| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Center for Molecular and Vascular Biology,
Center for Human Genetics, Department of Pathology and Department of
Pediatrics, University of Leuven, Belgium; and Division of Hematology,
A.Z. St-Jan, Brugge, Belgium.
A new mutation is described in the X-linked gene
GATA1, resulting in macrothrombocytopenia and mild
dyserythropoietic features but no marked anemia in a 4-generation
family. The molecular basis for the observed phenotype is a
substitution of glycine for aspartate in the strictly conserved codon
218 (D218G) of the amino-terminal zinc finger loop of the transcription
factor GATA1. Zinc finger interaction studies demonstrated that this
mutation results in a weak loss of affinity of GATA1 for its essential
cofactor FOG1, whereas direct D218G-GATA1 binding to DNA was normal.
The phenotypic effects of this mutation in the patients' platelets
have been studied. Semiquantitative RNA analysis, normalized for
X-linked thrombocytopenia is a well-known clinical
condition, found most often in the context of the Wiskott-Aldrich
syndrome (WAS) and consisting of thrombocytopenia, defective humoral
and cellular immunity, and eczema. Mutations in the WASP
gene lead either to the full-blown WAS picture or to isolated X-linked
thrombocytopenia.1 The platelets in this syndrome are
typically small sized. However, hereditary macrothrombocytopenia with
or without associated thrombopathy has been identified in a variety of
syndromes, such as the May-Hegglin anomaly, Bernard-Soulier syndrome,
Fechtner syndrome, or Epstein syndrome.2 Very recently,
the May-Hegglin anomaly and Fechtner syndrome have been linked to
mutations in the nonmuscle myosin heavy chain 9 gene on chromosome
22.3,4 Patients with X-linked macrothrombocytopenia are
not well recognized.
GATA1 is the founding member of the GATA-binding family of
transcription factors and has been shown to be an essential protein for
normal erythropoiesis and megakaryocyte
differentiation.5,6 The human gene encoding GATA1 has been
mapped to Xp11.23.7 Shivdasani et al8
developed a lineage-selective knockout mouse of GATA1, leading to
megakaryocyte-specific loss of GATA1 expression and established the
critical role of this transcription factor for megakaryocyte growth and
platelet development. Vyas et al9 further characterized
the macrothrombocytopenia in these mice with abnormal platelet number
and platelet ultrastructure and moderate defects in platelet activation.
Very recently Nichols et al10 described for the first time
a mutation in the GATA1 gene in a family with X-linked
dyserythropoietic anemia and macrothrombocytopenia. This missense
mutation (V205M) leads to a reduced interaction of the N-terminal
zinc finger of GATA1 with its essential cofactor FOG1 (for Friend of GATA1).
Here we describe a family with another mutation in the same zinc finger
of GATA1, showing pronounced X-linked macrothrombocytopenia and some
features of dyserythropoiesis but with no marked anemia. We describe
the hematologic features of the affected members and of the female
carriers. Moreover, the influence of the GATA1 mutation on
FOG1 and DNA binding, on platelet function, and on the expression of
platelet-specific glycoproteins is studied.
Electron microscopy of platelets
RNA isolation and complementary DNA synthesis
Genetic analysis of GATA1 GATA1 cDNA was amplified using primers GATA1-F1 (ATCCCCAGAGGCTCCATGGAG) and GATA1-R1 (TCTGTGCCCTCATGAGCTGAGCG). Primer GATA1-R2 (GTTTACTGACAATCAGGCGCTTC) was used for sequencing by the BigDye terminator chemistry (Perkin-Elmer Cetus, Norwalk, CT) on an ABI310 (PerkinElmer) sequencer of polymerase chain reaction (PCR)-generated cDNA fragments from patients and controls. A genomic sequence from chromosome Xq11.23 (accession No. AF196971) included the GATA1 gene. The region including exon 4 of the human GATA1 gene was amplified and sequenced with the primers GATA1-ex4U (GCCAGGGAGTGTGTGAACTG) and GATA1-ex4R (GTCTTACCAGGCGCTTCTTG). Genomic DNA from 72 normal females was screened for the presence of the 653 A G (D218G) mutation by single-stranded
conformation polymorphism analysis.
Statistical analysis Lod scores were calculated using the MLINK program of the Fastlink package (version 4.1P) for an X-linked recessive disorder and with conservative assumptions: allele-frequency of 1/10 000 for the disease mutation.11Glutathione-S-transferase fusion protein/FOG1 binding assay GATA1 Nf, GATA1 Nf D218G, and GATA1 Nf V205M (residues 197-251) fragments were generated by PCR, confirmed by DNA sequencing, and cloned in the expression vector pGEX-4T-2 (Amersham Pharmacia Biotech, Uppsala, Sweden). Different FOG1 fragments [consisting of finger 1 (241-291), fingers 5 to 7 (587-867), finger 9 (948-997), and fingers 5 to 9 (587-997)] were cloned in pcDNA3.1/His (Invitrogen, San Diego, CA), and S35-labeled FOG1 was produced by in vitro transcription/translation using the TNT system (Promega, Madison, WI). Primer sequences are available on request. In vitro binding studies were done as described previously.12,13Glutathione-S-transferase fusion protein/DNA binding assay A 29-base pair (bp) double-stranded DNA oligonucleotide containing the mouse -globin GATA site
(GATCTCCGGCAACTGATAAGGATTCCCTG) was 5' end biotinylated.13
Glutathione-S-transferase (GST) fusion proteins (1 µg)
were incubated in binding buffer (150 mM NaCl, 25 mM Tris, pH 7.5, 0.1% Igepal, 10 µM ZnSO4, 0.25% bovine serum albumin
[BSA], 1 mM -mercaptoethanol, 1.5 mM phenylmethylsulfonyl fluoride
[PMSF]) containing 100 nM biotinylated DNA in the absence or presence
of competing nonbiotinylated oligonucleotide (0-3.2 µM) for 1 hour at
room temperature. After washing the GST fusion proteins coupled
Sepharose beads 3 times in 1 mL binding buffer, the bound biotinylated
oligonucleotide was detected by complex formation with streptavidin-
and biotin-substituted horseradish peroxidase (ABC detection kit; DAKO,
Glostrup, Denmark).14
Semiquantitative RT-PCR The cDNA content was normalized by using primers for -actin.
The following primer sets were used to generate specific fragments: -actin beta5F (ACCAACTGGGACGACATGGAG) and beta3R
(CGTGAGGATCTTCATGAGGTAGTC), GPIb beta1F
(TGCAAGCTTCTCGCCATGGGCTCCGGGCCG) and beta1R
(GGCTGCTCAGGACTCCTCTCCTTAAGACG), GPIX IX1F
(GAGGGATCCTGTCCCATGCCTGCCTGGGG) and IX1R
(CTCCGGGACCTAACTCGGTCCCCATGGCTT), and Gs GNASF
(GGCTGCCTCGGGAACAGTAAG) and GNASR (TAATCATGCCCTATGGTGGGTG). For GPIb
and GPIX, a nested PCR reaction was performed with the following
external primer sets: for GPIb beta2F (ACGCCTCCCGCTGCAGAGTAAG) and
beta2R (GTTTGCAGGCCCGTGTTGCCC), and for GPIX IX2F
(GGAGAAGGCTGAGACCCGAG) and IX2R (GGACCTGCCTCAGGGACTGG). All reactions
were performed in duplicate on RNA samples without added RT during cDNA
synthesis, generating no reaction products (data not shown).
Platelet immunoblot analysis Platelets isolated from citrated blood were directly lysed in ice-cold phosphate-buffered saline (PBS) containing 1% Igepal CA-630 (Sigma Chemical, St Louis, MO), 2 mM Na3VO4, 1 mM EDTA, 1 mM PMSF, 2 mmol/L dithioerythritol (DTE), 1% aprotinin, and 2 mM NaF. The samples were then briefly sonicated (2 times for 10 seconds) and incubated on ice for 60 minutes. Lysates were cleared of insoluble debris by centrifugation at 14 000g for 20 minutes at 4°C. Platelet protein fractions were mixed with Laemmli sample buffer (5% sodium dodecyl sulfate [SDS] reducing buffer), resolved by SDS-polyacrylamide gel electrophoresis (PAGE) on 7% (for GPIb ), 12.5% (for GPIb ), or 10% (for Gs ) acrylamide
gels, and transferred to Hybond ECL-nitro-cellulose membrane (Amersham Pharmacia Biotech). The blots were blocked for 1 hour at room temperature in Tris-buffered saline with Tween (TBS-T; 0.1% Tween-20) supplemented with 5% nonfat dry milk. Incubation with primary (overnight at 4°C) and secondary antibody (2 to 3 hours at room temperature) was performed in TBS-T with 5% nonfat milk. The primary antibodies used were produced in our laboratory and used at 50 µg/mL.
Blots were revealed with a monoclonal anti-Gs antibody ( 3), a
monoclonal anti-GPIb antibody (G27C9), or a polyclonal anti-GPIb
antibody. The secondary antibody was conjugated with horseradish
peroxidase, and staining was performed with the Western blotting
enhanced chemiluminescence detection reagent (Amersham Pharmacia Biotech).
Flow cytometric analysis of platelet GPIb/GPIIIa in PRP PRP from citrated blood was prepared as described above, and 10 µL was diluted with 40 µL PBS in the presence of a GPIIb/IIIa antagonist (G4120; 1 µg/mL; Genentech, San Francisco, CA) to prevent platelet aggregate formation and a monoclonal antibody (30 µg/mL, except for Ib9D5, 50 µg/mL). The GPIb -directed monoclonal antibody G27C9, an anti-GPIIIa monoclonal antibody 16N7C2, an anti-GPIb monoclonal antibody Ib9D5, and a platelet nonspecific anti-GST monoclonal antibody were made in our laboratory.15 After
incubation for 15 minutes at room temperature, samples were centrifuged
for 10 minutes at 2000g, and platelets were resuspended in
50 µL PBS/G4120 with a secondary fluorescein isothiocyanate
(FITC)-conjugated goat antimouse antibody. After incubation for 15 minutes at room temperature, 500 µL PBS was added, and samples were
analyzed in a flow cytometer (FACS Calibur; Becton Dickinson, San
Jose, CA).
Flow cytometric analysis of platelet GPIb/GPIIIa in whole blood Citrated blood (15 µL) was incubated with 40 µL PBS/G4120 and specific primary antibodies as described above. After incubation with a secondary FITC-conjugated goat antimouse immunoglobulin antibody, samples were centrifuged and resuspended in 30 µL PBS/G4120 with simultaneous addition of perCP-conjugated monoclonal anti-GPIIIa antibody (CD61) to recognize the platelet population. Samples were incubated for 15 minutes, and 500 µL PBS was added before analysis by FACS.Platelet aggregation Blood was obtained from drug-free healthy donors and from patients V:3, V:7, and V:8 and anticoagulated with 3.8% (wt/vol) trisodium citrate (9:1) or acid citrate dextrose (ACD), pH 6.5 (9:1). PRP/ACD, obtained as described above by centrifugation (15 minutes at 150g), was recentrifuged in an equal volume ACD (1000g for 15 minutes) to concentrate the platelets, and the pellet was resuspended in autologous platelet-poor plasma (PPP-trisodium citrate). The platelet count was adjusted to 130 000 platelets/µL PPP. In vitro platelet aggregation was performed on a Chrono-Log Aggregometer (Chronolog, Havertown, PA) by simultaneously recording 2 tracings. Aggregation studies involved addition of collagen (2 µg/mL) or ristocetin (1.3 mg/mL) with or without 1 minute preincubation with a neutralizing monoclonal anti-GPIb antibody
(G19H10, 15 µg/mL).16
Patient description and hematologic analysis The propositus (patient V:3; Figure 1) is a 41-year-old man with congenital thrombocytopenia. A bone marrow examination performed at the age of 2 years revealed increased megakaryocytosis, which led at that time to the diagnosis of chronic idiopathic thrombocytopenia. He received treatment with steroids, resulting in a small and transient rise in platelet number. Throughout life he experienced mucocutaneous bleeding, spontaneously or after minor trauma. He underwent surgery for evacuation of a muscular hematoma and was once hospitalized for hematuria.
The family history (Figure 1A) was compatible with X-linked thrombocytopenia with patients V:7, V:8, V:13, V:14, V:15, V:16, V:17, V:20, V:23, and VI:6 known with chronic macrothrombocytopenia in various hematologic departments. The clinical features of V:7 and V:8 have been described previously in abstract form.17 More detailed hematologic data of some affected family
members, obligate carriers, and a healthy family member are
listed in Table 1.
Thrombocytopenia is not accompanied by anemia, and white blood cell
counts and differential counts were completely normal. The erythrocyte
sedimentation rate, when measured, was uniformly low.
Peripheral blood smears of affected patients invariably demonstrated giant platelets and dysmorphic red blood cells (anisocytes, poikilocytes, megalocytes, and acanthocytes are shown in Figure 1B). Platelet survival, measured in 2 patients using homologous indium111-labeled platelets, showed a normal life span. Light microscopy of the bone marrow of patients V:7 and V:8 revealed normoblasts with punctate basophilia, karyorhexis, budding, and pycnosis. The megakaryocytes appeared dysplastic, with megakaryoblasts, micromegakaryocytes, vacuolization of cytoplasma, and asynchronous maturation of nucleus and cytoplasma. The bone marrow examinations of V:3, V:14, and V:15 only evidenced increased megakaryocytosis. Electron microscopy of the platelets of affected patients V:3, V:7, V:8, V:15, V:16, and V:17 revealed increased platelet size; furthermore, platelets were rounder than the characteristic discoid shape of normal platelets (Figure 1C). In addition, in a high number of these platelets, clusters composed of smooth endoplasmic reticulum and abnormal membrane complexes were seen in the center and in the periphery of their cytoplasm. A paucity of alpha granules was obvious. The platelets of the female carrier IV:4 (data not shown) did not show abnormalities and were comparable to the controls. Single amino acid substitution in the N-terminal zinc finger of GATA1 We first studied, in the 2 branches of this family, the segregation of polymorphic markers located around GATA1 and observed identical haplotypes in family members V:7 and V:17 (data not shown). We next sequenced the GATA1 cDNA and found a hemizygous base pair substitution (A to G) at nucleotide position 653 in 2 affected brothers (V:7 and V:8). The mother (IV:4), who is an obligate carrier, is heterozygous for the missense mutation, and the healthy brother has a normal sequence (Figure 2A). The mutation was confirmed on genomic DNA and screened in all available family members. The affected family members V:3, V:14, V:17, and V:20 and the obligate carriers IV:1, IV:21, and V:21 were also respectively hemizygous and heterozygous for the GATA1 mutation. The unaffected male V:6 did not carry the mutation, neither did we detect the 653 A G substitution in peripheral blood leukocyte DNA from 72 normal females (data not shown).
These data enable us to calculate a maximal 2-point lod score of 2.804 at no recombination, thereby proving cosegregation of the D218G mutation with X-linked thrombocytopenia in this family. The 653 A GATA1-FOG1 and GATA1-DNA binding studies GATA1-FOG1 interaction experiments were performed to study the effect of the D218G mutation in GATA1 on the binding to its cofactor FOG1. We studied the binding between the N-terminal zinc finger of GATA1 and different FOG1 fingers known to be important in GATA1 recognition.19 The recently reported GATA1 mutant V205M was also produced and tested as a control in our assay.10 The wild-type GATA1 N finger/GST (197-251) was able to sequester almost all input in vitro translated FOG1 in contrast to the mutant N fingers (Figure 3A). The D218G mutant has a weaker affinity for all FOG1 fingers compared to the wild-type GATA1 but clearly interacts more strongly than the V205M mutant. Control GST-bound beads were unable to bind any FOG1.
Similar binding studies using GST fusion proteins of either wild-type or mutant GATA1 N fingers were performed to assess the effect of the D218G mutation on direct GATA1 DNA binding. The classical electrophoretic mobility shift assay (data not shown) as well as an equilibrium DNA competition method revealed no significant impairment of DNA binding in any of the mutants tested (Figure 3B). Study of platelet gene expression The promoters of many megakaryocyte-expressed genes have a GATA1 recognition site, as is the case for GPIb , GPIb , GPIIb, GPIX,
PF4, c-MPL, and p45 NF-E2.20-25 We studied the
GPIb and GPIX gene expression in the total
platelet population of patients V:3, V:7, and V:8 and in the carrier
IV:1 and compared it with that of control platelets (Figure
4). GATA1-defective platelets indeed
showed a strongly decreased GPIb and GPIX messenger RNA (mRNA)
expression. Only when performing nested PCR reactions, were signals
obtained for GPIb and GPIX. In contrast, the -actin normalized
expression of GPIIIa was close to normal (data not shown). No
abnormalities in expression levels of these glycoprotein mRNAs were
seen in the obligate carrier. To study whether this low level of
glycoprotein RNA expression is only due to the lack of direct
GATA1-FOG1 transcriptional regulation of the genes themselves or also
due to a decreased maturation state of the platelets, we also studied
the expression of the Gs gene. This widely expressed gene
(GNAS1) is, as far as we know, not a direct transcriptional target of GATA1 but its expression is up-regulated during terminal megakaryocytic maturation. We found a significantly decreased Gs
mRNA expression in the patients' platelets (Figure 4).
Platelet membrane glycoprotein studies in PRP Flow cytometric analysis of platelets in PRP showed that the platelet size in patient V:3 is 2 to 3 times larger than in controls (Figure 5 A). The platelet size of the obligate carriers IV:1 and VI:5 was normal. A series of immunofluorescent labelings were done to compare the expression of GPIb , GPIb , GPIX, GPV, and GPIIIa. Correction for background
fluorescence was made using an irrelevant antibody against GST. Most
platelets of patient V:3 expressed all glycoproteins although disturbed
(see below), but a distinct fraction of the platelets is almost
negative for every marker tested, indicating the existence in the
circulation of very immature platelets with the same size distribution
as the mature platelets (shown for GPIb in Figure 5A). The membrane distribution of GPIIIa was analyzed versus that of GPIb as a function of the platelet size, and a parallel increase of GPIIIa and GPIb expression with platelet size was found (data not shown). A murine monoclonal antibody against GPIIIa recognized a similar epitope density
on platelets of the propositus V:3 as on those from controls, whereas
the GPIb and GPIb expressions were abnormal. GPIb subunit expression was only half of normal and seemed to be slightly reduced in
obligate carriers (Figure 5B). Surprisingly, the amount of GPIb
seemed higher in the propositus than in controls. We also studied the
GPIX and GPV expressions but found no significant differences with
control platelets. Western blot analysis of the GPIIIa expression
confirmed normal GPIIb/IIIa protein, justifying the use of GPIIIa as a
parameter to normalize the expression of GPIb and GPIb during
FACS analysis (Figure 5C). Furthermore, platelet protein fractions of
patient V:3 have more GPIb and less GPIb than control platelets,
corroborating the findings presented in Figure 5B. Similar to the gene
expression studies, abnormal platelet maturation was analyzed
indirectly by studying Gs expression in the platelets. During normal
maturation of megakaryoblastic cells, the large splice variant of Gs
protein (52 kd) is up-regulated.26 However, when we
analyzed Gs expression in patient platelets using a monoclonal
antibody ( 3) that recognizes specifically this Gs subtype, we
found a weaker signal in patient V:3 and in carrier IV:1 (Figure 5C),
again suggestive of incomplete platelet maturation.
Platelet membrane glycoprotein studies in whole blood To ensure that all platelets were included in our analysis, flow cytometry was also performed in total blood. To differentiate platelets from other blood cells and to include giant platelets, a double-labeling technique was applied, based on our finding that the GPIIIa levels were not disturbed in patient platelets. Again clear abnormalities were observed in the distribution of platelet size of patient V:3 (Figure 6A). The platelet population (circled in red) showed giant platelets 4 to 5 times larger than normal platelets. The largest platelets were not seen in PRP (Figure 5A), most probably because they were lost during centrifugation. The very immature platelets observed in PRP were hardly detected in this window because the amount of platelets in whole blood analyzed is only 10% of the platelets examined in PRP. The bar graphs, normalized to the control GST antibody, showing GPIb and GPIb
expressions by platelets within the red ellipse, again revealed a
pronounced decrease of GPIb but not of GPIb expression in patient
V:3 compared with control or carrier platelets (Figure 6B). For GPIX
and GPV, no significant differences were observed (data not shown).
Flow cytometry experiments in whole blood also revealed a second weaker
GPIIIa-positive platelet population (indicated by blue circles),
located on top of the negative red blood cell population (Figure 6A).
The glycoprotein expression levels in these 1:1 platelet erythrocyte
conjugates revealed a still more pronounced drop of GPIb expression
compared with normal conjugates (Figure 6B). This is not the case for
the control or carrier platelets. Again for GPIX and GPV no significant
differences were found.
Platelet functional studies We have investigated to what degree the reduced GPIb levels on
patient platelets affect von Willebrand factor-dependent platelet aggregation (Figure 7). The response to
collagen is weak (34%) in PRP of patient V:3 compared with the control
(75%) probably because of the presence of some erythrocytes in the
PRP. However, the agglutination of platelets in response to ristocetin
seems to be more strongly reduced (17%) in comparison to the control (92%). Preincubation with the monoclonal antibody G19H10 resulted in
complete inhibition of the ristocetin-induced platelet agglutination. This finding indicates that the patient's platelets have a
functionally active GPIb-IX-V receptor complex, although in decreased
number. The aggregations shown are representative for 3 patients:
aggregations in patients V:7 and V:8 were very similar.
The role of the GATA1-FOG1 transcription complex in erythroid and megakaryocyte differentiation has already been illustrated in 3 mouse models. Homozygous disruption of either GATA1 or FOG1 causes embryonic lethality because of a severe erythroid defect.6,27 In contrast, mice with a mutation in the upstream region of GATA1 (GATA1 knockdown mice) show a milder erythroid defect but suffer from severe thrombocytopenia because of absent GATA1 expression in the megakaryocytic lineage.8,28 Very recently, the first GATA1 genetic defect (V205M) was found in patients with dyserythropoietic anemia and thrombocytopenia.10 This single amino acid substitution in GATA1, located in the N-terminal zinc finger, inhibits the interaction with its essential transcription cofactor FOG1. A similar observation in vitro had been made by mutagenesis of the key residues in the N-terminal zinc finger and thus implicated these residues in finger-specific FOG interactions.13 We describe here another mutation (D218G) located in the N-terminal zinc finger loop of GATA1. Mutagenesis of this residue and the neighboring residue (DR218/219NA) was studied by Fox et al13 and revealed FOG1 binding, although reduced. DNA binding was normal as also predicted by the 3-dimensional model of the N-terminal GATA1 zinc finger.29 The biochemical significance of our mutation for the GATA1-FOG1 interaction was studied by an in vitro assay and was compared with the V205M mutant of GATA1. The D218G mutant has a weaker affinity for FOG1, but it clearly interacts more strongly than the previously reported V205M GATA1 mutant. This observation is in agreement with the clinical differences between our kindred and the previously reported patients. The patients described in that study were anemic and severely thrombocytopenic with clear abnormalities not only in the megakaryocytic (low number and dysplastic platelets) but also in the erythrocyte (abnormal in size and shape) lineages.10 The patients of our family have an abnormal size and number of dysmorphic platelets but have a normal amount and size with shape abnormalities of the erythrocytes (also confirmed by flow cytometric analysis, data not shown). Furthermore, in the 2 patients described by Nichols et al,10 cryptorchidism was observed, possibly linked to a GATA1 deficiency in the Sertoli cells. In our family no testicular abnormalities are observed, and, as can be concluded from the offspring of patients III:5 and III:8, fertility seems not to be compromised. We extensively studied the consequences of the GATA1 mutation on mRNA and protein expression levels of GATA1-dependent and -independent genes in patient platelets. Similarly to the findings in the megakaryocytes of GATA1 knockdown mice,8 the presently reported GATA1 mutation leads to a decreased GATA1-regulated gene expression and maturation of the patients' platelets. The expression differences cannot be attributed only to an aberrant GATA1/FOG1 transcriptional regulation, since the expression of a nondirect GATA1 target gene such as GNAS1 also is low. The low expression of this gene could be due to a GATA1-dependent secondary effect, resulting from poor megakaryocyte differentiation. GPIIIa expression is close to normal, compatible with the knowledge that this gene has no known GATA1 binding site and is already expressed during early megakaryocyte differentiation. The in vivo expression of RNA in patient platelets thus corroborates
the differences in mRNA profiles (studied for GPIb We also studied the glycoprotein expression levels in platelets by flow
cytometry and Western blot analysis. Flow cytometric analysis of the
patients' platelets in plasma or whole blood both showed a decreased
GPIb In contrast to the GATA1-defective patients described by Nichols et
al,10 we were still able to functionally test patients' platelets. The ristocetin-induced agglutination is weak but is fully
GPIb dependent. The low but not absent ristocetin-induced agglutination
compared with the collagen-induced aggregation probably results from
the disturbed assembly of GPIb subunits. The weak agglutination is in
contrast to what is found in patients with Bernard-Soulier
syndrome30 in which ristocetin agglutination is completely
absent and also in the specific patient described by Ludlow et
al,31 in whom the Bernard-Soulier syndrome is the result
of a 22q11 microdeletion, with the gene for GPIb In conclusion, we describe the first family with isolated X-linked macrothrombocytopenia without anemia (but with some dyserythropoietic features), because of a new mutation in GATA1 leading to a weaker interaction with FOG1. These patients release immature platelets in the circulation with a hyperplastic endoplasmic reticulum and a disturbed GPIb-V-IX complex with weakened function. This work suggests that patients with hereditary macrothrombocytopenia or with so-called familial chronic idiopathic thrombocytopenic purpura should be screened for mutations in GATA1 and FOG1.
C. V. G. and K. D. are both holders of a fundamental clinical research mandate of the FWO Vlaanderen.
Submitted June 26, 2000; accepted March 2, 2001.
Supported by the FWO Vlaanderen (project G.0306.98).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Chris Van Geet, Center for Molecular and Vascular Biology, UZ-Gasthuisberg, Herestraat 49, 3000 Leuven, Belgium; e-mail: christel.vangeet{at}uz.kuleuven.ac.be.
1. Brooimans RA, van den Berg AJ, Tamminga RY, Revesz T, Wulffraat NM, Zegers BJ. Identification of six novel WASP gene mutations in patients suffering from Wiskott-Aldrich syndrome. Hum Mutat. 2000;15:386-387[Medline] [Order article via Infotrieve].
2.
Mhawech P, Saleem A.
Inherited giant platelet disorders: classification and literature review.
Am J Clin Pathol.
2000;113:176-190 3. Mutations in MYH9 result in the May-Hegglin anomaly, and Fechtner and Sebastian syndromes. The May-Hegglin/Fechtner Syndrome Consortium. Nat Genet. 2000;26:103-105[CrossRef][Medline] [Order article via Infotrieve]. 4. Kelley MJ, Jawien W, Ortel TL, Korczak JF. Mutation of MUH9, encoding non-muscle myosin heavy chain A, in May-Hegglin anomaly. Nat Genet. 2000;26:106-108[CrossRef][Medline] [Order article via Infotrieve]. 5. Tsai SF, Martin DI, Zon LI, D'Andrea AD, Wong GG, Orkin SH. Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature. 1989;339:446-451[CrossRef][Medline] [Order article via Infotrieve]. 6. Pevny L, Simon MC, Robertson E, et al. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature. 1991;349:257-260[CrossRef][Medline] [Order article via Infotrieve].
7.
Zon LI, Tsai SF, Burgess S, Matsudaira P, Bruns GAP, Orkin SH.
The major human erythroid DNA-binding protein (GF-1): primary sequence and localization of the gene to the X chromosome.
Proc Natl Acad Sci U S A.
1990;87:668-672 8. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH. A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development. EMBO J. 1997;16:3965-3973[CrossRef][Medline] [Order article via Infotrieve].
9.
Vyas P, Ault K, Jackson CW, Orkin SH, Shivdasani RA.
Consequences of GATA-1 deficiency in megakaryocytes and platelets.
Blood.
1999;93:2867-2875 10. Nichols KE, Crispino JD, Poncz M, et al. Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA1. Nat Genet. 2000;24:266-270[CrossRef][Medline] [Order article via Infotrieve]. 11. Cottingham RW, Idury RM, Schaffer AA. Faster sequential genetic linkage computations. Am J Hum Genet. 1993;53:252-263[Medline] [Order article via Infotrieve]. 12. Tsang AP, Visvader JE, Turner CA, et al. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell. 1997;90:109-119[CrossRef][Medline] [Order article via Infotrieve]. 13. Fox AH, Kowalski K, King GF, Mackay JP, Crossley M. Key residues characteristic of GATA N-fingers are recognized by FOG. J Biol Chem. 1998;173:33595-33603. 14. Benotmane AM, Hoylaerts MF, Collen D, Belayew A. Nonisotopic quantitative analysis of protein-DNA interactions at equilibrium. Anal Biochem. 1997;250:181-185[CrossRef][Medline] [Order article via Infotrieve]. 15. Deckmyn H, Stanssens P, Hoet B, et al. An echistatin-like Arg-Gly-Asp (RGD)-containing sequence in the heavy chain CDR3 of a murine monoclonal antibody that inhibits human platelet glycoprotein IIb/IIIa function. Br J Haematol. 1994;87:562-571[Medline] [Order article via Infotrieve].
16.
Theilmeier G, Lenaerts T, Remacle C, Collen D, Vermylen J, Hoylaerts MF.
Circulating activated platelets assist THP-1 monocytoid/endothelial cell interaction under shear stress.
Blood.
1999;94:2725-2734 17. Van Hoof A, Missault L, Heynen MJ, Criel A. Familial macrothrombocytopenia with abnormal ultrastructure of megakaryocytes and with associated dysplastic abnormalities in erythroid and myeloid cells [abstract]. Thromb Haemost. 1989;62:503. 18. Crispino JD, Lodish MB, MacKay JP, Orkin SH. Use of altered specificity mutants to probe a specific protein-protein interaction in differentiation: the GATA-1:FOG complex. Mol Cell. 1999;3:219-228[CrossRef][Medline] [Order article via Infotrieve]. 19. Fox AH, Liew C, Holmes M, Kowalski K, Mackay J, Crossley M. Transcriptional cofactors of the FOG family interact with GATA proteins by means of multiple zinc fingers. EMBO J. 1999;18:2812-2822[CrossRef][Medline] [Order article via Infotrieve].
20.
Block KL, Ravid K, Phung QH, Poncz M.
Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system.
Blood.
1994;84:3385-3393
21.
Hashimoto Y, Ware J.
Identification of essential GATA and Ets binding motifs within the promoter of the platelet glycoprotein Iba gene.
J Biol Chem.
1995;270:24532-24539
22.
Hickey MJ, Roth GJ.
Characterization of the gene encoding human platelet glycoprotein IX.
J Biol Chem.
1993;268:3438-3443
23.
Yagi M, Edelhoff S, Disteche CM, Roth GJ.
Structural characterization and chromosomal location of the gene encoding human platelet glycoprotein Ib beta.
J Biol Chem.
1994;269:17424-17427
24.
Ravid K, Doi T, Beeler DL, Kuter DJ, Rosenberg RD.
Transcriptional regulation of the rat platelet factor 4 gene: interaction between an enhancer/silencer domain and the GATA site.
Mol Cell Biol.
1991;11:6116-6127
25.
Deveaux S, Filipe A, Lemarchandel V, Ghysdael J, Romeo P-H, Mignotte V.
Analysis of the thrombopoietin receptor (MPL) promoter implicates GATA and Ets proteins in the coregulation of megakaryocyte-specific genes.
Blood.
1996;87:4678-4685
26.
Van der Vuurst H, Hendriks M, Lapetina EG, van Willigen G, Akkerman J-WN.
Maturation of megakaryoblastic cells is accompanied by upregulation of Gs
27.
Tsang AP, Fujiwara Y, Hom DB, Orkin SH.
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA1 transcriptional cofactor FOG.
Genes Dev.
1998;12:1176-1188
28.
McDevitt MA, Shivdasani RA, Fujiwara Y, Yang H, Orkin SH.
A "knockdown" mutation created by cis-element gene targeting reveals the dependence of erythroid cell maturation on the level of transcription factor GATA-1.
Proc Natl Acad Sci U S A.
1997;94:6781-6785 29. Kowalski K, Czolij R, King GF, Crossley M, Mackay JP. The solution structure of the N-terminal zinc finger of GATA1 reveals a specific binding face for the transcriptional cofactor FOG. J Biomol NMR. 1999;13:249-262[CrossRef][Medline] [Order article via Infotrieve]. 30. Margaglione M, D'Andrea G, Grandone E, Brancaccio V, Amoriello A, Di Minno G. Compound heterozygosity (554-589 del, C515-T transition) in the platelet glycoprotein Ib alpha gene in a patient with a severe bleeding tendency. Thromb Haemost. 1999;81:486-492[Medline] [Order article via Infotrieve].
31.
Ludlow LB, Schick BP, Budarf ML, et al.
Identification of a mutation in a GATA binding site of the platelet glycoprotein Ibbeta promotor resulting in the Bernard-Soulier syndrome.
J Biol Chem.
1996;271:22076-22080
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. C. Xavier, Y. Ge, and J. W. Taub Down Syndrome and Malignancies: A Unique Clinical Relationship: A Paper from the 2008 William Beaumont Hospital Symposium on Molecular Pathology J. Mol. Diagn., September 1, 2009; 11(5): 371 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Soranzo, A. Rendon, C. Gieger, C. I. Jones, N. A. Watkins, S. Menzel, A. Doring, J. Stephens, H. Prokisch, W. Erber, et al. A novel variant on chromosome 7q22.3 associated with mean platelet volume, counts, and function Blood, April 16, 2009; 113(16): 3831 - 3837. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suzuki, T. Moriguchi, K. Ohneda, and M. Yamamoto Differential Contribution of the Gata1 Gene Hematopoietic Enhancer to Erythroid Differentiation Mol. Cell. Biol., March 1, 2009; 29(5): 1163 - 1175. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Elagib, I. S. Mihaylov, L. L. Delehanty, G. C. Bullock, K. D. Ouma, J. F. Caronia, S. L. Gonias, and A. N. Goldfarb Cross-talk of GATA-1 and P-TEFb in megakaryocyte differentiation Blood, December 15, 2008; 112(13): 4884 - 4894. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ghevaert, A. Salsmann, N. A. Watkins, E. Schaffner-Reckinger, A. Rankin, S. F. Garner, J. Stephens, G. A. Smith, N. Debili, W. Vainchenker, et al. A nonsynonymous SNP in the ITGB3 gene disrupts the conserved membrane-proximal cytoplasmic salt bridge in the {alpha}IIb{beta}3 integrin and cosegregates dominantly with abnormal proplatelet formation and macrothrombocytopenia Blood, April 1, 2008; 111(7): 3407 - 3414. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Cantor, H. Iwasaki, Y. Arinobu, T. B. Moran, H. Shigematsu, M. R. Sullivan, K. Akashi, and S. H. Orkin Antagonism of FOG-1 and GATA factors in fate choice for the mast cell lineage J. Exp. Med., March 17, 2008; 205(3): 611 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Labarque, K. Freson, C. Thys, C. Wittevrongel, M. F. Hoylaerts, R. De Vos, N. Goemans, and C. Van Geet Increased Gs signalling in platelets and impaired collagen activation, due to a defect in the dystrophin gene, result in increased blood loss during spinal surgery Hum. Mol. Genet., February 1, 2008; 17(3): 357 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. N. Tubman, J. E. Levine, D. R. Campagna, R. Monahan-Earley, A. M. Dvorak, E. J. Neufeld, and M. D. Fleming X-linked gray platelet syndrome due to a GATA1 Arg216Gln mutation Blood, April 15, 2007; 109(8): 3297 - 3299. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Phillips, D. P. Steensma, M. A. Pulsipher, G. J. Spangrude, and J. P. Kushner Congenital erythropoietic porphyria due to a mutation in GATA1: the first trans-acting mutation causative for a human porphyria Blood, March 15, 2007; 109(6): 2618 - 2621. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ghinassi, M. Sanchez, F. Martelli, G. Amabile, A. M. Vannucchi, G. Migliaccio, S. H. Orkin, and A. R. Migliaccio The hypomorphic Gata1low mutation alters the proliferation/differentiation potential of the common megakaryocytic-erythroid progenitor Blood, February 15, 2007; 109(4): 1460 - 1471. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, M. Hu, and R. A. Shivdasani Expression analysis of primary mouse megakaryocyte differentiation and its application in identifying stage-specific molecular markers and a novel transcriptional target of NF-E2 Blood, February 15, 2007; 109(4): 1451 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maeda, C. Nishiyama, T. Tokura, H. Nakano, S. Kanada, M. Nishiyama, K. Okumura, and H. Ogawa FOG-1 represses GATA-1-dependent Fc{epsilon}RI beta-chain transcription: transcriptional mechanism of mast-cell-specific gene expression in mice Blood, July 1, 2006; 108(1): 262 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Stachura, S. T. Chou, and M. J. Weiss Early block to erythromegakaryocytic development conferred by loss of transcription factor GATA-1 Blood, January 1, 2006; 107(1): 87 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lo, L. Li, P. Gissen, H. Christensen, P. J. McKiernan, C. Ye, M. Abdelhaleem, J. A. Hayes, M. D. Williams, D. Chitayat, et al. Requirement of VPS33B, a member of the Sec1/Munc18 protein family, in megakaryocyte and platelet {alpha}-granule biogenesis Blood, December 15, 2005; 106(13): 4159 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kuhl, A. Atzberger, F. Iborra, B. Nieswandt, C. Porcher, and P. Vyas GATA1-Mediated Megakaryocyte Differentiation and Growth Control Can Be Uncoupled and Mapped to Different Domains in GATA1 Mol. Cell. Biol., October 1, 2005; 25(19): 8592 - 8606. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Freson, R. De Vos, C. Wittevrongel, C. Thys, J. Defoor, L. Vanhees, J. Vermylen, K. Peerlinck, and C. Van Geet The TUBB1 Q43P functional polymorphism reduces the risk of cardiovascular disease in men by modulating platelet function and structure Blood, October 1, 2005; 106(7): 2356 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Hughan, Y. Senis, D. Best, A. Thomas, J. Frampton, P. Vyas, and S. P. Watson Selective impairment of platelet activation to collagen in the absence of GATA1 Blood, June 1, 2005; 105(11): 4369 - 4376. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ezoe, I. Matsumura, K. Gale, Y. Satoh, J. Ishikawa, M. Mizuki, S. Takahashi, N. Minegishi, K. Nakajima, M. Yamamoto, et al. GATA Transcription Factors Inhibit Cytokine-dependent Growth and Survival of a Hematopoietic Cell Line through the Inhibition of STAT3 Activity J. Biol. Chem., April 1, 2005; 280(13): 13163 - 13170. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ferreira, K. Ohneda, M. Yamamoto, and S. Philipsen GATA1 Function, a Paradigm for Transcription Factors in Hematopoiesis Mol. Cell. Biol., February 15, 2005; 25(4): 1215 - 1227. [Full Text] [PDF] |
||||
![]() |
C. K. Liew, R. J. Y. Simpson, A. H. Y. Kwan, L. A. Crofts, F. E. Loughlin, J. M. Matthews, M. Crossley, and J. P. Mackay Zinc fingers as protein recognition motifs: Structural basis for the GATA-1/Friend of GATA interaction PNAS, January 18, 2005; 102(3): 583 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanaka, J. Zheng, K. Kitajima, K. Kita, H. Yoshikawa, and T. Nakano Differentiation status dependent function of FOG-1 Genes Cells, December 1, 2004; 9(12): 1213 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ahmed, A. Sternberg, G. Hall, A. Thomas, O. Smith, A. O'Marcaigh, R. Wynn, R. Stevens, M. Addison, D. King, et al. Natural history of GATA1 mutations in Down syndrome Blood, April 1, 2004; 103(7): 2480 - 2489. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shimizu, K. Ohneda, J. D. Engel, C. D. Trainor, and M. Yamamoto Transgenic rescue of GATA-1-deficient mice with GATA-1 lacking a FOG-1 association site phenocopies patients with X-linked thrombocytopenia Blood, April 1, 2004; 103(7): 2560 - 2567. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Drachman Inherited thrombocytopenia: when a low platelet count does not mean ITP Blood, January 15, 2004; 103(2): 390 - 398. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gurbuxani, P. Vyas, and J. D. Crispino Recent insights into the mechanisms of myeloid leukemogenesis in Down syndrome Blood, January 15, 2004; 103(2): 399 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fossett, K. Hyman, K. Gajewski, S. H. Orkin, and R. A. Schulz Combinatorial interactions of Serpent, Lozenge, and U-shaped regulate crystal cell lineage commitment during Drosophila hematopoiesis PNAS, September 30, 2003; 100(20): 11451 - 11456. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lindeboom, N. Gillemans, A. Karis, M. Jaegle, D. Meijer, F. Grosveld, and S. Philipsen A tissue-specific knockout reveals that Gata1 is not essential for Sertoli cell function in the mouse Nucleic Acids Res., September 15, 2003; 31(18): 5405 - 5412. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Italiano Jr, W. Bergmeier, S. Tiwari, H. Falet, J. H. Hartwig, K. M. Hoffmeister, P. Andre, D. D. Wagner, and R. A. Shivdasani Mechanisms and implications of platelet discoid shape Blood, June 15, 2003; 101(12): 4789 - 4796. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mundschau, S. Gurbuxani, A. S. Gamis, M. E. Greene, R. J. Arceci, and J. D. Crispino Mutagenesis of GATA1 is an initiating event in Down syndrome leukemogenesis Blood, June 1, 2003; 101(11): 4298 - 4300. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Malik, D. von Stechow, R. T. Bronson, and R. A. Shivdasani Deletion of the GATA Domain of TRPS1 Causes an Absence of Facial Hair and Provides New Insights into the Bone Disorder in Inherited Tricho-Rhino-Phalangeal Syndromes Mol. Cell. Biol., December 15, 2002; 22(24): 8592 - 8600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kowalski, C. K. Liew, J. M. Matthews, D. A. Gell, M. Crossley, and J. P. Mackay Characterization of the Conserved Interaction between GATA and FOG Family Proteins J. Biol. Chem., September 13, 2002; 277(38): 35720 - 35729. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yu, K. K. Niakan, M. Matsushita, G. Stamatoyannopoulos, S. H. Orkin, and W. H. Raskind X-linked thrombocytopenia with thalassemia from a mutation in the amino finger of GATA-1 affecting DNA binding rather than FOG-1 interaction Blood, August 28, 2002; 100(6): 2040 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vannucchi, L. Bianchi, C. Cellai, F. Paoletti, R. A. Rana, R. Lorenzini, G. Migliaccio, and A. R. Migliaccio Development of myelofibrosis in mice genetically impaired for GATA-1 expression (GATA-1low mice) Blood, July 30, 2002; 100(4): 1123 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Freson, G. Matthijs, C. Thys, P. Marien, M. F. Hoylaerts, J. Vermylen, and C. Van Geet Different substitutions at residue D218 of the X-linked transcription factor GATA1 lead to altered clinical severity of macrothrombocytopenia and anemia and are associated with variable skewed X inactivation Hum. Mol. Genet., January 1, 2002; 11(2): 147 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Newton, J. Mackay, and M. Crossley The N-terminal Zinc Finger of the Erythroid Transcription Factor GATA-1 Binds GATC Motifs in DNA J. Biol. Chem., September 14, 2001; 276(38): 35794 - 35801. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||