoma cells up-regulates MMP-2 activity and increases tumor growth and metastasis. Am J Pathol. 1997;151:1105-1113[Abstract]. 40. Inoue K, Slaton BY, Kim SJ, et al. Interleukin 8 expression regulates tumorigenicity and metastases in androgen-independent prostate cancer. Clin Cancer Res. 2000;6:2101-2119. 41. Brown RD, Pope B, Yuen E, Gibson J, Joshua DE. The expression of T cell related costimulatory molecules in multiple myeloma. Leuk Lymphoma. 1998;31:379-384[Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  G. Mateo, M. A. Montalban, M.-B. Vidriales, J. J. Lahuerta, M. V. Mateos, N. Gutierrez, L. Rosinol, L. Montejano, J. Blade, R. Martinez, et al. Prognostic Value of Immunophenotyping in Multiple Myeloma: A Study by the PETHEMA/GEM Cooperative Study Groups on Patients Uniformly Treated With High-Dose Therapy J. Clin. Oncol., June 1, 2008; 26(16): 2737 - 2744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Colla, S. Tagliaferri, F. Morandi, P. Lunghi, G. Donofrio, D. Martorana, C. Mancini, M. Lazzaretti, L. Mazzera, L. Ravanetti, et al. The new tumor-suppressor gene inhibitor of growth family member 4 (ING4) regulates the production of proangiogenic molecules by myeloma cells and suppresses hypoxia-inducible factor-1 {alpha} (HIF-1{alpha}) activity: involvement in myeloma-induced angiogenesis Blood, December 15, 2007; 110(13): 4464 - 4475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Bahlis, A. M. King, D. Kolonias, L. M. Carlson, H. Y. Liu, M. A. Hussein, H. R. Terebelo, G. E. Byrne Jr, B. L. Levine, L. H. Boise, et al. CD28-mediated regulation of multiple myeloma cell proliferation and survival Blood, June 1, 2007; 109(11): 5002 - 5010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Riley and C. H. June The CD28 family: a T-cell rheostat for therapeutic control of T-cell activation Blood, January 1, 2005; 105(1): 13 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Marinari, A. Costanzo, V. Marzano, E. Piccolella, and L. Tuosto CD28 delivers a unique signal leading to the selective recruitment of RelA and p52 NF-{kappa}B subunits on IL-8 and Bcl-xL gene promoters PNAS, April 20, 2004; 101(16): 6098 - 6103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Giuliani, S. Colla, M. Lazzaretti, R. Sala, G. Roti, C. Mancini, S. Bonomini, P. Lunghi, M. Hojden, G. Genestreti, et al. Proangiogenic properties of human myeloma cells: production of angiopoietin-1 and its potential relationship to myeloma-induced angiogenesis Blood, July 15, 2003; 102(2): 638 - 645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Gao, S. Parkin, P. F. Johnson, and R. C. Schwartz C/EBPgamma Has a Stimulatory Role on the IL-6 and IL-8 Promoters J. Biol. Chem., October 4, 2002; 277(41): 38827 - 38837. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
ODLO as previously described.
