|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Cell Biology, CardioVascular Systems, and
Genomics Units, GlaxoSmithKline Medicines Research Centre, Stevenage,
United Kingdom; and Atugen, Boulder, CO.
It has recently been shown that the transcription factor Erg, an
Ets family member, drives constitutive expression of the intercellular
adhesion molecule 2 (ICAM-2) in human umbilical vein endothelial cells
(HUVECs) and that its expression is down-regulated by the pleiotropic
cytokine tumor necrosis factor The endothelium plays a key role in a large number
of diseases, among them cancer and metastasis, rheumatoid arthritis,
atherosclerosis, and thrombosis, by regulating several key processes
such as leukocyte recruitment, hemostasis, vascular permeability, and
angiogenesis. During inflammation, several mediators can activate the
endothelium to promote a proinflammatory, prothrombotic state and to
regulate the angiogenic response. Angiogenesis (or new vessel
formation) is a tightly regulated process that requires the integration
of signals triggered by growth factors and adhesion events, namely modulation of cell-cell contact and interaction with the extracellular matrix.1 Angiogenesis is a critical aspect of the
development, growth, and repair of new tissues; it occurs
physiologically in circumstances such as wound healing and the
menstrual cycle. It is also a key component of many diseases driven by
tissue proliferation, such as cancer and rheumatoid
arthritis.2,3 In such diseases, new vessel formation
supports tissue growth and cellular infiltration, and it contributes to
the destructive proliferation of the inflammatory tissue. The link
between angiogenesis and inflammation has been suggested by various
studies that focus on common features such as the cellular infiltrate,
proliferation, and overlapping roles of inflammatory mediators and
growth factors.4-6
One such mediator is the pleiotropic cytokine tumor necrosis factor The proinflammatory effects of TNF- To define the endothelial target genes regulated by the transcription
factor Erg and thus provide new insight into the role of Erg in
endothelial cells, we used an antisense approach to decrease levels of
Erg mRNA and protein in HUVECs. The RNA obtained from these cells was
analyzed to identify Erg target genes, using differential gene
expression (DGE) technology. We show that Erg regulates several genes
involved in vascular cell remodeling and shape change, angiogenesis,
proliferation, and cell adhesion. We confirm that ICAM-2 and
vWF are downstream targets of Erg and identify
SPARC, thrombospondin (TSP-1), and
RhoA as new Erg target genes. The expression of all of these
genes is down-regulated by TNF- Design of Erg-specific GeneBlocs
Delivery of GeneBlocs to HUVECs
TaqMan and Lightcycler quantification of mRNA Total RNA was prepared from HUVECs after GeneBloc delivery using the RNA purification kit for the 35-mm well or RNeasy extraction kit for the 96-well assays (both from Qiagen, United Kingdom). For TaqMan analysis, dual-labeled probes were synthesized with a reporter dye, covalently linked at the 5' end and a quencher dye conjugated to the 3' end. One-step reverse transcription-polymerase chain reaction (RT-PCR) amplifications were performed on the ABI Prism 7700 Sequence Detector (PE Biosystems, Foster City, CA) using 50-µL reactions consisting of 10 µL total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, 1× TaqMan PCR reaction buffer (PE-Applied Biosystems, Foster City, CA), 5.5 mM MgCl2, 300 µM each dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega, Madison, WI), 1.25 U AmpliTaq Gold (PE-Applied Biosystems), and 10 U M-MLV Reverse Transcriptase (Promega). Thermal cycling conditions consisted of 30 minutes at 48°C, 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C, and 1 minute at 60°C. Standard curves were generated from serial dilutions of total HUVEC RNA; normalization was performed using -actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels as controls in parallel TaqMan reactions. For each gene of interest, 5' and 3' primers and a fluorescence-labeled probe were designed as follows: Erg 5' primer, GGAGTGGGCGGTGAAAGA; Erg 3' primer, AAGGATGTCGGCGTTGTAGC; Erg probe, TGGCCTTCCAGACGTCAACATCTTGTTATT; ICAM-2 5' primer,
ATCTGTCCTGCTCTGCTTCATCT; ICAM-2 3' primer, CGTAGGTGCCCATCCGC; ICAM-2
probe, CGGCCAGCACTTGCGCCA; Rho 5' primer, TTAACGATGTCCAACCCGTCT; Rho 3'
primer, GGTGGGAGTGCAGAGGAGG; Rho probe, CAGGGTCCTTTTGACACTGCTCTAACAGCC;
Actin 5' primer, GCA TGG GTC AGA AGG ATT CCT AT; Actin 3' primer, TGT
AGA AGG TGT GGT GCC AGA TT; Actin probe, TCGAGCACGGCATCGTCACCAA; GAPDH
primer-probe was purchased from PerkinElmer (catalog number,
4310884E). For analysis of gene expression using the Lightcycler (Roche
Molecular Biochemicals, Mannheim, Germany), the following primers were
used: vWF, 5' CTTGGTCACATCTTCACATTCACT; vWF, 3' GACACAGCTGCCTTCCAACAT; TSP, 5' ATGCTGGTGGTAGACTAGGGTTGTTT; TSP, 3'
GAAGGAGGATGTCAGGGTGGTTT; SPARC, 5' AATGTTT- GGATGGTTTGTTGTTCTGC;
SPARC, 3' ACGTTCTGGTTGGTGGATTCTGC; GAPDH, 5'ACCACAGTCCATGCCATCAC;
GAPDH, 3'ACCACAGTCCATGCCATCAC. Real-time incorporation of SYBR Green I
dye into a specific PCR product was measured in glass capillary tubes
using the Lightcyler (Roche Molecular Biochemicals). A standard curve
was generated for each primer pair using control HUVEC RNA, and values
are represented as relative expression to GAPDH in each sample.
Western blot analysis All nuclear extracts were prepared using the micropreparation technique.19 Protein extracts from supernatants were prepared using TCA precipitation. Briefly, an equal volume of 20% TCA was added to the cell supernatant, incubated on ice for 1 hour, and pelleted by centrifugation for 5 minutes. Pellets were washed in acetone, dried, and resuspended in water. HUVEC protein extracts were run on a 10% Bis-Tris NuPage (nuclear extracts) or 4% to 12% Tris-Glycine (supernatant extracts) polyacrylamide gel (Novex, San Diego, CA) following the manufacturer's protocols and were transferred onto nitrocellulose membranes using Novex X Cell-II module at 25 mA for 90 minutes. Nonspecific binding was blocked by incubation with 5% nonfat milk for 1 hour followed by primary antibody for 16 hours at 4°C. The following antibodies were used for Western blotting and were diluted as indicated: vWF (rabbit polyclonal A0082; Dako, Ely, United Kingdom), 1:100; SPARC (monoclonal ON1-1; Takara Biomedicals, Biowhittaker, Wokingham, United Kingdom), 1:1000; thrombospondin (TSP-B7; Sigma, St Louis, MO), 1:100; Erg (C20; Santa Cruz Biotechnology, Santa Cruz, CA), 1:1000; Oct-1 (C21; Santa Cruz), 1:100. After washes, the secondary antibody was applied (1:10 000 dilution; Sigma) for 1 hour at room temperature, and the signal was detected with the SuperSignal reagent (Pierce, United Kingdom).Differential gene expression Sequence-verified high-density cDNA arrays on nylon filters were prepared in house. Known human genes were selected because of their known or predicted role in inflammation and in the development atherosclerosis (for review, see Ross20). Genes were grouped in the following categories: inflammation, cell adhesion, apoptosis, cell cycle, cytoskeleton, extracellular matrix, signal transduction, transcription, growth factors, hemostasis, and lipid metabolism. One thousand forty EST clones were selected from the IMAGE library, representing 482 individual genes. Sequence-verified PCR products of 800-bp average length, corresponding to the 3' end of each gene, were gridded using a KB robotic gridder (KayBee Engineering, Essex, United Kingdom) in duplicate onto nylon filters (Boehringer Mannheim, Mannheim, Germany) using an automated 384-pin gridding device (Gentix, Hants, United Kingdom). Filters were then denatured (0.5 M NaOH, 100 mM NaCl) for 2 minutes, neutralized (1 M Tris, pH 7.2, 100 mM NaCl) for 2 minutes, and UV cross-linked (Stratalinker; Stratagene, Palo Alto, CA). Total RNA was prepared from HUVECs treated with Erg GeneBloc or a random control GeneBloc 3.3, as described. RNA was precipitated overnight and analyzed on a dimethyl sulfoxide-glyoxal-agarose gel to check the quantity and integrity of the RNA. Approximately 10 µg total RNA was used to generate duplicate radiolabeled cDNA probes using Superscript II (Stratagene) and -33P dCTP (Amersham Pharmacia Biotech, Little Chalfont,
Buckinghamshire, United Kingdom). After purification on a G50 column
(Amersham Pharmacia Biotech), probes were run on a 6% TBE urea gel
(Novex) alongside known size markers, and the image data were captured using a Storm Scanner (Molecular Dynamics, Sunnyvale, CA) for quality
control of probe size. All cDNAs in the array contained the M13
sequence; thus, an M13 oligonucleotide probe, end-labeled with
 -33P dATP, was hybridized to the membranes to control
for differences in spot loading. For prehybridization, membranes were
incubated in DIG Easy Hyb (Boehringer Mannheim) at 45°C for 90 minutes and were then hybridized overnight in DIG Easy Hyb containing
probe at 45°C. Filters were washed 3 × 15 minutes in 0.1 × SSC, 0.1% sodium dodecyl sulfate at 68°C and exposed to
phospho-screens for 2 days, and images were captured using a phosphor
imager (Storm Scanner; Molecular Dynamics). Processing of the images,
including spot finding, spot intensity quantitation, and local
background subtraction, was performed using Glaxo Wellcome proprietary
image analysis software (DGENT; GlaxoSmithKline, Uxbridge, Middlesex, United Kingdom). Raw values were normalized using M13 hybridization data and were compared in a 4-way analysis on duplicate probes and
replica filters. The genes, which were consistently more than 1.4-fold
different between the Erg GeneBloc and the control GeneBloc samples,
were selected.
Matrigel morphogenetic assay Aliquots of Matrigel (Becton Dickinson, Oxford, United Kingdom) were thawed on ice, and 200 µL was plated onto chilled 15-mm wells and incubated at 37°C for 30 minutes to form a gel as per the manufacturer's instructions. HUVECs in 6-well plates were treated with the Erg GeneBloc or the Mismatch GeneBloc for 24 hours as described, trypsinized, and counted, and 4 × 104 cells in EGM-2 were added to each well containing Matrigel. After 16 hours, the formation of tubulelike structures was analyzed using a Leica 550 image analyser. Dark-field, low-magnification images were processed to remove background and were skeletonized, and total curve length (in micromolars) and number of branches were calculated.
Erg GeneBlocs decrease Erg mRNA and protein levels in HUVECs To suppress Erg expression in endothelial cells, antisense oligonucleotides (GeneBlocs) were designed. GeneBlocs are modified RNA oligonucleotides that are less susceptible to degradation and have reduced toxicity and increased target-binding affinity than traditional antisense oligonucleotides.18 Because other Ets family members are expressed in endothelial cells, Erg GeneBlocs were designed to target a region of human Erg not homologous to 5 closely related family members also found in endothelial cells: Ets-1, Ets-2, Fli-1, Nerf-1, and Nerf-2.13,21-23 In initial studies, 8 Erg GeneBlocs were designed, and inhibition of Erg mRNA in HUVECs was assayed using TaqMan (data not shown). Two GeneBlocs (GB573 and GB566) gave more than 80% inhibition of Erg mRNA levels after 24 hours when compared to a random scrambled control GeneBloc (GBC3.3) (Figure 1). This inhibition lasted for at least 72 hours of continuous GeneBloc delivery. Erg mRNA was inhibited in a dose-dependent manner after treatment of HUVECs with GB566 from 0 nM to 25 nM (data not shown). Because the 2 GeneBlocs gave comparable results, only GeneBloc GB566 was used in all subsequent studies. To verify that Erg protein levels were also decreased after GeneBloc treatment, nuclear extracts from HUVECs treated with Erg GeneBloc (GB566), the scrambled control GeneBloc (GBC3.3), or the Erg Mismatch GeneBloc (GB478) were subjected to Western blot analysis. Expression levels of the ubiquitous transcription factor Oct-1 were also determined to normalize for loading differences (Figure 2A-B). Densitometry was performed on the bands representing Erg and Oct-1, and the Erg:Oct ratio was calculated. Results showed that Erg protein levels were decreased approximately 2.5-fold after 24 and 48 hours of Erg GeneBloc treatment and by 5-fold after 72 hours of treatment when compared with control GeneBloc treatment (Figure 2A). Erg Mismatch GeneBloc GB478 did not decrease Erg protein levels compared with random control GeneBloc GBC3.3 (Figure 2B).
Differential gene expression of HUVECs treated with Erg GeneBloc GeneBloc treatment significantly decreased Erg mRNA and protein levels at all time points tested. The model was, therefore, used in a DGE experiment between Erg GeneBloc-treated and control GeneBloc-treated HUVECs to identify differences in the gene expression pattern caused by the inhibition of Erg expression. Total RNA was generated from cells treated with Erg GeneBloc (GB566) or control GeneBloc (GBC3.3) for 24, 48, and 72 hours and was used to prepare radiolabeled cDNA probes for DGE analysis. Probes were hybridized to sequence-verified cDNA arrays containing clones corresponding to 482 individual genes. Genes belonged to several functional families, including inflammation, cell adhesion, and transcription (see "Materials and methods"). For each clone, duplicate spots were present in each array. Each hybridization was performed in duplicate so that for each clone at each time point at least 4 duplicate determinations were available. A 4-way comparison analysis was performed between control GeneBloc and Erg GeneBloc samples to identify genes that were decreased after the suppression of Erg expression. Only the genes that were consistently different by 1.4-fold or more in all 4 comparisons were considered. Several hits were identified that were consistently decreased in the samples treated with Erg GeneBloc (Table 1). ICAM-2 and vWF were consistently decreased in the Erg GeneBloc samples. This confirms that Erg drives expression of these 2 genes, as suggested by previous reports showing that Erg cDNA can transactivate the ICAM-2 and vWF promoters.12,21 Other genes decreased after Erg GeneBloc treatment were SPARC, TSP, and RhoA. The expression of these 5 genes was decreased at all time points, though only 2 of the 4 RhoA replicates were decreased at 24 hours. These results suggest that the 5 genes identified by DGE are down-stream targets of Erg. Interestingly, a common functional theme is present in the DGE hits because 4 of the 5 genes identified are cell adhesion molecules, and RhoA is involved in signaling downstream of adhesion molecules.
Real-time polymerase chain reaction analysis of differential gene expression hits To validate the DGE results, 2 real-time PCR-based methods of RNA quantification TaqMan (PerkinElmer) and Lightcycler (Roche)were used. A new set of RNA was generated from cells treated with the Erg GeneBloc 566 or with scrambled control GeneBloc. A new
4-base mismatch control (GB478), which did not inhibit Erg
mRNA levels after 24, 48, or 72 hours of treatment (Figure
3), was used in these experiments. To
select the most appropriate control for normalization, a panel of 11 putative housekeeping genes was screened for variability across the
different GeneBloc treatments. Expression of GAPDH was the
least variable between treatments (data not shown) and was, therefore,
used in subsequent experiments for normalization. Expression of
ICAM-2 and RhoA was detected using the TaqMan
system, whereas expression of SPARC, TSP, and
vWF was detected using the light cycler real-time PCR. mRNA
levels of all 5 genes analyzed were decreased to various degrees in
HUVECs after 24 hours of treatment with the Erg GeneBloc
(Figure 4). An additional control was
represented by fibronectin mRNA, whose levels were unchanged after 24 hours of treatment and were up-regulated after 48 and 72 hours of Erg
GeneBloc treatment (data not shown). Therefore, the results obtained by
DGE on the 5 putative Erg target genes were confirmed at the 24-hour
time-point on a separate set of samples by PCR-based
quantification methods.
TNF- in HUVECs. Hence, we looked at the effect of
TNF- on expression of the other Erg target genes identified by DGE, namely the secreted proteins vWF,
SPARC, and TSP-1 (Figure
5). HUVECs were treated with TNF- (10 µg/mL) for 24 hours, and protein extracts were prepared from
the cell supernatants. Western blot analysis was performed, and band
intensity was measured by densitometry. Protein levels of SPARC, TSP,
and vWF were all markedly decreased in response to 24 hours of TNF-
treatment (Figure 5). Therefore, TNF- down-regulates the expression
of Erg and of its target genes in endothelial cells.
Effect of Erg GeneBloc on endothelial cell tube formation All the genes identified by DGE as downstream targets of the transcription factor Erg are associated with angiogenesis or vascular remodeling. SPARC and TSP-1 have been shown to modulate angiogenesis, cell shape change, motility, differentiation, and proliferation.24-27 RhoA is a key regulator of the actin cytoskeleton, mediating cell shape responses to the interaction between adhesion molecules and the surrounding extracellular matrix.28 vWF has recently been associated with angiogenesis through interaction with its endothelial receptor, GPIb.29 We tested the ability of the Erg GeneBloc to modulate endothelial tube formation in a 3-dimensional culture system. An identical number of HUVECs, treated with Erg GeneBloc (GB566) or control GeneBloc (GB478) for 24 hours, was plated on Matrigel in 15-mm wells and allowed to form tubes over 16 hours. Figure 6A shows a representative photograph of HUVEC on Matrigel after treatment with Erg GeneBloc (right panel) or the mismatch control GeneBloc (left panel). After treatment with Erg GeneBloc, a clear reduction in the amount of tube formation of HUVECs and in the number of branches formed is observed. The number of branches formed in each well was quantified by image analysis, and the results are shown in Figure 6B. A 3-fold reduction in the number of branches was observed after Erg GeneBloc treatment, indicating that Erg gene expression is required for vascular remodeling, one of the key steps of angiogenesis.
Inflammation, leukocyte recruitment into tissues, and angiogenesis are just a few of the processes regulated by the endothelium.3 In healthy conditions, a dynamic balance between inhibitors and activators of these key functions maintains endothelial homeostasis. The up-regulation of proinflammatory or proangiogenic factors is accompanied by the down-regulation of inhibitory factors. Consequently, understanding the mechanisms underlying up-regulation and down-regulation of gene expression is crucial to understanding endothelial activation and its role in health and disease. Numerous stimuli affect endothelial function by modulating gene
expression.30 Although many studies have focused on the up-regulation of gene expression induced by cytokines such as TNF- To identify new Erg target genes and gain some insight into its role in the endothelium, we designed a strategy to suppress Erg expression in HUVECs using antisense oligonucleotides, and we analyzed the gene expression profile in the cells with reduced Erg expression. A specific Erg antisense (GeneBloc) decreased levels of Erg mRNA (by 80%-90%) and protein (by 60%-80%) in HUVECs over a period of 24 to 72 hours. RNA from HUVECs treated with either Erg GeneBloc or a control GeneBloc was used in a differential gene expression experiment to compare the gene expression profile in cells with reduced Erg expression with control HUVECs. DGE was performed on high-density cDNA arrays containing 482 known genes, representing genes involved in inflammation, cell adhesion, angiogenesis, hemostasis, cell cycle, apoptosis, lipid metabolism, signaling, and transcription. Several genes were identified that were reduced in the Erg GeneBloc-treated cells. After a stringent analysis of duplicates and replicates, and across all time points, ICAM-2, vWF, SPARC, TSP-1, and Rho A were consistently down-regulated after Erg GeneBloc treatment. The results of this study suggest a new functional role for the
transcription factor Erg in endothelial cells. The new genes identified as Erg targets have been clearly involved in
angiogenesis, often displaying both pro- and antiangiogenic properties.
SPARC was initially referred to as antiadhesin because it can disrupt cell-matrix interactions.40 It was shown to inhibit
endothelial cell spreading on collagen40 and to alter
endothelial morphology41 and barrier
properties.42 Evidence for a role of SPARC in regulating angiogenesis comes from several studies. SPARC regulates endothelial cell proliferation, induces loss of focal adhesion (thus loosening adhesion to the extracellular matrix), and stimulates production of
matrix-degrading enzymes such as MMPs and PAI-1.43 TSP-1 is also an extracellular matrix protein involved in the regulation of
adhesion and angiogenesis.25,26 It inhibits angiogenesis both in vitro and in vivo,44 and it functions by binding
to several molecules including Given the involvement of 4 Erg target genes in angiogenesis and cell proliferation, we investigated the role of Erg in vascular cell remodeling and adhesion using an in vitro model of endothelial cell differentiation. Endothelial cells plated on Matrigel undergo a morphologic rearrangement, and alignment of cells into tubulelike structures is complete by 16 hours.58 HUVECs treated with Erg GeneBloc for 24 hours were plated on Matrigel and allowed to form these tubular structures overnight. Cells in which Erg expression was decreased because of GeneBloc treatment formed significantly less tubulelike structures than cells treated with a specific control GeneBloc. The final alignment of endothelial cells into these structures on Matrigel may not itself require transcription59; however, in the experiment presented here, HUVECs were treated with antisense oligonucleotides for 24 hours before seeding on Matrigel. This time is sufficient to significantly reduce the transcription of Erg and Erg target genes, as shown here. Therefore, it is the transcriptional effect that occurs before seeding onto Matrigel that is responsible for this phenotype. This assay clearly demonstrates a role for Erg as a direct modulator of this endothelial differentiation phenotype, a prerequisite for the in vivo process of angiogenesis. Further support for this model comes from recent studies in Xenopus embyros. A Xenopus homologue of Erg, Xl-erg, was micro-injected into embryos, and several developmental defects were observed, including eye malformations and ectopic endothelial differentiation,60 suggesting that in Xenopus Erg may be involved in regulation of cell motility, adhesion, and angiogenesis. Other Ets family members, Ets-114,61 and Fli-1,23 have been involved in the regulation of angiogenesis. It is unlikely that the effects observed in this study are attributable to the inhibition of Ets family members other than Erg because the GeneBloc used in this study was specific for Erg, and a 4-bp mismatch was sufficient to abrogate the effect. All Erg target genes described here have been shown to be
down-regulated in HUVEC by TNF- In conclusion, we have demonstrated that the transcription factor Erg regulates the expression of ICAM-2, SPARC, TSP-1, RhoA, and vWF and is a modulator of endothelial cell differentiation, which is a component of angiogenesis. Strategies aimed at the regulation of Erg may be of use in the therapy of diseases such as cancer, rheumatoid arthritis, osteoporosis, and wound healing.
We thank Francesco Falciani (GSK) and Eugenia Biguzzi (Policlinico Hospital, Milan, Italy) for preparation of the cDNA arrays; Mark Edbrooke (GSK) and Thale C. Jarvis (Atugen) for setting up a fruitful collaboration; Brian Hayes (GSK) and Justin Mason (Hammersmith Hospital, London) for assistance with the Matrigel assay; Anne Ridley and Paul Thompson (Ludwig Institute, London, United Kingdom) for a personal communication; Chantelle Ward (GSK) and Matthew Goulden (GSK) for help with real-time PCR set-up; and Callum J. Campbell (GSK) for helpful discussions.
Submitted February 13, 2001; accepted July 30, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Anna M. Randi, Experimental Medicine, GlaxoSmithKline, Addenbrooke's Centre for Clinical Investigation, Addenbrooke's Hospital, Hills Road, Cambridge, United Kingdom, CB2 2 GG; e-mail: ar18946{at}gsk.com.
1. Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature. 2000;407:249-257[CrossRef][Medline] [Order article via Infotrieve]. 2. Celermajer DS. Endothelial dysfunction: does it matter? Is it reversible? J Am Coll Cardiol. 1997;30:325-333[Abstract].
3.
Cines DB, Pollak ES, Buck CA, et al.
Endothelial cells in physiology and in the pathophysiology of vascular disorders.
Blood.
1998;91:3527-3561
4.
Frater-Schroder M, Risau W, Hallman R, Gautschi P, Bohlen P.
Tumor necrosis factor type
5.
Griffioen AW, Damen CA, Blijham GH, Groenewegen G.
Tumor angiogenesis is accompanied by a decreased inflammatory response of tumor-associated endothelium.
Blood.
1996;88:667-673
6.
Fajardo LF, Kwan HH, Kowalski J, Prionas SD, Allison AC.
Dual role of tumor necrosis factor-
7.
Leibovich S, Polverini H, Shepard D, Wiseman D, Shively V, Nuseir N.
Macrophage-induced angiogenesis is mediated by tumor necrosis factor- 8. Stolpen A, Guinan E, Fiers W, Pober JS. Recombinant tumor necrosis factor and immune interferon act singly and in combination to reorganize human vascular endothelial cell monolayers. Am J Pathol. 1986;123:16-24[Abstract].
9.
Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, Williamson B.
An endotoxin-induced serum factor that causes tumor necrosis.
Proc Natl Acad Sci U S A.
1975;72:3666-3670 10. McEver RP. Selectins: novel receptors that mediate leukocyte adhesion during inflammation. Thromb Haemost. 1991;65:223-228[Medline] [Order article via Infotrieve].
11.
Saadi S, Holzknecht RA, Patte CP, Stern DM, Platt JL.
Complement-mediated regulation of tissue factor activity in endothelium.
J Exp Med.
1995;182:1807-1814
12.
McLaughlin F, Ludbrook VJ, Kola I, Campbell CJ, Randi AR.
Characterization of the tumour necrosis factor (TNF)- 13. Wernert N, Raes M, Lassalle P, et al. c-ets1 proto-oncogene is a transcription factor expressed in endothelial cells during tumor vascularization and other forms of angiogenesis in humans. Am J Pathol. 1992;140:119-127[Abstract]. 14. Iwasaka C, Tanaka K, Abe M, Sato Y. Ets-1 regulates angiogenesis by inducing the expression of urokinase-type plasminogen activator and matrix metalloproteinase-1 and the migration of vascular endothelial cells. J Cell Physiol. 1996;169:522-531[CrossRef][Medline] [Order article via Infotrieve]. 15. MacLeod K, Leprince D, Stehelin D. The Ets gene family. Trends Biochem Sci. 1992;17:251-256[CrossRef][Medline] [Order article via Infotrieve]. 16. Wasylyk B, Hagman J, Gutierrez-Hartmann A. Ets transcription factors: nuclear effectors of the ras-map-kinase signaling pathway. Trends Biochem Sci. 1998;23:213-216[CrossRef][Medline] [Order article via Infotrieve]. 17. Hart AH, Corrick CM, Tymms MJ, Hertzog PJ, Kola I. Human Erg is a proto-oncogene with mitogenic and transforming activity. Oncogene. 1995;10:1423-1430[Medline] [Order article via Infotrieve].
18.
Wincott F, DiRenzo A, Shaffer C, et al.
Synthesis, deptrotection, analysis and purification of RNA and ribozymes.
Nucleic Acids Res.
1995;23:2677-2684
19.
Andrews NC, Faller DV.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res.
1991;19:2499-2500
20.
Ross J.
mRNA stability in mammalian cells.
Microbiol Rev.
1995;59:423-450 21. Schwachtgen JL, Janel N, Barek L, et al. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene. Oncogene. 1997;15:3091-3102[CrossRef][Medline] [Order article via Infotrieve].
22.
Dube A, Akbarali Y, Sato TN, Libermann TA, Oettgen P.
Role of the Ets transcription factors in the regulation of the vascular-specific Tie2 gene.
Circ Res.
1999;84:1177-1185 23. Brown LA, Rodaway AR, Schilling TF, et al. Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish. Mech Dev. 2000;90:237-252[CrossRef][Medline] [Order article via Infotrieve]. 24. Sage H. Terms of attachment: SPARC and tumorigenesis. Nat Med. 1997;3:144-146[CrossRef][Medline] [Order article via Infotrieve]. 25. Roberts DD. Regulation of tumor growth and metastasis by thrombospondin-1. FASEB J. 1996;10:1183-1191[Abstract].
26.
Tolsma SS, Volpert OV, Good DJ, Frazier WA, Polverini PJ, Bouck N.
Peptides derived from two separate domains of the matrix protein thrombospondin-1 have anti-angiogenic activity.
J Cell Biol.
1993;122:497-511 27. Ledda MF, Adris S, Bravo AI, et al. Suppression of SPARC expression by antisense RNA abrogates the tumorigenicity of human melanoma cells. Nat Med. 1997;3:171-176[CrossRef][Medline] [Order article via Infotrieve]. 28. Nobes C, Hall A. Rho, Rac and CDC42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia and filopodia. Cell. 1995;81:53-62[CrossRef][Medline] [Order article via Infotrieve].
29.
Yeh CH, Wang WC, Hsieh TT, Huang TF.
Agkistin, a snake venom-derived glycoprotein Ib antagonist, disrupts von Willebrand factor-endothelial cell interaction and inhibits angiogenesis.
J Biol Chem.
2000;275:18615-18618 30. Pober JS, Gimbrone MA, Lapierre LA, et al. Overlapping patterns of activation of human endothelial cells by interleukin 1, tumour necrosis factor, and immune interferon. J Immunol. 1986;137:1893-1896[Abstract].
31.
Bachurski CJ, Pryhuber GS, Glasser SW, Kelly SE, Whitsett JA.
Tumor necrosis factor-
32.
Fukudome K, Esmon CT.
Identification, cloning, and regulation of a novel endothelial cell protein C/activated protein C receptor.
J Biol Chem.
1994;269:26486-26491
33.
Hooper WC, Phillips DJ, Ribeiro MJA, et al.
Tumor necrosis factor-
34.
Lentz SR, Tsiang M, Sadler JE.
Regulation of thrombomodulin by tumor necrosis factor-
35.
Puri KD, Finger EB, Gaudernack G, Springer TA.
Sialomucin CD34 is the major L-selectin ligand in human tonsil high endothelial venules.
J Cell Biol.
1995;131:261-270 36. Alonso J, Sanchez de Miguel L, Monton M, Casado S, Lopez-Farre A. Endothelial cytosolic proteins bind to the 3' untranslated region of endothelial nitric oxide synthase mRNA: regulation by tumor necrosis factor alpha. Mol Cell Biol. 1997;17:5719-5726[Abstract]. 37. Sirenko OI, Lofquist AK, DeMaria CT, Morris JS, Brewer G, Haskill JS. Adhesion-dependent regulation of an A+U-rich element-binding activity associated with AUF1. Mol Cell Biol. 1997;17:3898-3906[Abstract]. 38. Buttice G, Duterque-Coquillaud M, Basuyaux JP, Carrere S, Kurkinen M, Stehelin D. Erg, an ets-family member, differentially regulates human collagenase1 (MMP1) and stromelysin1 (MMP3) gene expression by physically interacting with the fos/jun complex. Oncogene. 1996;13:2297-2306[Medline] [Order article via Infotrieve].
39.
Gory S, Dalmon J, Prandini MH, Kortulewski T, de Launoit Y, Huber P.
Requirement of a GT box (Sp1 site) and two ETS binding sites for vascular endothelial cadherin gene transcription.
J Biol Chem.
1998;273:6750-6755
40.
Sage H, Vernon RB, Funk SE, Everitt EA, Angello J.
SPARC, a secreted protein associated with cellular proliferation, inhibits cell spreading in vitro and exhibits Ca2+-dependent binding to the extracellular matrix.
J Cell Biol.
1989;109:341-356 41. Sage H. Modulation of endothelial cell shape by SPARC does not involve chelation of extracellular Ca2+ and Mg2+. Biochem Cell Biol. 1991;70:56-62.
42.
Goldblum SE, Ding X, Funk SE, Sage H.
SPARC (secreted protein acidic and rich in cysteine) regulates endothelial cell shape change and barrier function.
Proc Natl Acad Sci U S A.
1994;91:3448-3452 43. Jenraschak E, Sage H. Regulation of angiogenesis by SPARC and angiostatin: implications for tumor cell biology. Semin Cancer Biol. 1996;7:139-146[CrossRef][Medline] [Order article via Infotrieve]. 44. Lawler J. The functions of thrombospondin-1 and -2. Curr Opin Cell Biol. 2000;12:634-640[CrossRef][Medline] [Order article via Infotrieve].
45.
Sadler JE.
von Willebrand factor.
J Biol Chem.
1991;266:22777-22780 46. Zanetta L, Marcus SG, Vasile J, et al. Expression of von Willebrand factor, an endothelial cell marker, is up-regulated by angiogenesis factors: a potential method for objective assessment of tumor angiogenesis. Int J Cancer. 2000;85:281-288[Medline] [Order article via Infotrieve].
47.
De Groot PG, Verweij CL, Nawroth PP, de Boer HC, Stern DM, Sixma JJ.
Interleukin-1 inhibits the synthesis of von Willebrand factor in endothelial cells, which results in a decreased reactivity of their matrix toward platelets.
Arteriosclerosis.
1987;7:605-611 48. Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell. 1992;70:389-399[CrossRef][Medline] [Order article via Infotrieve]. 49. Boudreau NJ, Jones PL. Extracellular matrix and integrin signaling: the shape of things to come. Biochem J. 1999;339:481-488.
50.
Vouret-Craviari V, Boquit P, Pouyssegur J, Van Obberghen-Schilling E.
Regulation of the actin cytoskeleton by thrombin in human endothelial cells: role of rho proteins in endothelial barrier function.
Mol Biol Cell.
1998;9:2639-2653 51. Gerwin N, Gonzalo J, Coyle C, et al. Prolonged eosinophil accumulation in allergic lung interstitium of ICAM-2-deficient mice results in extended hyperresponsiveness. Immunity. 1999;10:9-19[CrossRef][Medline] [Order article via Infotrieve]. 52. Issekutz AC, Rowter D, Springer TA. Role of ICAM-1 and ICAM-2 and alternate CD11/CD18 ligands in neutrophil transendothelial migration. J Leukoc Biol. 1999;65:117-121[Abstract]. 53. Reiss Y, Hoch G, Deutsch U, Engelhardt B. T cell interaction with ICAM-1-deficient endothelium in vitro: essential role for ICAM-1 and ICAM-2 in transendothelial migration of T cells. Eur J Immunol. 1998;28:3086-3099[CrossRef][Medline] [Order article via Infotrieve]. 54. Geijtenbeek TBH, Krooshoop DJED, Bleijs DA, et al. DC-SIGN-ICAM 2 interaction mediates dendritic cell trafficking. Nat Immunol. 2000;1:353-357[CrossRef][Medline] [Order article via Infotrieve]. 55. Shang X, Issekutz AC. Contribution of CD11a/CD18, CD11b/CD18, ICAM-1 (CD54) and -2 (CD102) to human monocyte migration through endothelium and connective tissue fibroblast barriers. Eur J Immunol. 1998;28:1970-1979[CrossRef][Medline] [Order article via Infotrieve]. 56. Romer LH, McLean NV, Yan HC, Daise M, Sun J, DeLisser HM. IFN-gamma and TNF-alpha induce redistribution of PECAM-1 (CD31) on human endothelial cells. J Immunol. 1995;154:6582-6592[Abstract].
57.
McLaughlin F, Hayes BP, Horgan CMT, Beesley JE, Campbell CJ, Randi AR.
Tumor necrosis factor (TNF)- 58. Bauer J, Margolis M, Schreiner C, et al. In vitro model of angiogenesis using a human endothelium-derived permanent cell line: contributions of induced gene expression, G-proteins, and integrins. J Cell Physiol. 1992;153:437-449[CrossRef][Medline] [Order article via Infotrieve]. 59. Zimrin A, Villeponteau B, Maciag T. Models of in vitro angiogenesis: endothelial cell differentiation on fibrin but not Matrigel is transcriptionally dependent. Biochem Biophys Res Commun. 1995;213:630-638[CrossRef][Medline] [Order article via Infotrieve]. 60. Baltzinger M, Mager-Heckel A, Remy P. XL erg: expression pattern and overexpression during development plead for a role in endothelial cell differentiation. Dev Dyn. 1999;216:420-433[CrossRef][Medline] [Order article via Infotrieve]. 61. Wernert N, Stanjek A, Kiriakidis S, et al. Inhibition of angiogenesis in vivo by ets-1 antisense oligonucleotides: inhibition of Ets-1 transcription factor expression by the antibiotic fumagillin. Angew Chem Int Ed Engl. 1999;38:3228-3231[CrossRef][Medline] [Order article via Infotrieve].
62.
Ryuto M, Ono M, Izumi H, et al.
Induction of vascular endothelial growth factor by tumor necrosis factor 63. Bussolino F, Arese M, Silverstro L, et al. Involvement of a serine protease in the synthesis of platelet-activating factor by endothelial cells stimulated by tumor necrosis factor-alpha or interleukin-1-alpha. Eur J Immunol. 1994;24:3131-3139[Medline] [Order article via Infotrieve].
64.
Paleolog E.
Target effector role of vascular endothelium in the inflammatory response: insights from the clinical trial of anti-TNF alpha antibody.
Mol Pathol.
1997;50:225-233 65. Yamamoto K, Dewaard V, Fearns C, Loskutoff D. Tissue distribution and regulation of murine von Willebrand factor gene expression in vivo. Blood. 1998;8:2791-2801.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  L. Yuan, V. Nikolova-Krstevski, Y. Zhan, M. Kondo, M. Bhasin, L. Varghese, K. Yano, C. V. Carman, W. C. Aird, and P. Oettgen Antiinflammatory Effects of the ETS Factor ERG in Endothelial Cells Are Mediated Through Transcriptional Repression of the Interleukin-8 Gene Circ. Res., May 8, 2009; 104(9): 1049 - 1057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Birdsey, N. H. Dryden, V. Amsellem, F. Gebhardt, K. Sahnan, D. O. Haskard, E. Dejana, J. C. Mason, and A. M. Randi Transcription factor Erg regulates angiogenesis and endothelial apoptosis through VE-cadherin Blood, April 1, 2008; 111(7): 3498 - 3506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Oettgen Regulation of Vascular Inflammation and Remodeling by ETS Factors Circ. Res., November 24, 2006; 99(11): 1159 - 1166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Marcucci, C. D. Baldus, A. S. Ruppert, M. D. Radmacher, K. Mrozek, S. P. Whitman, J. E. Kolitz, C. G. Edwards, J. W. Vardiman, B. L. Powell, et al. Overexpression of the ETS-Related Gene, ERG, Predicts a Worse Outcome in Acute Myeloid Leukemia With Normal Karyotype: A Cancer and Leukemia Group B Study J. Clin. Oncol., December 20, 2005; 23(36): 9234 - 9242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Rainis, T. Toki, J. E. Pimanda, E. Rosenthal, K. Machol, S. Strehl, B. Gottgens, E. Ito, and S. Izraeli The Proto-Oncogene ERG in Megakaryoblastic Leukemias Cancer Res., September 1, 2005; 65(17): 7596 - 7602. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-T. Huang, J. C. Mason, G. M. Birdsey, V. Amsellem, N. Gerwin, D. O. Haskard, A. J. Ridley, and A. M. Randi Endothelial intercellular adhesion molecule (ICAM)-2 regulates angiogenesis Blood, September 1, 2005; 106(5): 1636 - 1643. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. Hollenhorst, D. A. Jones, and B. J. Graves Expression profiles frame the promoter specificity dilemma of the ETS family of transcription factors Nucleic Acids Res., October 21, 2004; 32(18): 5693 - 5702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Galang, W. J. Muller, G. Foos, R. G. Oshima, and C. A. Hauser Changes in the Expression of Many Ets Family Transcription Factors and of Potential Target Genes in Normal Mammary Tissue and Tumors J. Biol. Chem., March 19, 2004; 279(12): 11281 - 11292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. W. Thompson, A. M. Randi, and A. J. Ridley Intercellular Adhesion Molecule (ICAM)-1, But Not ICAM-2, Activates RhoA and Stimulates c-fos and rhoA Transcription in Endothelial Cells J. Immunol., July 15, 2002; 169(2): 1007 - 1013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Gaspar, S. Thai, C. Voland, A. Dube, T. A. Libermann, M.L. Iruela-Arispe, and P. Oettgen Opposing Functions of the Ets Factors NERF and ELF-1 During Chicken Blood Vessel Development Arterioscler. Thromb. Vasc. Biol., July 1, 2002; 22(7): 1106 - 1112. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
B and AP-1.
lane). Sizes of the detected bands are reported on
the right.
