|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Departments of Developmental and Molecular
Biology, Pathology, and Obstetrics and Gynecology, Albert Einstein
College of Medicine, Bronx, New York.
Colony-stimulating factor 1 (CSF-1) regulates the survival,
proliferation, and differentiation of mononuclear phagocytes. It is
expressed as a secreted glycoprotein or proteoglycan found in the
circulation or as a biologically active cell-surface glycoprotein. To
investigate tissue CSF-1 regulation, CSF-1-null
Csf1op/Csf1op mice expressing
transgenes encoding the full-length membrane-spanning CSF-1 precursor
driven by 3.13 kilobases of the mouse CSF-1 promoter and first intron
were characterized. Transgene expression corrected the gross
osteopetrotic, neurologic, weight, tooth, and reproductive defects of
Csf1op/Csf1op mice. Detailed
analysis of one transgenic line revealed that circulating CSF-1, tissue
macrophage numbers, hematopoietic tissue cellularity, and hematopoietic
parameters were normalized. Tissue CSF-1 levels were normal except for
elevations in 4 secretory tissues. Skin fibroblasts from the transgenic
mice secreted normal amounts of CSF-1 but also expressed some
cell-surface CSF-1. Also, lacZ driven by the same
promoter/first intron revealed Colony-stimulating factor 1 (CSF-1), the primary
regulator of mononuclear phagocyte production, also regulates cells of
the female reproductive tract.1,2 The effects of
CSF-1 are mediated by a high-affinity receptor tyrosine kinase
(CSF-1R)3-5 encoded by the c-fms
protooncogene.6 Complementary DNA (cDNA) clones encoding several different isoforms of both mouse and human CSF-1 have been obtained.7-12 Full-length CSF-1 cDNAs direct the
expression of both secreted glycoprotein13,14 and
proteoglycan15,16 forms, whereas the membrane-bound
cell-surface form is derived from a truncated messenger RNA (mRNA)
precursor in which the glycosaminoglycan addition site and the
proteolytic cleavage sites yielding the secreted forms have been
spliced out.17 The N-terminal 152 amino acids of CSF-1 are
required for in vitro biological activity.1,12
Although CSF-1 is synthesized by many different cell types in
vitro, the primary source of the circulating proteoglycan
and glycoprotein forms is thought to be the endothelial cells that line
the small blood vessels.18 However, CSF-1 is synthesized locally, eg, by osteoblasts19,20 and, during pregnancy, by uterine epithelial cells.21 It has been suggested that
regulation at particular tissue sites is mediated by local synthesis of
the membrane-spanning, cell-surface CSF-1 and/or selective
sequestration of the secreted proteoglycan CSF-1.15,16,22
CSF-1-null Csf1op/Csf1op
mice harbor an inactivating mutation in the coding region of the
CSF-1 gene23-26 and are osteopetrotic because of their
paucity of osteoclasts.27 They are toothless, have low
body weight, low growth rate, skeletal abnormalities, and are deficient
in tissue macrophages.23,27-30 In addition, they have
defects in both male and female fertility, neural development, the
dermis, and synovial membranes.2 Because CSF-1R expression outside the female reproductive tract is apparently restricted to
mononuclear phagocytes,1,2 the pleiotropic phenotype of the Csf1op/Csf1op mouse is
apparently due to a reduction in trophic and/or scavenger functions of
the tissue macrophages regulated by CSF-1, secondary to the reduction
of their concentration in tissues.30
Reconstitution of circulating levels of CSF-1 in
Csf1op/Csf1op mice, by
daily subcutaneous injection of human recombinant CSF-1 from 3 days of
age, partially or completely restored many tissue macrophage
populations, whereas others failed to respond and were presumed to have
an embryonic requirement for CSF-1, to be present at sites inaccessible
to circulating CSF-1, or to be dependent on the local production of
CSF-1.30 In the present study, we have used a transgene
encoding the full-length CSF-1 precursor to reconstitute circulating
and tissue levels of secreted CSF-1 and some cell-surface CSF-1
expression. We have established that the forms of CSF-1 encoded by this
precursor, when expressed in an essentially normal tissue-specific and
developmental pattern, correct the defects reported in
Csf1op/Csf1op mice, confirming that
all the phenotypes found in these mice are due to the absence of CSF-1
and not due to a linked secondary mutation. We have identified
regulatory regions of the CSF-1 gene that confer normal
tissue-specific expression of CSF-1 and used these to drive
expression of the lacZ gene, pinpointing sites of
local CSF-1 production in tissues.
Animals
Transgene constructs and production of transgenic animals
Genotypic analysis
Founder mice expressing the CSF-1 transgene were first detected by Southern hybridization of mouse tail DNA samples digested with DraIII and probed with a 32P-labeled CSF-1 cDNA insert from plasmid pGEM2MCSF53.10 Subsequent TgN(FLCsf1)Ers transgene genotype analysis was carried out by multiplex PCR using primers P3 (GCAGCTGTTAAAACTAATGTGATCTTAATC) and P4 (ATGAGGACAGACAGGTGGAACTGCCAGTAATGAAG) to detect transgene (Figure 1B). Expression of TgN(Csf1-Z)1Ers was detected using primers P5 (CCCAACTTAATCGCCTTGCAGCACATCCCC) and P6 (CTGCCAGTTTGAGGGGACGACGACAGTATC) (Figure 1C). Measurement of CSF-1 CSF-1 was measured by radioimmunoassay.34,35 Tissue extracts were prepared from exsanguinated mice as described elsewhere.36 Cell-surface CSF-1 was measured by flow cytometry (below) and by trypsin release of intact CSF-1 followed by radioimmunoassay.Analyses of mRNAs Ribonuclease protection assays (RPAs) were carried out using an RPA II kit (Ambion, Austin, TX) by probing 10 µg of DNase1-treated total tissue RNA with 32P-labeled RNA probes synthesized using a MAXIscript Sp6/T7 kit (Ambion) from linearized PCR-vector (Invitrogen, Carlsbad, CA)-based intermediate plasmid DNA, in which PCR products for the exon 9/hGH RPA probe (from the BamHI site of exon 6 to the SmaI site of the hGH untranslated region [UTR], including the hGH poly(A) addition site, Figure 1B) and exon 10 probe (Figure 1A) were amplified from TgN(FLCsf1)Ers DNA and pGEM2MCSF10 DNA,10 respectively.X-ray analysis of mouse skeletal structure Radiographs were produced by exposing euthanized or anesthetized mice in a Faxitron pathology specimen x-ray cabinet (Faxitron X-Ray, Buffalo Grove, IL). The animals were posed immediately above a fine-grained Polaroid 665 instant-negative film package. Exposure was set at 50 kV for 1.5 minutes. The negatives were developed and printed according to the manufacturer's instructions (Polaroid, Cambridge, MA).Immunohistochemistry, histochemistry, and flow cytometry For immunostaining with rat monoclonal antibody F4/8037 and histochemical localization of tartrate-resistant acid phosphatase (TRAP), siblings of the different genotypes were perfused and tissues fixed, decalcified (knee joint only), embedded, sectioned, and immunostained as described.30 F4/80+ cells in tissue sections of at least 2 mice of a particular genotype at each age were quantitated as described.30 For localization of -galactosidase, 5-mm tissue cubes were fixed and stained by incubation with
4-chloro-5-bromo-3-indolyl-b-D-galactopyranoside as
described.38 Alternate 5- and 20-mm sections were used for hematoxylin and eosin (H&E) staining and for observation of
-galactosidase localization, respectively. For all of the tissues
shown, there was minimal -galactosidase staining in nontransgenic
tissues. For flow cytometry analysis of cell-surface CSF-1, single-cell suspensions of primary skin fibroblasts were made from +/+,
+/Csf1op, Csf1op/Csf1op,
and Csf1op/Csf1op; TgN(FLCsf1)2Ers/+
mice and incubated sequentially with rat antimouse CSF-1 YYG106
monoclonal (2 µg/106 cells)35 and
phycoerythrin-goat antirat and phycoerythrin-conjugated rabbit
antigoat antibodies. Fluorescence-activated cell sorter (FACS) analyses
were done with a Becton Dickinson FACSCalibur (San Jose, CA) in the
FACS facility of Albert Einstein College of Medicine.
Hematopoietic parameters Red cell lysis, antibody staining (FITC-CD45.2 and PerCp-B220, Pharmingen, San Diego, CA), and FACS and data analysis of heparinized blood samples were standard procedures carried out as described.39 Spleen and bone marrow cell suspensions were assayed for colony-forming cells of high proliferative potential (HPP-CFC) and low proliferative potential (CFU-C) as previously described.40 BFU-E (burst-forming unit-erythroid) and CFU-GEMM (colony-forming unit-granulocyte, erythroid, macrophage, megakaryocyte) assays were performed using reagents supplied by Stem Cell Technology, as described by the manufacturers (Stem Cell Technologies, Vancouver, BC, Canada).
Circulating levels of CSF-1 and fibroblast CSF-1 expression in Csf1op/Csf1op mice expressing the full-length CSF-1 transgene, TgN(FLCsf1)Ers The CSF-1 transgene, TgN(FLCsf1)Ers, included the first intron to increase the likelihood of efficient expression of the transgene and an additional 700-bp hGH poly(A) addition site sequence downstream of the CSF-1 cDNA (Figure 1B), because the 2 kb (exon 9 5' UTR) CSF-1 cDNA does not contain a canonical mRNA poly(A) addition site sequence. Southern analysis of the tail DNA of 2 transgenic founder mice revealed that each contained multiple copies (TgN(FLCsf1)2Ers/+, about 10, and TgN(FLCsf1)4Ers/+, about 40) of the complete CSF-1 transgene (data not shown). In contrast to Csf1op/Csf1op mice, which expressed no detectable circulating CSF-1, either Csf1op/Csf1op; TgN(FLCsf1)2Ers/+ mice or +/Csf1op TgN(FLCsf1)2Ers/+ mice possessed serum CSF-1 concentrations indistinguishable from those of +/+ or +/Csf1op mice (Table 1). However, the serum CSF-1 concentrations of Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ mice, containing about 4 times higher levels of the transgene, were 3 times those of +/Csf1op mice (Table 1). Despite the higher than normal levels of circulating CSF-1 in the Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ mice, careful examination of 15 Csf1op/Csf1op; TgN(FLCsf1)4Ers/+ mice revealed that they possessed the same gross phenotype (see below) as Csf1op/Csf1op; TgN(FLCsf1)2Ers/+, +/+, or +/Csf1op mice and were similarly fertile. Further detailed studies of Csf1op/Csf1op mice expressing TgN(FLCsf1)Ers reported here used the Csf1op/Csf1op; TgN(FLCsf1)2Ers/+ mice (TgN(FLCsf1)2Ers is henceforth abbreviated TgC). Skin fibroblasts from Csf1op/Csf1op; TgC/+ mice secreted CSF-1 in amounts equivalent to +/Csf1op fibroblasts but less than +/+ fibroblasts and expressed approximately a third of the amount of cell-surface CSF-1 expressed by +/Csf1op fibroblasts, as assessed by FACS analysis of cells stained with anti-CSF-1, or by trypsin release of intact CSF-1 from the cell surface (Figure 2).
Gross phenotype of Csf1op/Csf1op; TgC/+ mice The CSF-1-null Csf1op/Csf1op mice exhibit impaired bone resorption associated with a reduction in the number of osteoclasts.27 Their inability to remodel bone results in skeletal deformities, particularly in the long bones, which are dense, short, and thick (Figure 3G); in the flat bony plates, which produce their characteristically domed skull (Figure 3C); and in the mandible, resulting in a failure of tooth eruption (Figure 3C). These gross skeletal defects were completely restored by expression of either transgene (compare Figure 3F,D with Figure 3E,B). Upper and lower incisor tooth eruption, absent in Csf1op/Csf1op mice (Figure 3C), occurred on postnatal days 9 and 10 after birth in both +/Csf1op and transgenic Csf1op/Csf1op mice (Figure 3B,D). In contrast to the sometimes abnormally curved or misaligned (Figure 3A) incisor teeth of Csf1op/Csf1op mice injected daily with CSF-1 from the third postnatal day,30 incisor teeth of the transgenic Csf1op/Csf1op mice always appeared to be normal and properly aligned (Figure 3D). The decreased head size and shortening of the facial bones (Figure 3C), the stubby appearance of the tarsals and metatarsals, and the appearance of the femur and humerus (Figure 3G) in the Csf1op/Csf1op mice were also restored to normal by transgene expression (Figure 3D,F). Remodeling of the marrow space can be clearly seen in the tarsals and tibia and noticeably in tail vertebrae of both normal +/Csf1op as well as transgenic Csf1op/Csf1op mice (Figure 3E,F,H,I) but is very much reduced in the Csf1op/Csf1op mutant mice (Figure 3G,J). Despite their powdered chow and milk formula diet, Csf1op/Csf1op mice still exhibited decreased adult body weight and a retarded growth rate (Figure 4). In contrast, the growth rate of Csf1op/Csf1op; TgC/+ mice was not significantly different from the growth rate of age-matched normal +/Csf1op littermates (Figure 4). The gross neurologic defects of Csf1op/Csf1op mice, blindness and deafness,41 were also absent in Csf1op/Csf1op; TgC/+ mice (data not shown).
Restoration of tissue CSF-1 expression in Csf1op/Csf1op; TgC/+ mice The ability of the transgene to reconstitute the expression of CSF-1 in tissues was examined by comparing tissue CSF-1 concentrations of Csf1op/Csf1op; TgC/+ and normal +/Csf1op mice. Biologically active CSF-1 protein was detected in every transgenic Csf1op/Csf1op tissue, and most possessed levels that were not significantly different from those of +/Csf1op mice (Table 2). Importantly, the dramatic elevation in uterine CSF-1 expression reported for normal mice during pregnancy36 was also detected in the Csf1op/Csf1op; TgC/+ mice, indicating that the transgene confers normal tissue-specific regulation of CSF-1 during pregnancy. However, CSF-1 concentrations in several secretory organs salivary glands, prostate, bladder, and
testes/epididymiswere significantly higher than those of the
corresponding +/Csf1op tissues. The widespread
detection of at least normal levels of CSF-1 in tissue extracts from
transgenic Csf1op/Csf1op
mice suggests that regulation of the transgene construct for the most
part reflects the regulation of endogenous CSF-1 gene expression.
TgC rescue of Csf1op/Csf1op mouse reproductive defects The important role of CSF-1 in ovulation, preimplantation, placental function, regulation of the estrus cycle, and lactation has been previously described.2,42,43 Estrus cycling times are disturbed in mature Csf1op/Csf1op mice, with estrus occurring irregularly and more infrequently (average duration 14.5 days) than the estrus times of normal mice (about 5 days). The estrus cycling time of female Csf1op/Csf1op; TgC/+ mice, determined by the appearance in the vagina of exfoliated anuclear cornified cells and the absence of macrophages,43 was 4.5 ± 0.6 days (n = 5). This was indistinguishable from the cycling time for their phenotypically normal +/Csf1op siblings (4.8 ± 0.2 days). The litter size (about 7 pups) of the Csf1op/Csf1op; TgC/+ CSF-1 mice was similarly normal. Furthermore, even though only 10% of Csf1op/Csf1op mothers feed pups,44 observation of more than 20 litters resulting from Csf1op/Csf1op; TgC/+ × Csf1op/Csf1op +/+ crosses indicate that Csf1op/Csf1op; TgC/+ mothers were able to raise normal-size litters.Csf1op/Csf1op male mice have low testosterone levels, a low libido, and reduced viable sperm numbers compared with normal males and mate infrequently, displaying a long latency between mating when presented serially with female mice in estrus.45 Restoration of normal male libido was apparent in Csf1op/Csf1op; TgC/+ mice, which mated frequently with cycling females and produced plugged females on successive days following daily exposure to different superovulated females (data not shown). Expression of TgC transgene mRNA A labeled RNA probe covering exon 9 and hGH sequences that allowed the simultaneous comparison of endogenous and transgenic CSF-1 mRNA by RPA (Figure 1B) revealed that the CSF-1 transgene mRNA was detected in each of the tissues examined (Figure 5A). However, the amount of transgene-specific mRNA containing the hGH sequences was low compared with that of the endogenous exon 9-containing CSF-1 mRNA. Because the ratio of the 2.0-kb exon 9-containing CSF-1 mRNA to the 4.0-kb exon 10-containing CSF-1 mRNA is lower in tissues of Csf1op/Csf1op mice than in +/+ mice,23,26 the high levels of exon 9-containing mRNA detected in Csf1op/Csf1op; TgC/+ tissues (Figure 5A) prompted us to use an exon 10 probe (Figure 1A) with the exon 9/hGH probe to examine the relative contributions of the alternatively spliced exon 9- and exon 10-containing versions of CSF-1 mRNA in Csf1op/Csf1op; TgC/+, wild-type, and Csf1op/Csf1op mice (Figure 5B). This comparison demonstrated a much higher ratio of exon 9- to exon 10-containing mRNA in the tissues of Csf1op/Csf1op; TgC/+ mice than in the tissues of their Csf1op/Csf1op littermates (Figure 5B, right panel), indicating that the high expression of exon 9 mRNA relative to the transgene in Figure 5A is due to use of the endogenous CSF-1 poly(A) addition site upstream of the hGH poly(A) addition sequences in the transgene. Thus, the CSF-1 transgene mRNA is expressed at sufficiently high levels to explain the normalization of CSF-1 in most tissues of Csf1op/Csf1op; TgC/+ mice.
Development of F4/80+ tissue macrophages in Csf1op/Csf1op; TgC/+ mice Examination of the development of cells expressing the macrophage-specific cell-surface protein F4/80 in tissues of Csf1op/Csf1op mice indicated that most F4/80 macrophage populations are partially or completely dependent on CSF-1 for their development and maintenance.30 To assess whether expression of TgC in Csf1op/Csf1op mice reconstituted F4/80+ macrophage expression in these tissues, F4/80+ macrophages in Csf1op/Csf1op; TgC/+, Csf1op/Csf1op, and normal (+/Csf1op) mice were quantified in tissues prepared from mice at the ages where the F4/80+ macrophage density had previously been shown30 to be maximum for the particular wild-type tissue (Table 3). Previous studies showed that injected CSF-1 is unable to restore F4/80+ macrophages, which colonize the adrenal gland and dense connective tissues including tendon, striated muscle, deep dermis, synovium, and periosteum.30 F4/80+ macrophages in these tissues are completely recovered in the tissues of Csf1op/Csf1op; TgC/+ mice, being present at slightly elevated numbers compared with their density in normal tissues (Figure 6, Table 3). Tissues containing CSF-1-dependent F4/80+ macrophages that are only partially restored by injection of CSF-1 include bladder, sublingual salivary gland, stomach, and villus cores of the small intestine and large intestine.30 With the exception of bladder, which showed a partial response to expression of TgC, F4/80+ macrophages in these tissues were also restored to at least normal levels (Figure 6, Table 3). Tissues in which F4/80+ macrophages attained at least normal levels with restoration of circulating CSF-1 by injection included tissues such as kidney, liver, and spleen. F4/80+ macrophages were restored to normal levels in these tissues in Csf1op/Csf1op; TgC/+ mice (Table 3). In lymph node and thymus and among epidermal Langerhans cells and bone marrow monocytes, examined at ages in which the F4/80+ macrophage density was relatively normal in Csf1op/Csf1op mice,30 the F4/80+ cell densities for Csf1op/Csf1op; TgC/+ mice approximated those of both Csf1op/Csf1op and +/Csf1op mice, except in the case of thymus where the F4/80+ macrophage density was somewhat lower for Csf1op/Csf1op mice than previously reported. Macrophages interdigitating with Leydig cells in the intertubular spaces of the testes have been shown to be almost completely absent in Csf1op/Csf1op mice.46 Compared with +/Csf1op mice, their numbers in Csf1op/Csf1op; TgC/+ mice (Figure 6) were slightly higher (Table 3). These data indicate that TgC confers approximately normal regulation of the development of all CSF-1-dependent F4/80+ tissue macrophage populations examined.
Normalization of hematopoietic parameters in Csf1op/Csf1op; TgC/+ mice To examine the hematopoietic status of the Csf1op/Csf1op; TgC/+ mice, bone marrow, spleen, and hematopoietic progenitor cell numbers were determined at 6 weeks of age (Table 4). The reduced bone marrow cellularity of Csf1op/Csf1op mice was restored to normal by expression of TgC. Consistent with their reduced space for marrow hematopoiesis and in agreement with their reported compensatory splenic hematopoiesis,40 the splenic cellularities of 6-week-old Csf1op/Csf1op mice were significantly elevated compared with those of +/Csf1op mice. As expected from their normal bone marrow cellularity, these parameters in Csf1op/Csf1op; TgC/+ mice were indistinguishable from those of +/Csf1op mice. In agreement with previous reports,28,47 blood monocyte and lymphocyte percentages were reduced in Csf1op/Csf1op mice and, consistent with one other report,48 blood granulocyte percentages were increased. All these changes were normalized in the blood of the Csf1op/Csf1op; TgC/+ mice (Figure 7, Table 4). Previous studies have shown that the Csf1op mutation does not alter the relative frequency of BFU-E, CFU-GEMM, HPP-CFC, or CFU-C progenitor cells in the bone marrow.40 There was no significant difference in the frequency of these various progenitors in the bone marrows of Csf1op/Csf1op; TgC/+, Csf1op/Csf1op, and +/Csf1op mice (Table 4).
Localization of in vivo sites of CSF-1 synthesis TgC drives relatively normal tissue-specific and developmental expression of CSF-1 and corrects all the major aspects of the Csf1op/Csf1op phenotype. To rapidly identify CSF-1-synthesizing cells within tissues, we constructed a transgene with the same regulatory regions but encoding-galactosidase instead of CSF-1 (TgN(Csf1-Z)Ers [TgZ], Figure 1C).
Two transgenic founder mice were obtained, only one of which
transmitted the transgene. TgZ/+ mice showed no abnormal
phenotype and were used exclusively for this study.
Analysis of the expression of
Expression of New sites of CSF-1 synthesis are also indicated for other tissues
(Figure 10). The
We have shown that expression of a transgene encoding full-length
CSF-1 under the control of 3.13 kb of the CSF-1 promoter and first
intron completely corrected the gross defects of the CSF-1-null
Csf1op/Csf1op mouse, including the
osteopetrotic, neurologic, weight, skeletal, tooth eruption,
hematopoietic, and reproductive defects. Save for overexpression in 4 tissues, it normalized CSF-1 expression in the circulation and in
tissues, including uterus during pregnancy, where CSF-1 expression is
dramatically increased. In addition, expression of the transgene
restored tissue F4/80+ macrophage densities in a temporally
correct fashion. These results suggest that this transgene provides all
the forms of CSF-1 necessary for normal regulation of both locally and
humorally regulated target cells. This point is emphasized in Table
5, which summarizes the relative
incompleteness of the reconstitution of F4/80+ macrophage
densities in Csf1op/Csf1op mice
injected with CSF-1, compared with those expressing the transgene.
The exon 9 poly(A) addition signal was used quite efficiently in the transgene, although transcripts derived from use of the hGH poly(A) addition signal were present in each tissue examined. The exon 10 3' UTR contains AU-rich repeats, absent in exon 9, that in the right context confer a short half-life on mRNAs.10,53 Thus, the high levels of expression of CSF-1 in the secretory organs, bladder, testes/epididymis, prostate, and salivary glands may result from the use of the exon 9 3' UTR in the transgene, because the levels of mRNA for 2 of the 4 tissues examined, testis and salivary gland, are significantly elevated over their expression in +/Csf1op mice. Although the detailed data presented here are analyses of a single
CSF-1 transgenic line, an identical gross phenotype was observed with a
second independent line that expressed 3-fold higher levels of
circulating CSF-1. In addition, we have recently used the same CSF-1
promoter/intron 1 region to drive expression of another form of CSF-1
encoded by a truncated CSF-1 cDNA and have shown that it has a similar
pattern of tissue expression (data not shown). For the above reasons,
we believe that the pattern of tissue CSF-1 expression driven by the
promoter/first intron is position- and copy number-independent.
Furthermore, as we have also shown here, this regulatory region drives
expression of a lacZ reporter gene specifically in all
previously documented sites of local CSF-1 synthesis within tissues.
Thus, the 3.13-kb CSF-1 promoter/first intron are apparently sufficient
to regulate normal CSF-1 gene expression. Previous studies of the
regulation of CSF-1 gene expression have utilized CSF-1 reporter
constructs containing 774 bp of the mouse CSF-1 promoter transfected
into fibroblasts, monocytes, osteoblast-like, and COS-7 cell
lines.54,55 Several putative trans-acting factors for
cis-acting elements in this region of the promoter have been
identified,54 and it has been shown that expression in
different cell types is mediated by common and by cell type-specific
transcription factors.54,56 However, the minimal promoter
length required for normal tissue-specific and developmental
expression has not been established, and modulation of CSF-1 gene
expression by parathyroid hormone (PTH), tumor necrosis factor- Although previous experiments involving transfection of the full-length exon 10-containing CSF-1 cDNA into NIH3T3 cells failed to demonstrate cell-surface expression of the more truncated glycoprotein, the expression of the larger more prominent proteoglycan was not studied.13 Consistent with our observation of cell-surface expression in Csf1op/Csf1op; TgC/+ fibroblasts, others have demonstrated cell-surface expression in COS-7 cells expressing full-length CSF-1 cDNA.11 Whether the surface expression is due to a membrane-spanning or membrane-associated CSF-1 remains to be established. As indicated above (Table 5), restoration of circulating CSF-1 in Csf1op/Csf1op mice by daily injection of CSF-1 was only partially successful in correcting the Csf1op/Csf1op defects, suggesting that either CSF-1 must be given embyronically, be synthesized locally, be expressed on the surface of cells, contain the correct glycosaminoglycan as the proteoglycan form, or various combinations of these possibilities for complete correction of the Csf1op/Csf1op defects to occur. The present successful correction by the full-length transgene is likely to have satisfied all of these putative requirements but is unable to resolve which requirement is necessary for correction of each particular defect. Using this promoter/intron combination to drive appropriate CSF-1 cDNAs, it should be possible to independently investigate the roles of the secreted glycoprotein, secreted proteoglycan, and cell-surface forms of the growth factor. The pattern of the transgenic expression of Analysis of TgZ/+ mice suggests that synthesis of CSF-1 occurs at several novel sites besides those mentioned above, in which CSF-1-responding cells are localized. These sites include cells in the cortex and hypothalamus of the brain, cells in the zona reticularis of the adrenal gland, and cells in the neck of the sebaceous gland. Analysis of the role of CSF-1 synthesis at these sites and the sites mentioned above, in which CSF-1 synthesis juxtaposes CSF-1-responding cells, should greatly increase our understanding of local regulation by this growth factor. Previous studies with
Csf1op/Csf1op mice have
indicated that CSF-1 target cells have important scavenger (eg,
osteoclasts62), trophic (eg, testicular
macrophages42,46,52), and immunologic (eg,
trophoblasts63) roles in the development, maintenance, and
function of the tissues in which they reside. Given the restricted distribution of the CSF-1 receptor to mononuclear phagocytes and cells
of the female reproductive tract,1,2 such functions explain the pleiotropic nature of the Csf1op
mutation.30 The present analysis of the TgZ mouse
contributes significantly to our understanding of the local regulation
of these cells. Consider, for example, reproduction. CSF-1 maintains ovulation rates and recruits macrophages to the growing
follicle43 and to the uterine stroma during the estrus
cycle.59 The uterine CSF-1 is locally synthesized from
epithelial cells, which synthesize it in response to estrogen and,
during pregnancy, progesterone.21,59 During pregnancy, its
action on the trophoblast is necessary for effective immunologic
responses to pathogens at the uteroplacental unit.63
Expression of
We thank members of the Albert Einstein College of Medicine transgenic, histopathology, and analytical imaging facilities for assistance in different aspects of the work, Dr Sandy C. Marks Jr, for advice on TRAP staining, David Gebhard of the Albert Einstein College of Medicine FACS facility for assistance with the FACS analyses, and James Chaloupka, Alex Cho, Sara Kapp, Vonetta Sylvestre, Reza Zadeh, and Xiao-Hua Zong for technical assistance. We also acknowledge kind gifts of the CSF-1 promoter clone from Dr Michael Cole and monoclonal antibody F4/80 from Dr David Hume.
Submitted August 22, 2000; accepted February 28, 2001.
Supported by National Institutes of Health grants CA32551 (E.R.S.), HD30280 (J.W.P.), and HD35627 (J.W.P.), Albert Einstein College of Medicine Cancer Center grant 5P30-CA13330, and an American Society of Hematology fellowship (G.R.R.).
G.R.R. and X.-M.D. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: E. Richard Stanley, Dept of Developmental and Molecular Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY 10461; e-mail: rstanley{at}aecom.yu.edu.
1. Stanley ER. CSF-1. In: Oppenheim JJ,Feldmann M, eds. Cytokine Database. London United Kingdom: Academic Press; 2000:913-934. 2. Pollard JW, Stanley ER. Pleiotropic roles for CSF-1 in development defined by the mouse mutation osteopetrotic (op). Adv Dev Biochem. 1996;4:153-193[CrossRef].
3.
Guilbert LJ, Stanley ER.
Specific interaction of murine colony-stimulating factor with mononuclear phagocytic cells.
J Cell Biol.
1980;85:153-159
4.
Byrne PV, Guilbert LJ, Stanley ER.
Distribution of cells bearing receptors for a colony-stimulating factor (CSF) in murine tissues.
J Cell Biol.
1981;91:848-853
5.
Yeung Y-G, Jubinsky PT, Sengupta A, Yeung DC-Y, Stanley ER.
Purification of the colony-stimulating factor 1 receptor and demonstration of its tyrosine kinase activity.
Proc Natl Acad Sci U S A.
1987;84:1268-1271 6. Sherr CJ, Rettenmier CW, Sacca R, Roussel MF, Look AT, Stanley ER. The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-1. Cell. 1985;41:665-676[CrossRef][Medline] [Order article via Infotrieve].
7.
Kawasaki ES, Ladner MB, Wang AM, et al.
Molecular cloning of a complementary DNA encoding human macrophage-specific colony-stimulating factor (CSF-1).
Science.
1985;230:291-296 8. Ladner MB, Martin GA, Noble JA, et al. Human CSF-1: gene structure and alternative splicing of mRNA precursors. EMBO J. 1987;6:2693-2698[Medline] [Order article via Infotrieve].
9.
Wong GG, Temple PA, Leary AC, et al.
Human CSF-1: molecular cloning and expression of 4-kb cDNA encoding the human urinary protein.
Science.
1987;235:1504-1508
10.
Ladner MB, Martin GA, Noble JA, et al.
cDNA cloning and expression of murine macrophage colony-stimulating factor from L929 cells.
Proc Natl Acad Sci U S A.
1988;85:6706-6710 11. Cerretti DP, Wignall J, Anderson D, et al. Human macrophage-colony stimulating factor: alternative RNA and protein processing from a single gene. Mol Immunol. 1988;25:761-770[CrossRef][Medline] [Order article via Infotrieve]. 12. Kawasaki ES, Ladner MB. Molecular biology of macrophage colony-stimulating factor. Immunol Ser. 1990;49:155-176[Medline] [Order article via Infotrieve].
13.
Rettenmier CW, Roussel MF.
Differential processing of colony-stimulating factor 1 precursors encoded by two human cDNAs.
Mol Cell Biol.
1988;8:5026-5034
14.
Manos MM.
Expression and processing of a recombinant human macrophage colony-stimulating factor in mouse cells.
Mol Cell Biol.
1988;8:5035-5039
15.
Price LKH, Choi HU, Rosenberg L, Stanley ER.
The predominant form of secreted colony stimulating factor-1 is a proteoglycan.
J Biol Chem.
1992;267:2190-2199
16.
Suzu S, Ohtsuki T, Yanai N, et al.
Identification of a high molecular weight macrophage colony-stimulating factor as a glycosaminoglycan-containing species.
J Biol Chem.
1992;267:4345-4348
17.
Rettenmier CW, Roussel MF, Ashmun RA, Ralph P, Price K, Sherr CJ.
Synthesis of membrane-bound colony-stimulating factor 1 (CSF-1) and downmodulation of CSF-1 receptors in NIH 3T3 cells transformed by cotransfection of the human CSF-1 and c-fms (CSF-1 receptor) genes.
Mol Cell Biol.
1987;7:2378-2387 18. Roth P, Stanley ER. The biology of CSF-1 and its receptor. Curr Top Microbiol Immunol. 1992;181:141-167[Medline] [Order article via Infotrieve]. 19. Elford PR, Felix R, Cecchini M, Trechsel U, Fleisch H. Murine osteoblastlike cells and the osteogenic cell MC3T3-E1 release a macrophage colony-stimulating activity in culture. Calcif Tissue Int. 1987;41:151-156[Medline] [Order article via Infotrieve]. 20. Hofstetter W, Wetterwald A, Cecchini M, Felix R, Mueller C, Fleisch H. Expression of M-CSF and of its receptor c-fms, in bone, as detected by in situ hybridization [abstract]. J Bone Miner Res. 1991;6(suppl 1):S199. 21. Pollard JW, Bartocci A, Arceci R, Orlofsky A, Ladner MB, Stanley ER. Apparent role of the macrophage growth factor, CSF-1, in placental development. Nature. 1987;330:484-486[CrossRef][Medline] [Order article via Infotrieve].
22.
Suzu S, Ohtsuki T, Makishima M, et al.
Biological activity of a proteoglycan form of macrophage colony-stimulating factor and its binding to type V collagen.
J Biol Chem.
1992;267:16812-16815
23.
Wiktor-Jedrzejczak W, Bartocci A, Ferrante AW Jr, et al.
Total absence of colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (op/op) mouse.
Proc Natl Acad Sci U S A.
1990;87:4828-4832 24. Yoshida H, Hayashi S-I, Kunisada T, et al. The murine mutation "osteopetrosis" (op) is a mutation in the coding region of the macrophage colony stimulating factor (Csfm) gene. Nature. 1990;345:442-444[CrossRef][Medline] [Order article via Infotrieve].
25.
Felix R, Cecchini MG, Fleisch H.
Macrophage colony stimulating factor restores in vivo bone resorption in the op/op osteopetrotic mouse.
Endocrinology.
1990;127:2592-2594 26. Pollard JW, Hunt JS, Wiktor-Jedrzejczak W, Stanley ER. A pregnancy defect in the osteopetrotic (op/op) mouse demonstrates the requirement for CSF-1 in female fertility. Dev Biol. 1991;148:273-283[CrossRef][Medline] [Order article via Infotrieve].
27.
Marks SC Jr, Lane PW.
Osteopetrosis, a new recessive skeletal mutation on chromosome 12 of the mouse.
J Hered.
1976;67:11-18
28.
Wiktor-Jedrzejczak W, Ahmed A, Szczylik C, Skelly RR.
Hematological characterization of congenital osteopetrosis in op/op mouse.
J Exp Med.
1982;156:1516-1527 29. Felix R, Cecchini MG, Hofstetter W, Elford PR, Stutzer A, Fleisch H. Impairment of macrophage colony-stimulating factor production and lack of resident bone marrow macrophages in the osteopetrotic op/op mouse. J Bone Miner Res. 1990;5:781-789[Medline] [Order article via Infotrieve]. 30. Cecchini MG, Dominguez MG, Mocci S, et al. Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse. Development. 1994;120:1357-1372[Abstract].
31.
Baumbach WR, Colston EM, Cole MD.
Integration of the BALB/c ecotropic provirus into the colony-stimulating factor-1 growth factor locus in a myc retrovirus-induced murine monocyte tumor.
J Virol.
1988;62:3151-3155
32.
DeNoto FM, Moore DD, Goodman HM.
Human growth hormone DNA sequence and mRNA structure: possible alternative splicing.
Nucleic Acids Res.
1981;9:3719-3730 33. Fire A, Harrison SW, Dixon D. A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene. 1990;93:189-198[CrossRef][Medline] [Order article via Infotrieve].
34.
Stanley ER.
Colony-stimulating factor (CSF) radioimmunoassay: detection of a CSF subclass stimulating macrophage production.
Proc Natl Acad Sci U S A.
1979;76:2969-2973 35. Stanley ER. The macrophage colony-stimulating factor, CSF-1. Methods Enzymol. 1985;116:564-587[Medline] [Order article via Infotrieve].
36.
Bartocci A, Pollard JW, Stanley ER.
Regulation of colony-stimulating factor 1 during pregnancy.
J Exp Med.
1986;164:956-961 37. Austyn JM, Gordon S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol. 1981;11:805-815[Medline] [Order article via Infotrieve]. 38. Hennighausen L, Wall RJ, Tillmann U, Li M, Furth PA. Conditional gene expression in secretory tissues and skin of transgenic mice using the MMTV-LTR and the tetracycline responsive system. J Cell Biochem. 1995;59:463-472[CrossRef][Medline] [Order article via Infotrieve]. 39. O'Gorman M. Phenotypic analysis. In: Robinson J,Darzynkiewicz Z,Dean PN, et al., eds. Current Protocols in Cytometry. New York, NY: John Wiley and Sons; 1997:6.0.1-6.7.10.
40.
Begg SK, Radley JM, Pollard JW, et al.
Delayed hematopoietic development in osteopetrotic (op/op) mice.
J Exp Med.
1993;177:237-242 41. Michaelson MD, Bieri PL, Mehler MF, et al. CSF-1 deficiency in mice results in abnormal brain development. Development. 1996;122:2661-2672[Abstract]. 42. Cohen PE, Nishimura K, Zhu L, Pollard JW. Macrophages: important accessory cells for reproductive function. J Leukoc Biol. 1999;66:765-772[Abstract]. 43. Cohen PE, Zhu L, Pollard JW. Absence of colony stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice disrupts estrous cycles and ovulation. Biol Reprod. 1997;56:110-118[Abstract].
44.
Pollard JW, Hennighausen L.
Colony stimulating factor 1 is required for mammary gland development during pregnancy.
Proc Natl Acad Sci U S A.
1994;91:9312-9316 45. Cohen PE, Chisholm O, Arceci RJ, Stanley ER, Pollard JW. Absence of colony-stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice results in male fertility defects. Biol Reprod. 1996;55:310-317[Abstract]. 46. Pollard JW, Dominguez MG, Mocci S, Cohen PE, Stanley ER. Effect of the colony-stimulating factor-1 null mutation, osteopetrotic (csfmop), on the distribution of macrophages in the male mouse reproductive tract. Biol Reprod. 1997;56:1290-1300[Abstract].
47.
Lieschke GJ, Stanley E, Grail D, et al.
Mice lacking both macrophage- and granulocyte-macrophage colony-stimulating factor have macrophages and coexistent osteopetrosis and severe lung disease.
Blood.
1994;84:27-35
48.
Nilsson SK, Lieschke GJ, Garcia-Wijnen CC, et al.
Granulocyte-macrophage colony-stimulating factor is not responsible for the correction of hematopoietic deficiencies in the maturing op/op mouse.
Blood.
1995;86:66-72 49. Tanaka S, Takahashi N, Udagawa N, et al. Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteoclast progenitors. J Clin Invest. 1993;91:257-263. 50. Hofstetter W, Wetterwald A, Cecchini MG, Mueller C, Felix R. Detection of transcripts and binding sites for colony-stimulating factor-1 during bone development. Bone. 1995;17:145-151[Medline] [Order article via Infotrieve]. 51. Mikkelsen HB, Thuneberg L. Op/op mice defective in production of functional colony-stimulating factor-1 lack macrophages in muscularis externa of the small intestine. Cell Tissue Res. 1999;295:485-493[CrossRef][Medline] [Order article via Infotrieve].
52.
Cohen PE, Hardy MP, Pollard JW.
Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice.
Mol Endocrinol.
1997;11:1636-1650 53. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell. 1986;46:659-667[CrossRef][Medline] [Order article via Infotrieve]. 54. Harrington M, Konicek BW, Xia XL, Song A. Transcriptional regulation of the mouse CSF-1 gene. Mol Reprod Dev. 1997;46:39-44[CrossRef][Medline] [Order article via Infotrieve]. 55. Rubin J, Fan D, Wade A, et al. Transcriptional regulation of the expression of macrophage colony stimulating factor. Mol Cell Endocrinol. 2000;160:193-202[CrossRef][Medline] [Order article via Infotrieve]. 56. Konicek BW, Xia X, Rajavashisth T, Harrington MA. Regulation of mouse colony-stimulating factor-1 gene promoter activity by AP1 and cellular nucleic acid-binding protein. DNA Cell Biol. 1998;17:799-809[Medline] [Order article via Infotrieve]. 57. Yan Z-J, Wang Q-R, McNiece IK, Wolf NS. Dissecting the hematopoietic microenvironment, VII; the production of an autostimulatory factor as well as a CSF by unstimulated murine marrow fibroblasts. Exp Hematol. 1990;18:348-354[Medline] [Order article via Infotrieve]. 58. Gouon-Evans V, Rothenberg ME, Pollard JW. Postnatal mammary gland development requires macrophages and eosinophils. Development. 2000;127:2269-2282[Abstract].
59.
Pollard JW, Lin EY, Zhu L.
Complexity in uterine macrophage responses to cytokines in mice.
Biol Reprod.
1998;58:1469-1475 60. Takahashi K, Umeda S, Shultz LD, Hayashi S, Nishikawa S-I. Effects of macrophage colony-stimulating factor (M-CSF) on the development, differentiation, and maturation of marginal metallophilic macrophages and marginal zone macrophages in the spleen of osteopetrosis (op) mutant mice lacking functional M-CSF activity. J Leukoc Biol. 1994;55:581-588[Abstract].
61.
Hume DA, Perry VH, Gordon S.
Immunohistochemical localization of a macrophage-specific antigen in developing mouse retina: phagocytosis of dying neurons and differentiation of microglial cells to form a regular array in the plexiform layers.
J Cell Biol.
1983;97:253-257
62.
Hofstetter W, Wetterwald A, Cecchini MC, Felix R, Fleisch H, Mueller C.
Detection of transcripts for the receptor for macrophage colony-stimulating factor, c-fms, in murine osteoclasts.
Proc Natl Acad Sci U S A.
1992;89:9637-9641 63. Guleria I, Pollard JW. The trophoblast is a component of the innate immune system during pregnancy. Nat Med. 2000;6:589-593[CrossRef][Medline] [Order article via Infotrieve].
64.
Arceci RJ, Shanahan F, Stanley ER, Pollard JW.
Temporal expression and location of colony-stimulating factor 1 (CSF-1) and its receptor in the female reproductive tract are consistent with CSF-1-regulated placental development.
Proc Natl Acad Sci U S A.
1989;86:8818-8822
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  G.-Q. Yao, J.-J. Wu, S. Ovadia, N. Troiano, B. H. Sun, and K. Insogna Targeted overexpression of the two colony-stimulating factor-1 isoforms in osteoblasts differentially affects bone loss in ovariectomized mice Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E714 - E720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Menke, M.-Y. Hsu, K. T. Byrne, J. A. Lucas, W. A. Rabacal, B. P. Croker, X.-H. Zong, E. R. Stanley, and V. R. Kelley Sunlight Triggers Cutaneous Lupus through a CSF-1-Dependent Mechanism in MRL-Faslpr Mice J. Immunol., November 15, 2008; 181(10): 7367 - 7379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Tamimi, J. S. Brugge, M. L. Freedman, A. Miron, J. D. Iglehart, G. A. Colditz, and S. E. Hankinson Circulating Colony Stimulating Factor-1 and Breast Cancer Risk Cancer Res., January 1, 2008; 68(1): 18 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Horiuchi, T. Miyamoto, H. Takaishi, A. Hakozaki, N. Kosaki, Y. Miyauchi, M. Furukawa, J. Takito, H. Kaneko, K. Matsuzaki, et al. Cell Surface Colony-Stimulating Factor 1 Can Be Cleaved by TNF-{alpha} Converting Enzyme or Endocytosed in a Clathrin-Dependent Manner J. Immunol., November 15, 2007; 179(10): 6715 - 6724. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wei, X.-M. Dai, and E. R. Stanley Transgenic expression of CSF-1 in CSF-1 receptor-expressing cells leads to macrophage activation, osteoporosis, and early death J. Leukoc. Biol., December 1, 2006; 80(6): 1445 - 1453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-H. Jang, D. M. Herber, X. Jiang, S. Nandi, X.-M. Dai, G. Zeller, E. R. Stanley, and V. R. Kelley Distinct In Vivo Roles of Colony-Stimulating Factor-1 Isoforms in Renal Inflammation J. Immunol., September 15, 2006; 177(6): 4055 - 4063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Paulus, E. R. Stanley, R. Schafer, D. Abraham, and S. Aharinejad Colony-stimulating factor-1 antibody reverses chemoresistance in human mcf-7 breast cancer xenografts. Cancer Res., April 15, 2006; 66(8): 4349 - 4356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ovadia, K. Insogna, and G.-Q. Yao The Cell-Surface Isoform of Colony Stimulating Factor 1 (CSF1) Restores but Does Not Completely Normalize Fecundity in CSF1-Deficient Mice Biol Reprod, February 1, 2006; 74(2): 331 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Nandi, M. P. Akhter, M. F. Seifert, X.-M. Dai, and E. R. Stanley Developmental and functional significance of the CSF-1 proteoglycan chondroitin sulfate chain Blood, January 15, 2006; 107(2): 786 - 795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Lenda, E. R. Stanley, and V. R. Kelley Negative Role of Colony-Stimulating Factor-1 in Macrophage, T Cell, and B Cell Mediated Autoimmune Disease in MRL-Faslpr Mice J. Immunol., October 1, 2004; 173(7): 4744 - 4754. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification Endocr. Rev., August 1, 2004; 25(4): 629 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Aharinejad, P. Paulus, M. Sioud, M. Hofmann, K. Zins, R. Schafer, E. R. Stanley, and D. Abraham Colony-Stimulating Factor-1 Blockade by Antisense Oligonucleotides and Small Interfering RNAs Suppresses Growth of Human Mammary Tumor Xenografts in Mice Cancer Res., August 1, 2004; 64(15): 5378 - 5384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-M. Dai, X.-H. Zong, V. Sylvestre, and E. R. Stanley Incomplete restoration of colony-stimulating factor 1 (CSF-1) function in CSF-1-deficient Csf1op/Csf1op mice by transgenic expression of cell surface CSF-1 Blood, February 1, 2004; 103(3): 1114 - 1123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Sapi The Role of CSF-1 in Normal Physiology of Mammary Gland and Breast Cancer: An Update Experimental Biology and Medicine, January 1, 2004; 229(1): 1 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.-Q. Yao, J.-J. Wu, B.-H. Sun, N. Troiano, M. A. Mitnick, and K. Insogna The Cell Surface Form of Colony-Stimulating Factor-1 Is Biologically Active in Bone in Vivo Endocrinology, August 1, 2003; 144(8): 3677 - 3682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Abboud, M. Bunegin, N. Ghosh-Choudhury, and K. Woodruff Analysis of the Mouse CSF-1 Gene Promoter in a Transgenic Mouse Model J. Histochem. Cytochem., July 1, 2003; 51(7): 941 - 949. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ide, D. B. Seligson, S. Memarzadeh, L. Xin, S. Horvath, P. Dubey, M. B. Flick, B. M. Kacinski, A. Palotie, and O. N. Witte Expression of colony-stimulating factor 1 receptor during prostate development and prostate cancer progression PNAS, October 29, 2002; 99(22): 14404 - 14409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Hume, I. L. Ross, S. R. Himes, R. T. Sasmono, C. A. Wells, and T. Ravasi The mononuclear phagocyte system revisited J. Leukoc. Biol., October 1, 2002; 72(4): 621 - 627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Aharinejad, D. Abraham, P. Paulus, H. Abri, M. Hofmann, K. Grossschmidt, R. Schafer, E. R. Stanley, and R. Hofbauer Colony-stimulating Factor-1 Antisense Treatment Suppresses Growth of Human Tumor Xenografts in Mice Cancer Res., September 15, 2002; 62(18): 5317 - 5324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Cohen, L. Zhu, K. Nishimura, and J. W. Pollard Colony-Stimulating Factor 1 Regulation of Neuroendocrine Pathways that Control Gonadal Function in Mice Endocrinology, April 1, 2002; 143(4): 1413 - 1422. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
-phage insert
containing 6.4 kilobases (kb) of the mouse CSF-1 promoter (3.13 kb),
, +/+; 
,
Csf1op/Csf1op; TgC/+;
, Csf1op/Csf1op) were weighed at
approximately weekly intervals. Means ± SEM.
, Il-1