| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Donna D. and Donald M. Lambert Laboratory of
Myeloma Genetics and Myeloma and the Transplantation Research Center,
Arkansas Cancer Research Center, University of Arkansas for Medical
Sciences, Little Rock; the Genetics Department, Medicine Branch,
National Cancer Institute, Bethesda, MD; the Department of Medicine,
Division of Hematology and Oncology, Cornell University Medical
College, New York, NY.
Reciprocal chromosomal translocations, which are mediated by errors
in immunoglobulin heavy chain (IgH) switch recombination or somatic
hypermutation as plasma cells are generated in germinal centers, are
present in most multiple myeloma (MM) tumors. These translocations
dysregulate an oncogene that is repositioned in proximity to a strong
IgH enhancer. There is a promiscuous array of nonrandom chromosomal
partners (and oncogenes), with the 3 most frequent partners (11q13
[cyclin D1]; 4p16 [FGFR3 and MMSET]; 16q23 [c-maf])
involved in nearly half of MM tumors. It is now shown that a novel
t(6;14)(p21;q32) translocation is present in 1 of 30 MM cell lines and
that this cell line uniquely overexpresses cyclin D3. The cloned
breakpoint juxtaposes gamma 4 switch sequences with 6p21
sequences that are located about 65 kb centromeric to the cyclin
D3 gene. By metaphase chromosome analysis, the
t(6;14) (p21;q32) translocation was identified in 6 of 150 (4%)
primary MM tumors. Overexpression of cyclin D3 messenger RNA
(mRNA) was identified by microarray RNA expression analysis in
3 of 53 additional primary MM tumors, each of which was found to have a
t(6;14) translocation breakpoint by interphase fluorescence in
situ hybridization analysis. One tumor has a t(6;22)(p21;q11)
translocation, so that cyclin D3 is bracketed by the IgL and IgH
breakpoints. These results provide the first clear evidence for primary
dysregulation of cyclin D3 during tumorigenesis. It is suggested that
the initial oncogenic event for most MM tumors is a primary
immunoglobulin translocation that dysregulates cyclin D1, cyclin D3,
and other oncogenes to provide a proliferative stimulus to postgerminal center plasma cells.
(Blood. 2001;98:217-223) Dysregulation of oncogenes by translocation near a
strong enhancer in an immunoglobulin heavy chain (IgH) (14q32) or IgL
( Three D-type cyclin genes encode proteins, each of which can interact
with the cdk4 or the cdk6 cyclin D-dependent kinases that phosphorylate
Rb, thus regulating a process that promotes the G1/S cell cycle
transition.11 Despite differences in expression patterns
and in some functional properties, it appears that cyclins D1, D2, and
D3 are virtually interchangeable for regulating Rb phosphorylation.12-14 It is well established that
dysregulation of cyclin D1 provides a primary oncogenic event in animal
models and in various human tumors, including MM.15-23 By
contrast, despite overexpression or amplification of cyclins D2 or D3
in some human tumors, there is a paucity of compelling evidence that
dysregulation of cyclins D2 or D3 are primary oncogenic
events.24-31
We report here the cytogenetic and molecular characterization of a
novel partner locus at 6p21 that is translocated to the IgH or Ig Probes
Cell lines
Fluorescence in situ hybridization assays Three color fluorescence in situ hybridization (FISH) assays of metaphase chromosomes and interphase chromosomes and the 3-color cIg FISH assays have been described in detail previously.8,32,36 For sequential 3-color FISH analyses, after initial hybridization and analysis, slides were rinsed in phosphate-buffered saline, dehydrated in 70%, 90%, and 100% ethanol, stripped in 70% formamide denaturing solution at 72°C for 6 minutes, rehybridized with FISH probes, and then reanalyzed.Cloning and sequencing of the KMM-1 translocation breakpoint KMM-1 genomic DNA was digested with HindIII, ligated to BamHI adaptors (New England Biolabs, Beverly, MA), and cloned into ZAP Express vector (Stratagene, LaJolla, CA). A phage
clone containing the 6.4-kb translocation breakpoint fragment that
hybridizes with 3'S , but not 5'S , probes was isolated. The
rescued plasmid was partially sequenced as depicted in Figure
2A. The T7 sequence included 317 bp that completely matched
sequences upstream of the HindIII site, which is downstream
of S 4 sequences. The 6236 sequence (accession no. AF364073) started
330 bp 3' of the S 4 region and included the following sequences:
S 4 3'nt330 > 240/S 4 3'nt40 > 232/300 bp of repetitive
sequence. The T3 sequence (accession no. AF364072) included 648 bp of
repetitive sequence, but 2 oligonucleotides (TATAGGTACCTCCCCAGAAGA and
TGCCTGGCTTCTTTCACTTAG) designed from this sequence identified a unique
211-bp fragment from a polymerase chain reaction (PCR) reaction of
genomic DNA. This PCR reaction enabled us to identify and isolate the
CD3 BAC (see above) that contains cyclin D3 coding sequences and the
KMM-1 translocation breakpoint-associated sequences.
Microarray analysis of mRNA in purified normal and malignant plasma cells Bone marrow plasma cells from 10 healthy donors, 28 patients with newly diagnosed disease, and 25 treated patients with active multiple myeloma were subjected to gene expression analysis using oligonucleotide-based microarrays. Bone marrow cells were aspirated from the iliac crest of healthy donors or patients with active disease during routine clinical work-up. All tests were performed with informed consent, and samples were encrypted to ensure privacy. Mononuclear cells were obtained by Ficoll-Hypaque density gradient centrifugation. Plasma cells were purified by anti-CD138 immunomagnetic bead selection with the AutoMACs system according to the manufacturer's instructions (Miltenyi, Cologne, Germany). Average plasma cell purity, as determined by CD38+/CD45 FACs analysis, was 95.46%
(range, 90.58% to 98.85%). Total RNA was isolated, converted to
complementary DNA (cDNA), and transcribed into biotinylated
complementary RNA (cRNA) and hybridized to the Test2 and HuGenFL
oligonucleotide microarrays according to the manufacturer's
instructions (Affymetrix, Santa Clara, CA). After hybridization, the
hybridization solution was removed, and the GeneChips were installed in
a fluidics system for washing and staining with
phycoerythrin-streptavidin. The GeneChips were read at a resolution of
6 µm using a Hewlett Packard GeneArray Scanner (Palo Alto,
CA). Scanned output files were visually inspected for hybridization
artifacts and then analyzed with GeneChip 3.3 software (Affymetrix).
All arrays were scaled to an average intensity of 1500 and
analyzed independently. The absolute call and the average difference
calls of mRNA presence and abundance were performed. The expression
value (average difference call) for each gene was determined by
calculating the average of differences of intensity (perfect match
intensity mismatch intensity) between probe pairs of the given
probe sets. Samples with absent calls or present calls with average
difference values less than 54 were given an average difference call of
54 (2.5 × the average raw Q or noise level). The average
difference call for the CCND3 gene was compared among
all samples.
Other procedures Cell culture, isolation of RNA and genomic DNA, genomic library construction and screening, isolation and sequencing of clones, and Northern, Southern, and Western blot analyses have been described elsewhere.6,19,37
Cyclin D3 is overexpressed in the KMM-1 MM cell line Using a cyclin D competitive RT-PCR assay38 and Northern blot analysis, a panel of 30 MM cell lines (M&M) was screened for the expression of cyclin D1, D2, and D3 mRNAs. Cyclin D1 mRNA was present at high levels in 8 cell lines, each of which has a t(11;14) translocation (Flam-76, H1112, KMS-12, MM-S1, SKMM-2, U266, XG-1, and XG-5) but was not detected in most MM cell lines (not shown).19,32 In contrast to the marked variation in cyclin D1 mRNA expression, all 30 MM lines expressed cyclin D3 mRNA (Figure 1A and not shown). Although all MM cell lines expressed low and somewhat variable levels of cyclin D3, the KMM-1 MM cell line was exceptional in that it expressed 6 times as much cyclin D3 mRNA as the next highest (H929) of the other 29 cell lines (Figure 1A). Cyclin D3 protein expression paralleled mRNA expression (Figure 1B).
KMM-1 cell line has a t(6;14)(p21;q32) translocation that juxtaposes the cyclin D3 gene with 3' IgH enhancer sequences It was originally reported that the KMM-1 MM cell line has a complex karyotype that includes a14q+ translocation, though the partner chromosome was not identified.39 In addition, there are several reports of t(6;14)(p21;q32) translocations in MM and B-lymphoma tumors.40,41 Because cyclin D3 is located at 6p21, we hypothesized that the KMM-1 cell line would have a t(6;14)(p21;q32) translocation. We used different combinations of VH and CH probes (Figure 2A), a cyclin D3 cosmid probe (Figure 2A), plus chromosome 6 or 14 chromosome painting probes in 3 color-FISH analyses to test this hypothesis. A representative result (Figure 3A) shows a complex karyotype that includes one copy of a normal chromosome 6 plus 5 copies of a rearranged chromosome 6, 2 of which (both der[14]) juxtapose cyclin D3 and 3' IgH enhancer sequences (CH probe). The overlap of the cyclin D3 and CH signals by interphase FISH (Figure 3B) indicates that the 2 sequences are separated by fewer than 500 kb.42 Der(6) t(6;14) with telomeric VH sequences was not detected (not shown). Two additional copies of CH (arrows) are juxtaposed with VH and inserted c-myc sequences, as we have described in detail elsewhere.8
KMM-1 t(6;14) translocation breakpoint
involves S probe but no other 5' or 3' switch probe
(Figure 2B). The 6.4-kb illegitimate switch recombination fragment was cloned. Sequence analysis of this clone (M&M) shows that a
translocation breakpoint is located near the 3' end of the S 4 region
(sequence 6236 in Figure 2A). The IgH sequences include a 170-bp
inversion immediately adjacent to the breakpoint plus repetitive
sequences (presumably from 6p21) on the other side of the breakpoint.
Sequences from the T3 end of the clone also were repetitive, but it was possible to design oligonucleotides to generate a PCR assay that enabled us to isolate a BAC clone (CD3 BAC in Figure 2A). In
addition to the KMM-1 breakpoint-associated sequences, the CD3
BAC also contains coding sequences from the cyclin D3 gene. Thus, the
breakpoint must be located no more than 200 kb centromeric to the
cyclin D3 gene (see Note added in proof).
Detection of t(6;14)(p21;q32) in primary MM tumors Among 150 karyotypically abnormal MM tumors that had been analyzed by conventional cytogenetic and spectral karyotypic (SKY) procedures, 6 had apparent t(6;14)(p21;q32) translocations.9,10 Metaphase chromosomes from 5 tumors with apparent t(6;14)(p21;q32) translocations were analyzed by 3-color FISH using various combinations of VH, CH, CD3 cosmid, and CD3 BAC probes (Figure 2A), plus chromosome 6 or 14 painting probes. Figure 4A shows an MM tumor (MM2 in Table 1) in which a simple reciprocal t(6;14)(p21;q32) translocation juxtaposes the cyclin D3 gene (CD3 cosmid) with 3' IgH enhancer sequences (CH probe) on the 2 copies of der(14). The CD3 BAC probe cohybridizes with the CH probe on the 2 der(14) but also with the VH probe on the one copy of der(6), indicating that the breakpoint occurs within the CD3 BAC. Three of the 4 remaining tumors (MM1, MM3, and MM4) were also confirmed to have t(6;14)(p21;q32) translocations for which cyclin D3 is closely juxtaposed to CH probe sequences on both metaphase and interphase chromosomes (summarized in Table 1). The fifth tumor (MM5) is confirmed to have a t(6;14)(p21;q32) translocation, with the cyclin D3 gene and chromosome 14 sequences juxtaposed at the translocation breakpoint. However, there has been a duplication and inversion of sequences detected by the CH probe, but the CH probe is not localized near cyclin D3 at the breakpoint. It is possible that IgH enhancer sequences not detectable by our FISH assays are closely juxtaposed to cyclin D3 at the translocation breakpoint. In any case, at least 4 of 5 tumors with a t(6;14)(p21;q32) translocation detected by conventional cytogenetic or SKY analyses appear to have IgH enhancer sequences closely juxtaposed to the cyclin D3 gene. Together, these results indicate that the t(6;14)(p21;q32) translocation, with close juxtaposition of cyclin D3 and 3' IgH enhancer sequences, is present in approximately 4% of primary MM tumors.
MM tumor with a t(6;22)(p21;q11) translocation
juxtaposing C probe, which contains 3' C enhancer sequences, with CD3
cosmid sequences on the single copy of der(6), but der(22) was not
detected. The C and CD3 cosmid sequences consistently overlap on
interphase nuclei, indicating that these sequences are separated by
fewer than 500 kb. Similar to other oncogenes dysregulated by
immunoglobulin translocations, the cyclin D3 gene is bracketed by IgH
translocations with centromeric breakpoints and IgL translocations with
telomeric breakpoints.1,43
Three of 53 primary MM tumors overexpress cyclin D3 and have t(6;14)(p21;q32) translocations For each of the primary tumor samples described, we did not have appropriate samples to assess the expression of cyclin D3 mRNA or protein. Recently, however, it became possible to screen purified intramedullary MM tumor cells, which were obtained from 28 untreated and 25 treated patients, for expression of cyclin D3 mRNA by microarray analysis. As seen in Figure 5, MM tumor cells from 3 of 53 patients (P12, P26, P46) showed distinctively high levels of cyclin D3 mRNA expression. Metaphase chromosomes could be obtained only for tumor P12. However, FISH analyses of metaphase chromosomes from P12 and interphase nuclei (Figure 4C) from all 3 tumors demonstrated that the CD3 cosmid probe is closely juxtaposed to the CH probe in each case (summarized in Table 1). This confirms the close association of the t(6;14)(p21;q32) translocation with specific overexpression of cyclin D3.
Summary of 6p21 translocations with an immunoglobulin locus in MM tumors Table 1 includes results obtained for the KMM-1 cell line and 9 primary tumors. Eight tumors have a t(6;14)(p21;q32) translocation, with cyclin D3 closely juxtaposed to a CH probe that contains 3' IgH enhancer sequences in 7 of the tumors. In all informative cases, there is overexpression of cyclin D3. The cell line and 2 tumors have no der(6), whereas the other 6 tumors have one copy of der(6). In contrast, 5 tumors have one copy of der(14), whereas 2 tumors have 2 copies of der(14) and the remaining 2 tumors have 5 or 6 copies of der(14). It is also notable that the KMM-1 cell line and 5 of 6 informative tumors have a t(6;14) translocation breakpoint that occurs within the sequences present in the CD3 BAC clone, so that most breakpoints appear to be clustered in a region that is fewer than 200 kb centromeric to cyclin D3. The single tumor with a t(6;22)(p21;q11) translocation has no der(22), but cyclin D3 is closely juxtaposed to a C probe that contains 3' C enhancer sequences.
Cyclins D1, D2, and D3 are widely expressed in overlapping and apparently redundant patterns, with a degree of tissue specificity for each.11,12,26,29 For example, cyclin D1 is expressed in most proliferating tissues but is not expressed in normal proliferating lymphoid cells that instead express cyclin D2 or cyclin D3.14,31,38,44-47 Cyclin D genes generally are not expressed in quiescent (G0) cells11,34,48-50. In response to growth factors, they are transcriptionally up-regulated and then are expressed in the G1 and sometimes S phases of the cell cycle. Inhibition of cyclin D1 function by antisense sequences or injection of antibodies often results in a complete block of cell proliferation, though this result is not seen in all cases (eg, cells that do not express Rb). In avian DT40 B-lymphoma cells that express cyclins D1 and D2, targeted deletion of the endogenous cyclin D1 gene results in continued proliferation but with a prolonged G1 phase that is rendered normal by the overexpression of transfected cyclin D1, cyclin D2, or cyclin D3 genes.13 Each of the 3 cyclin D genes positively interacts with either the cdk4 or the cdk6 cyclin D-dependent kinases that phosphorylate Rb, resulting in a cascade of events that promote the G1/S cell cycle transition.11 These cyclin D-cdk complexes also bind p27 (Kip1), which does not affect the function of the cyclin D complex, but the sequestration of p27 decreases its ability to negatively regulate cyclin E-cdk2 complexes that are also involved in promoting the G1/S transition.11,51 Notably, the levels of sequestered p27 seem to be higher in lymphomas that overexpress cyclin D3 than in lymphomas that overexpress cyclin D1, suggesting a possible functional difference between cyclin D1 and cyclin D3.52 Cyclin D1 has several cdk-independent activities, including an ability to interact with and partially activate estrogen receptors in the absence of estrogen ligand or more fully activate estrogen receptor-estrogen ligand complexes.29,53 It is unclear whether cyclin D2 or cyclin D3 have cdk-independent activities. Cyclin D1 is oncogenic in model systems. Overexpression of transfected cyclin D1 in the Rat6 embryo fibroblast cell line has no effect on anchorage dependence, but it causes a decreased duration of G1 and induction of tumors in nude mice after a long latency.18 Transfection of rat embryonic fibroblasts with cyclin D1 and H-ras abrogates anchorage dependence and enables them to form fibrosarcomas in nude mice.15,17 Transgenic mice with B-lymphocyte-specific expression of cyclin D1 have apparently normal B cells that do not form tumors, but B-lymphoma tumor formation is enhanced in c-myc, N-myc, or L-myc transgenic mice that also express the cyclin D1 transgene.16,23 An MMTV-cyclin D1 transgene causes abnormal mammary cell proliferation, including development of mammary adenocarcinomas.54 Dysregulation of cyclin D1 can be a primary oncogenic event in human
tumors. The best examples of this include the inversion of chromosome
11 and the t(11;14) translocation. The inversion of chromosome 11 Convincing evidence that cyclin D2 or cyclin D3 dysregulation can be a primary oncogenic event in model systems or human tumors has been lacking. There is one report of a t(12;22)(p13;q11) translocation in a B-cell tumor with a cloned breakpoint involving a negative regulatory region of the cyclin D2 promoter; it was suggested that this would cause up-regulation of cyclin D2, but no expression data were provided.30 There are limited examples of lymphoid and nonlymphoid tumors with cyclin D2 or cyclin D3 amplification or cyclin D2 or cyclin D3 overexpression, but the significance of this remains unclear.24-29 However, we have now shown that cyclin D3 is dysregulated by translocation to one of the immunoglobulin loci in MM. The t(6;14)(p21;q32) translocation was identified originally by conventional cytogenetics techniques in tumor cells from 2 patients with MM and one patient with plasma cell leukemia. It was also reported as a recurrent translocation that was present in a small number of non-Hodgkin lymphomas.41 Surprisingly, this translocation was not reported by others who used conventional cytogenetics to analyze many karyotypically abnormal MM tumors.56-59 Recently, however, we reported 6 tumors with t(6;14)(p21;q32) translocations among 150 karyotypically abnormal primary MM tumors that were analyzed by conventional cytogenetic and SKY procedures.9,10 Conventional cytogenetics identified this translocation in only 3 of the tumors, whereas SKY identified this translocation in all 6 tumors. In "Results" we describe FISH analyses of the KMM-1 MM cell line, 5 MM tumors that have a t(6;14) (p21;q32) translocation identified by conventional cytogenetics or SKY analyses, and 3 MM tumors that overexpress cyclin D3 (Table 1). In the KMM-1 MM cell line and all 6 tumors from which we were able to obtain metaphase chromosomes, cyclin D3 was located at the translocation breakpoint. In KMM-1, in 5 of these 6 tumors, and in the 2 tumors analyzed only by interphase FISH, cyclin D3 was closely juxtaposed to a CH probe that included 3' IgH enhancer sequences. As found for other oncogenes dysregulated by immunoglobulin translocations, we show that the putative oncogene, cyclin D3, is bracketed by centromeric IgH and telomeric IgL translocation breakpoints. Moreover, cyclin D3 is overexpressed in the cell line (KMM-1) and all 3 informative tumors that have a t(6;14)(p21;q23) translocation, even though all MM cell lines express low levels of cyclin D3 (Figures 1, 5). Our results indicate that immunoglobulin translocations that dysregulate cyclin D3 can be efficiently detected by microarray analysis of RNA expression or by FISH analyses, and we suggest the possibility that microarray analysis of RNA expression may, in fact, be the best way to identify tumors with dysregulated expression of cyclin D3. Primary immunoglobulin translocations in MM appear to be generated by errors in IgH switch recombination or, less often, by errors in somatic hypermutation that occur during the generation of long-lived plasma cells in germinal centers.60 The 3 major primary translocations in MM involve 4p16, 11q13, and 16q23. Similarly, the t(6;14) (p21;q32) translocation appears to be mediated by an error in IgH switch recombination because the cloned translocation breakpoint in KMM-1 involves a switch region. Given our results for cyclin D3 dysregulation in MM, the similar functional properties of the D-type cyclins and the fact that cyclin D1 is a proven oncogene, it seems clear that cyclin D3 must be oncogenic in MM. However, for cyclin D1, cyclin D3, and other oncogenes dysregulated by translocations in MM, it remains to be determined whether the oncogenic effect results from dysregulated expression in G0 plasma cells or from markedly increased levels of expression in cycling plasma cells.
The KMM-1 t(6;14) translocation breakpoint is located approximately 65 kb from the 5' end of the cyclin D3 gene (BAC sequence AL513008).
We thank Johanna Hardin for her help designing methods for analysis of the microarray RNA expression data and Giovanni Tonon for helpful suggestions.
Submitted January 26, 2001; accepted March 8, 2001.
Supported by the Howard Temin Award (CA74265) from the National Cancer Institute (P.L.B.).
J.S. and A.G. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Michael Kuehl, Genetics Department, Medicine Branch, Naval Hospital, Bldg 8, Rm 5101, Bethesda, MD 20889-5105; e-mail: wmk{at}helix.nih.gov.
1. Kirsch IR. The Causes and Consequences of Chromosomal Aberrations. Boca Raton, FL: CRC Press; 1993. 2. Korsmeyer SJ. Chromosomal translocations in lymphoid malignancies reveal novel proto-oncogenes. Annu Rev Immunol. 1992;10:785-807[CrossRef][Medline] [Order article via Infotrieve]. 3. Papavasiliou FN, Schatz DG. Cell-cycle-regulated DNA double-stranded breaks in somatic hypermutation of immunoglobulin genes [In Process Citation]. Nature. 2000;408:216-221[CrossRef][Medline] [Order article via Infotrieve].
4.
Goossens T, Klein U, Kuppers R.
Frequent occurrence of deletions and duplications during somatic hypermutation: implications for oncogene translocations and heavy chain disease.
Proc Natl Acad Sci U S A.
1998;95:2463-2468 5. Avet-Loiseau H, Garand R, Gaillard F, et al. Detection of t(11;14) using interphase molecular cytogenetics in mantle cell lymphoma and atypical chronic lymphocytic leukemia. Genes Chromosomes Cancer. 1998;23:175-182[CrossRef][Medline] [Order article via Infotrieve].
6.
Bergsagel PL, Chesi MC, Nardini E, Brents LA, Kirby SL, Kuehl WM.
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc Natl Acad Sci.
1996;93:13931-13936
7.
Chesi M, Kuehl WM, Bergsagel PL.
Recurrent immunoglobulin gene translocations identify distinct molecular subtypes of myeloma.
Ann Oncol.
2000;11:131-135
8.
Shou Y, Martelli ML, Gabrea A, et al.
Diverse karyotypic abnormalities of the c-myc locus associated with c-myc dysregulation and tumor progression in multiple myeloma.
Proc Natl Acad Sci U S A.
2000;97:228-233
9.
Sawyer JR, Lukacs JL, Munshi N, et al.
Identification of new nonrandom translocations in multiple myeloma with multicolor spectral karyotyping.
Blood.
1998;92:4269-4278 10. Sawyer JR, Lukacs JL, Thomas EL, et al. Multicolour spectral karyotyping identifies new translocations and a recurring pathway for chromosome loss in multiple myeloma. Br J Haematol. 2000;112:1-9[CrossRef].
11.
Sherr CJ.
The Pezcoller Lecture: cancer cell cycles revisited.
Cancer Res.
2000;60:3689-3695 12. Sicinski P, Donaher JL, Geng Y, et al. Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature. 1996;384:470-474[CrossRef][Medline] [Order article via Infotrieve].
13.
Lahti JM, Li H, Kidd VJ.
Elimination of cyclin D1 in vertebrate cells leads to an altered cell cycle phenotype, which is rescued by overexpression of murine cyclins D1, D2, or D3 but not by a mutant cyclin D1.
J Biol Chem.
1997;272:10859-10869
14.
Lam EW, Glassford J, Banerji L, Thomas NS, Sicinski P, Klaus GG.
Cyclin D3 compensates for loss of cyclin D2 in mouse B-lymphocytes activated via the antigen receptor and CD40.
J Biol Chem.
2000;275:3479-3484
15.
Hinds PW, Dowdy SF, Eaton EN, Arnold A, Weinberg RA.
Function of a human cyclin gene as an oncogene.
Proc Natl Acad Sci U S A.
1994;91:709-713 16. Lovec H, Grzeschiczek A, Kowalski MB, Moroy T. Cyclin D1/bcl-1 cooperates with myc genes in the generation of B-cell lymphoma in transgenic mice. EMBO J. 1994;13:3487-3495[Medline] [Order article via Infotrieve]. 17. Lovec H, Sewing A, Lucibello FC, Muller R, Moroy T. Oncogenic activity of cyclin D1 revealed through cooperation with H-ras: link between cell cycle control and malignant transformation. Oncogene. 1994;9:323-326[Medline] [Order article via Infotrieve]. 18. Jiang W, Kahn SM, Zhou P, et al. Overexpression of cyclin D1 in rat fibroblasts causes abnormalities in growth control, cell cycle progression and gene expression. Oncogene. 1993;8:3447-3457[Medline] [Order article via Infotrieve].
19.
Chesi M, Bergsagel PL, Brents LA, Smith CM, Gerhard DS, Kuehl WM.
Dysregulation of cyclin D1 by translocation into an IgH gamma switch region in two multiple myeloma cell lines.
Blood.
1996;88:674-681 20. Campo E, Raffeld M, Jaffe ES. Mantle-cell lymphoma. Semin Hematol. 1999;36:115-127[Medline] [Order article via Infotrieve].
21.
Pruneri G, Fabris S, Baldini L, et al.
Immunohistochemical analysis of cyclin D1 shows deregulated expression in multiple myeloma with the t(11;14).
Am J Pathol.
2000;156:1505-1513 22. Lai JL, Michaux L, Dastugue N, et al. Cytogenetics in multiple myeloma: a multicenter study of 24 patients with t(11;14)(q13;q32) or its variant. Cancer Genet Cytogenet. 1998;104:133-138[CrossRef][Medline] [Order article via Infotrieve]. 23. Bodrug SE, Warner BJ, Bath ML, et al. Cyclin D1 transgene impedes lymphocyte maturation and collaborates in lymphomagenesis with the myc gene. EMBO J. 1994;13:2124-2130[Medline] [Order article via Infotrieve]. 24. Baldassarre G, Belletti B, Bruni P, et al. Overexpressed cyclin D3 contributes to retaining the growth inhibitor p27 in the cytoplasm of thyroid tumor cells. J Clin Invest. 1999;104:865-874[Medline] [Order article via Infotrieve].
25.
Delmer A, Ajchenbaum-Cymbalista F, Tang R, et al.
Overexpression of cyclin D2 in chronic B-cell malignancies.
Blood.
1995;85:2870-2876 26. Doglioni C, Chiarelli C, Macri E, et al. Cyclin D3 expression in normal, reactive and neoplastic tissues. J Pathol. 1998;185:159-166[CrossRef][Medline] [Order article via Infotrieve]. 27. Kuchiki H, Saino M, Nobukuni T, et al. Detection of amplification of a chromosomal fragment at 6p21 including the cyclin D3 gene in a glioblastoma cell line by arbitrarily primed polymerase chain reaction. Int J Cancer. 2000;85:113-116[CrossRef][Medline] [Order article via Infotrieve].
28.
Leach FS, Elledge SJ, Sherr CJ, et al.
Amplification of cyclin genes in colorectal carcinomas.
Cancer Res.
1993;53:1986-1989 29. Hall M, Peters G. Genetic alterations of cyclins, cyclin-dependent kinases, and Cdk inhibitors in human cancer. Adv Cancer Res. 1996;68:67-108[Medline] [Order article via Infotrieve]. 30. Qian L, Gong J, Liu J, Broome JD, Koduru PR. Cyclin D2 promoter disrupted by t(12;22)(p13;q11.2) during transformation of chronic lymphocytic leukaemia to non-Hodgkin's lymphoma. Br J Haematol. 1999;106:477-485[CrossRef][Medline] [Order article via Infotrieve]. 31. Teramoto N, Pokrovskaja K, Szekely L, et al. Expression of cyclin D2 and D3 in lymphoid lesions. Int J Cancer. 1999;81:543-550[CrossRef][Medline] [Order article via Infotrieve]. 32. Gabrea A, Bergsagel PL, Chesi M, Shou Y, Kuehl WM. Insertion of excised IgH switch sequences causes overexpression of cyclin D1 in a myeloma tumor cell. Mol Cell. 1999;3:119-123[CrossRef][Medline] [Order article via Infotrieve]. 33. Inaba T, Matsushime H, Valentine M, Roussel MF, Sherr CJ, Look AT. Genomic organization, chromosomal localization, and independent expression of human cyclin D genes. Genomics. 1992;13:565-574[CrossRef][Medline] [Order article via Infotrieve].
34.
Motokura T, Keyomarsi K, Kronenberg HM, Arnold A.
Cloning and characterization of human cyclin D3, a cDNA closely related in sequence to the PRAD1/cyclin D1 proto-oncogene.
J Biol Chem.
1992;267:20412-20415
35.
Zhang XG, Gaillard JP, Robillard N, et al.
Reproducible obtaining of human myeloma cell lines as a model for tumor stem cell study in human multiple myeloma.
Blood.
1994;83:3654-3663
36.
Shaughnessy J, Tian E, Sawyer J, et al.
High incidence of chromosome 13 deletion in multiple myeloma detected by multiprobe interphase FISH.
Blood.
2000;96:1505-1511
37.
Chesi M, Nardini E, Lim RSC, Smith KD, Kuehl WM, Bergsagel PL.
The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts.
Blood.
1998;92:3025-3034
38.
Uchimaru K, Taniguchi T, Yoshikawa M, et al.
Detection of cyclin D1 (bcl-1, PRAD1) overexpression by a simple competitive reverse transcription-polymerase chain reaction assay in t(11;14)(q13;q32)-bearing B-cell malignancies and/or mantle cell lymphoma.
Blood.
1997;89:965-974 39. Namba M, Ohtsuki T, Mori M, et al. Establishment of five human myeloma cell lines. In Vitro Cell Dev Biol. 1989;25:223-229[Medline] [Order article via Infotrieve].
40.
Taniwaki M, Nishida K, Takashima T, et al.
Nonrandom chromosomal rearrangements of 14q32.3 and 19p13.3 and preferential deletion of 1p in 21 patients with multiple myeloma and plasma cell leukemia.
Blood.
1994;84:2283-2290 41. Offit K, Chaganti RS. Chromosomal aberrations in non-Hodgkin's lymphoma: biologic and clinical correlations. Hematol Oncol Clin North Am. 1991;5:853-869[Medline] [Order article via Infotrieve]. 42. Popescu NC, Zimonjic DB. Molecular cytogenetic characterization of cancer cell alterations. Cancer Genet. Cytogenet. 1997;93:10-21[CrossRef][Medline] [Order article via Infotrieve].
43.
Chesi M, Bergsagel PL, Shonukan OO, et al.
Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma.
Blood.
1998;91:4457-4463
44.
Wagner EF, Hleb M, Hanna N, Sharma S.
A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation.
J Immunol.
1998;161:1123-1131 45. Blanchard DA, Affredou MT, Vazquez A. Modulation of the p27kip1 cyclin-dependent kinase inhibitor expression during IL-4-mediated human B cell activation. J Immunol. 1997;158:3054-3061[Abstract]. 46. Pokrovskaja K, Ehlin-Henriksson B, Bartkova J, et al. Phenotype-related differences in the expression of D-type cyclins in human B cell-derived lines. Cell Growth Differ. 1996;7:1723-1732[Abstra |