|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the University of Minnesota Cancer Center and the
Department of Laboratory Medicine and Pathology, University of
Minnesota, Minneapolis.
The most common chromosomal abnormality of infant acute
lymphoblastic leukemia (ALL) is the t(4;11)(q21;q23) that gives rise to
the MLL/AF4 fusion gene. Leukemic blasts expressing MLL/AF4 are arrested at an early progenitor stage with lymphoid or monocytoid characteristics. A novel B-lineage ALL cell line termed
B-lineage-3 (BLIN-3) requiring
human bone marrow (BM) stromal cell contact and interleukin-7 (IL-7)
for optimal proliferation has been established. BLIN-3 cells have a
CD19+/CD10 Mammalian B-cell development is characterized by
the ordered rearrangement of heavy- and light-chain immunoglobulin gene
segments that encode cell surface receptors critical for
antigen-independent and antigen-dependent development
(Rajewsky1 and references therein). The ordered stages of
immunoglobulin gene segment rearrangement occur in human B-lineage
progenitors at distinct levels of maturation (Bertrand et
al2 and and LeBien3 and references therein). CD34+/CD19 Human acute lymphoblastic leukemia (ALL) frequently involves clonal
expansion of a CD19+ B-lineage cell at one of several
stages of B-cell development.3,9,10 Infant acute leukemia
is a malignancy with distinct biologic and clinical features, and 60%
to 70% of patients harbor rearrangements of the mixed-lineage leukemia
(MLL) gene at 11q23.9-11 The ALL subtype of
infant acute leukemia frequently includes the t(4;11)(q21;q23) cytogenetic abnormality, characterized by expression of the MLL/AF4 fusion protein.9-11 MLL is a large protein (approximately
430 kd) with a complex domain structure that includes a DNA-binding AT
hook domain, a methyltransferase domain, and a trithorax
homology (SET) domain.12-14 Mice heterozygous for an
Mll null allele have defects in Hox gene
expression and have subtle homeotic malformations,15 consonant with the role of the homologous Drosophila protein
Trithorax in maintaining clustered homeotic gene expression. The AF4
protein contains nuclear localization and guanosine triphosphate
(GTP)-binding domains,16,17 but little is known about its
function. Homozygous disruption of the murine Af4 gene leads
to severe inhibition of thymocyte development and modest inhibition of
B-cell development.18 The MLL/AF4 fusion protein
invariably preserves the AT hook and methyltransferase MLL domains and
the GTP-binding and nuclear localization AF4 domains. The precise
functional role of MLL/AF4 in the oncogenesis of infant ALL
is unknown. However, studies with an MLL-lacZ fusion protein
have linked neoplastic transformation to aberrant activation of
MLL target genes, and they support a general
gain-of-function role for MLL independent of its fusion partner.19
Infant ALL leukemic cells generally express a
CD19+/CD10 We have previously established a human BM stromal cell-dependent
culture system for establishing pre-B ALL cell lines that retain the
ability to respond to BM stromal cell-derived signals.20 Using our human BM stromal cell culture system, we herein describe the
establishment and characterization of a new B-lineage ALL cell line
designated B-lineage-3 (BLIN-3).
Both the original BM leukemic blasts and the BLIN-3 cell line contain
the t(4;11)(q21;q23) cytogenetic abnormality. Remarkably, BLIN-3 cells
manifest a normal developmental program characterized by preservation
of the response to BM stromal cell-derived signals and IL-7, functional
immunoglobulin gene segment rearrangement, and acquisition of surface
expression of the µ- Cell culture and cell lines
BLIN-1 and BLIN-2 pre-B ALL cell lines were established in this
laboratory.20,23 The t(4;11) ALL cell lines
RS4;1124 and SEMK225 were kindly provided by
John H. Kersey (University of Minnesota Cancer Center). RAMOS and Daudi
B-lymphoma cell lines were obtained from the American Tissue Type
Culture Collection (Rockville, MD). With the exception of the BM
stromal cell-dependent BLIN-2 cell line, all cell lines were
maintained in standard suspension culture in RPMI-1640-10% fetal
bovine serum.
Flow cytometry
Western blot analysis of AF4 and MLL/AF4 protein expression Cells were lysed in RIPA buffer containing 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate (SDS). The following protease inhibitors were included: aprotinin (22 µg/mL), phenylmethylsulfonyl fluoride (1 µg/mL), iodoacetamide (0.01 µM), pepstatin A (1 µg/mL), and leupeptin (1 µg/mL). All protease inhibitors were purchased from Sigma Chemical (St Louis, MO). Eighty micrograms total cellular protein was electrophoresed in each lane of a 6% SDS-polyacrylamide gel electrophoresis (PAGE) gel with a 3% stacking gel, and then Western blot transfer to nitrocellulose membranes was performed. Membranes were blocked at 4°C overnight in 5% (wt/vol) nonfat milk dissolved in 1× TBST (50 mM Tris, 150 mM NaCl, 0.1% Tween-20). The blots were then incubated at room temperature with a mouse anti-human AF4 mAb (designated N5C) diluted in 5% milk-TBST. The anti-AF4 mAb was made by immunizing mice with a glutathione-S-transferase (GST)-AF4 fusion protein encompassing AF4 amino acids 507 to 607. The N5C anti-AF4 mAb recognizes AF4 and MLL/AF4 in Western blotting and exhibits a punctate nuclear staining previously observed with a rabbit anti-AF4 antiserum.26 The N5C mAb was a kind gift of Quanzhi Li and John H. Kersey (University of Minnesota Cancer Center). After a 45-minute wash in 1× TBST at room temperature, the membranes were incubated for 90 minutes at room temperature with a 1:5000 dilution of sheep anti-mouse IgG conjugated to horseradish peroxidase (Amersham Life Science, Arlington Heights, IL) in 1× TBST. Staining was revealed by chemiluminescence using SuperSignal Chemiluminescent Substrate (Pierce, Rockford, IL).Polymerase chain reaction assay for immunoglobulin gene segment rearrangement The polymerase chain reaction (PCR) assay for examining IgH gene segment rearrangement has been described.4 Briefly, cells were lysed directly in PCR buffer consisting of 10 mM Tris-HCl, pH 8.0, 1.5 mM MgCl2, 50 mM KCl, 0.45% NP-40, and 0.45% Tween-20 at a concentration of 1 × 104 cells/50 µL buffer. Samples were treated with 10 µg/mL proteinase K (Boehringer Mannheim, Indianapolis, IN) at 56°C for 1 hour, followed by heat inactivation at 90°C for 15 minutes. PCR reactions used 20 µM 5' and 3' primers, 10 mM dNTP, and 2.5 U Taq polymerase (Gibco-BRL, Gaithersburg, MD). Each PCR consisted of 30 cycles of denaturation at 95°C for 1 minute, annealing at 56°C for 1 minute, and extension at 72°C for 1 minute. A final extension for 7 minutes at 72°C was performed. PCR primer sequences used to detect DJ and VDJ rearrangements have been described.4,27-29Reverse transcription-polymerase chain reaction RNA isolation, cDNA synthesis, and reverse transcription-polymerase chain reaction (RT-PCR) were conducted as previously described.30 Annealing temperatures and cycle conditions for each primer pair were optimized such that the PCR was in the linear range of amplification. Amplification primers for recombination activating gene 1 (RAG-1), RAG-2, TdT, VH family specific primers, V , and C have been
published previously.4,27-29 Primers used to detect
expression of the MLL/AF4 fusion gene were MLL-E5'
(5'AAGCCCGTCGAGGAAAAG3') and AF4-D (5'CGTTCCTTGCTGAGAATTTG3'), as
described by van Dongen et al.31
Ten microliters each PCR product was separated on a 1.5% agarose gel and transferred to a Nytran membrane (Schleicher and Schuell, Keene, NH). After standard prehybridization, the blots were hybridized at 42°C with oligonucleotide probes labeled with digoxigenin (DIG) using the DIG oligonucleotide 3'-end labeling kit (Boehringer Mannheim) according to the manufacturer's instructions. After washing at 42°C, hybridization signals were revealed using the DIG luminescence detection kit for nucleic acids (Boehringer Mannheim) according to the manufacturer's instructions. Internal oligonucleotide probes used to detect specific amplified products have been reported.4,27-29 Cytogenetics Metaphase chromosomes were G-banded using Wright stain, as described.20
Establishment of the BLIN-3 cell line The regulation of leukemic cell survival and proliferation by the BM microenvironment are poorly understood. We have approached this problem by establishing B-lineage ALL cell lines that retain a dependency on normal human BM stromal cells for survival and proliferation.2,20 Using our previously described strategy,20 we now report the establishment and characterization of a new cell line designated BLIN-3. Cryopreserved leukemic blasts from a 3-month-old girl with t(4;11)(q21;q23) infant ALL were plated onto human BM stromal cells or the murine S17 stromal cell line,22 in the absence or presence of IL-7. Two weeks after initial plating, the S17 cultures showed little microscopic evidence of leukemic cell survival and were discarded. At the same time leukemic blasts plated onto human BM stromal cells alone showed no increase compared with input cell number, but BM stromal cell cultures supplemented with IL-7 supported a 3-fold increase in cell number (data not shown). The leukemic blasts could then be passaged onto fresh human BM stromal cells supplemented with IL-7. The cell line was designated BLIN-3 after successful passage. Early passages of BLIN-3 were CD10 /CD11b/CD15+/CD19+/CD20/CD21/CD22±/CD33/CD38+/CD40±
(Figure 1). BLIN-3 cells were bimodal for
CD34 expression (Figure 1), and CD34 expression was lost on prolonged
culture (data not shown). Early passages of BLIN-3 did not express
cytoplasmic or surface µ heavy chains and did not express the VpreB
subunit of the  light chain. Cytogenetic analysis revealed a
47,XX,+X, t(4;11)(q21;q23) karyotype, consistent with a classical
MLL/AF4 translocation.
BLIN-3 requires bone marrow stromal cell contact and IL-7 for optimal survival and proliferation Figure 2 shows the survival and proliferation characteristics of BLIN-3. BLIN-3 cells cultured in medium alone underwent a kinetically slow rate of cell death and were 95% to 99% dead by day 7. Inclusion of IL-7 slowed BLIN-3 cell death, suggesting that IL-7 transduced a survival signal. BLIN-3 cells survived in the presence of BM stromal cells but failed to undergo appreciable expansion. However, consistent with the conditions used to establish the cell line, the inclusion of IL-7 facilitated proliferative expansion of BLIN-3 cells on BM stromal cells. Thus, BLIN-3 cells have preserved a response to human BM stromal cells and IL-7 that is similar to the response of normal human pro-B cells.32
BLIN-3 cells acquire surface µ After approximately 5 months of continuous maintenance on BM stromal cells and IL-7, flow cytometric analysis revealed the emergence of surface µ+ cells in BLIN-3 cultures. Results in Figure 3 show that approximately 20% of BLIN-3 cells expressed surface µ heavy chain and the VpreB subunit of the light chain, indicating that µ heavy chains were expressed as
part of the pre-BCR on the surface of BLIN-3. The pre-BCR is only
expressed on the cell surface when assembled as a complex composed of
Ig , Ig , VpreB,  5, and µ.33-35 Thus, surface VpreB and surface µ expression (along with functional data presented below) are consistent with a structurally and functionally complete pre-BCR receptor complex on the surface of µ+
BLIN-3.
BLIN-3 cells express TdT, but not immunoglobulin light chains In general, pro-B cells express high levels of TdT protein, and detectable levels of TdT protein are dramatically reduced in the pre-B cell stage (LeBien3 and references therein). TdT expression, however, is often variable in B-lineage ALL cell lines. RT-PCR analysis and cytoplasmic staining revealed that both µ and µ+ BLIN-3 cultures express TdT
(Figure 4).
We next examined
Loss of DJ rearrangements and appearance of VDJ rearrangements To track the emergence of µ+ cells more thoroughly, cryopreservations of BLIN-3 were thawed, cultured for varying lengths of time on BM stromal cells and IL-7, and analyzed for surface µ expression. As shown in Figure 6, older cultures (BLIN-3A) contained a higher percentage of surface µ+ cells than earlier cultures (BLIN-3B or BLIN-3C). This suggested that surface µ+ BLIN-3 were emerging as a function of length of time in culture. Importantly, surface µ+ BLIN-3 cells also harbored a 47,XX,+X, t(4;11) (q21;q23) karyotype (data not shown).
The acquisition of surface µ and VpreB expression by BLIN-3 suggested
that BLIN-3 surface µ
We next examined VDJ transcription in BLIN-3 cells expressing various
levels of surface µ (Figure 9). The
transcription of multiple VH families by BLIN-3C and
BLIN-3B suggested a stochastic pattern of V to DJ rearrangement.
BLIN-3A, which contained the highest percentage of surface
µ+ cells (Figure 6), only expressed VH1 and
VH6 transcripts (Figure 9). Thus, the µ heavy-chain
protein expressed in BLIN-3A represented a productive rearrangement of
a VH1 or a VH6 family member, or both. These
findings are consistent with those of recent studies documenting
increased VH1 and VH6 family immunoglobulin
rearrangements in adult and childhood ALL.36
Cross-linking the pre-BCR on BLIN-3 promotes cell proliferation Pre-BCR signaling has been reported to influence positive selection, allelic exclusion, proliferation, differentiation, and VH-repertoire selection.33-35,37 To test whether the BLIN-3 pre-BCR is a functional complex capable of transducing a biologic signal, µ+ BLIN-3 cells were cross-linked with anti-µ heavy-chain mAb. As shown in Figure 10, cross-linking the BLIN-3 pre-BCR led to an increase in cell number when BLIN-3 was maintained on BM stromal cells, whereas control IgG1 and anti-major histocompatibility complex class I had no effect. Cross-linking the BLIN-3 pre-BCR in the absence of BM stromal cells had no effect on survival (data not shown). These results indicate that cross-linking the BLIN-3 pre-BCR transduces a signal that cooperates with BM stromal cells to promote the proliferation of BLIN-3.
BLIN-3 µ and BLIN-3
µ+ sublines were analyzed by RT-PCR for expression of
MLL/AF4 transcripts. As shown in Figure
11A, both the BLIN-3 µ
and µ+ cells expressed MLL/AF4 transcripts. BLIN-1 is a
pre-B ALL cell line that does not harbor the t(4;11)
translocation23 and was used as a control for the
specificity of the PCR primers. RS4;11 is a well-characterized,
MLL/AF4-bearing cell line24 that served as a positive
control. Whole-cell protein lysates from BLIN-3 µ and
µ+ cells were analyzed for the expression of AF4 protein
using a mouse anti-human AF4 mAb that recognized wild-type AF4 and the MLL/AF4 fusion protein. As shown in Figure 11B, surface
µ and surface µ+ BLIN-3 cells expressed
the MLL/AF4 fusion protein, similar to the previously characterized
MLL/AF4-bearing cell lines RS4;11 and SEMK2.26
Rearrangements involving the MLL gene occur in 60% to 70% of infant leukemias.9-11 Although MLL has more than 20 different fusion partners, infant ALL most often has the MLL/AF4 fusion gene.11 In contrast, the MLL/AF9 fusion gene is most often associated with acute myeloid leukemia.11 Recent studies have indicated that a truncated MLL fusion product (ie, MLL-lacZ) is sufficient to cause acute leukemia in chimeric mice.19 The specific MLL fusion partner might then confer some degree of lineage specificity in the development of leukemia. Infant ALL, with the t(4;11) translocation, often displays a
mixed-lineage phenotype characterized by coexpression of the B-lineage cell surface glycoprotein CD19 and myeloid-monocytoid gene
products such as myeloperoxidase.11 We herein report
the establishment of a novel t(4;11) cell line, BLIN-3, that expresses the MLL/AF4 fusion protein. BLIN-3 requires IL-7 and human BM stromal
cells for optimal proliferation (Figure 2). This is a stable
requirement of surface µ Stages of human B-lineage development have been historically defined on
the basis of immunoglobulin gene segment rearrangement and µ heavy-chain expression.38 As a population, pro-B cells predominately bear DJH rearrangements and lack µ heavy-chain expression. The µ The BM stromal cell culture system used to grow BLIN-3 is capable of
supporting the development of IgM+ B cells from
CD34+ stem cells.40 Hence, it is somewhat
surprising to us that we have not seen the emergence of surface
A review of the phenotypic and biologic characteristics of other t(4;11) cell lines24,41,42 and freshly isolated t(4;11) leukemic blasts43-50 indicates that BLIN-3 is unique in its retention of a "developmental program" that occurs in normal B-lineage cells. None of the established t(4;11) cell lines require human BM stromal cells for proliferation or undergo active V to DJ rearrangement, culminating in expression of the pre-BCR.24,41,42,51-53 Why is BLIN-3 unique? Leukemias with the t(4;11) translocation exhibit breakpoint heterogeneity.11,31 Breakpoints in the MLL gene generally cluster in a 6.5-kb region between exons 8 and 12, and breakpoints in the AF4 gene span a 40-kb region from exons 3 through 7. It is conceivable that some of the characteristics of BLIN-3 may be attributable to an MLL/AF4 fusion protein with unique functional characteristics. However, PCR analysis using primers that can distinguish between the possible MLL/AF4 fusion products31 indicated that BLIN-3 contains an MLL/AF4 fusion transcript similar (if not identical) to the one expressed in RS4;11 (Figure 6A). Moreover, no correlation between the presence of a specific MLL/AF4 fusion gene and the phenotypic characteristics of MLL/AF4+ leukemic blasts has been observed.54 At the time BLIN-3 was being established, we were unaware that the original BM leukemic blasts harbored the t(4;11) chromosomal abnormality. No attempt was made to establish a parallel leukemic cell line in the absence of BM stromal cells. It is unknown whether a cell line could have been established from this patient's leukemic blasts that would have resembled other t(4;11) cell lines characterized by resistance to stress-induced cell death.55 Our human BM stromal cell culture system has been successfully used to establish B-lineage ALL cell lines that retain a dependency on BM stromal cells for optimal proliferation20 and that support normal B-cell development from lymphohematopoietic stem cells.40,56 The BLIN-3 cell line was not selected for apoptotic resistance to growth factor withdrawal and BM stromal cell independent growth, which could potentially explain its unique growth factor requirements. The leukemogenic events that give rise to t(4;11) can be initiated in
utero.57 However, it is unclear whether MLL/AF4
alone is sufficient for the development of infant ALL or whether
other mutations are necessary. Clinical studies have not identified a
recurring chromosomal abnormality or mutation that cooperates with
MLL/AF4.44,48 In one study of 173 patients with MLL/AF4+ ALL, 30% harbored additional
chromosomal changes In conclusion, our data provide direct evidence that the expression of MLL/AF4 does not compromise the response of B-lineage cells to BM stromal cell-derived signals or their capacity to undergo V to DJ rearrangements and to express functional pre-BCR. These characteristics are in sharp contrast to the block in B-lineage differentiation that typifies infant ALL. Furthermore, recent studies60 in which the 3' portion of human AF4 has been knocked into the murine Mll locus have demonstrated an arrest in hematopoiesis in embryonic stem cells. These collective results suggest that the transcriptional effects of MLL/AF4 are cell-type dependent or are modified by other gene products.
We thank LeAnn Oseth and Betsy Hirsch (Cytogenetics Laboratory, University of Minnesota) for the cytogenetic analysis of BLIN-3. We appreciate the comments and critical input from John H. Kersey and David Largaespada (University of Minnesota Cancer Center), and we thank Sandi Sherman for assistance in preparation of the manuscript.
Submitted April 24, 2001; accepted July 24, 2001.
Supported by National Institutes of Health grants RO1 CA31685 and RO1 CA76055, the Graduate School of the University of Minnesota, the Minnesota Medical Foundation, and the Apogee Enterprises Professorship. F.E.B. is supported by The Chris P. Tkalcevic Foundation for Leukemia Research as a Special Fellow of the Leukemia and Lymphoma Society.
F.E.B. and C.V. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Fred E. Bertrand, University of Minnesota Cancer Center, Mayo Mail Code 806, 420 Delaware St SE, Minneapolis, MN 55455; e-mail: bertr010{at}tc.umn.edu.
1. Rajewsky K. Clonal selection and learning in the antibody system. Nature. 1996;381:751-758[CrossRef][Medline] [Order article via Infotrieve]. 2. Bertrand FE, Eckfeldt CE, Fink JR, et al. Microenvironmental influences on human B-cell development. Immunol Rev. 2000;175:175-186[CrossRef][Medline] [Order article via Infotrieve].
3.
LeBien TW.
Fates of human B-cell precursors.
Blood.
2000;96:9-23
4.
Bertrand FE, Billips LG, Burrows PD, Gartland GL, Kubagawa H, Schroeder HW.
Ig DH gene segment transcription and rearrangement before surface expression of the pan-B-cell marker CD19 in normal human bone marrow.
Blood.
1997;90:736-744
5.
Davi F, Faili A, Gritti C, et al.
Early onset of immunoglobulin heavy chain gene rearrangements in normal human bone marrow CD34+ cells.
Blood.
1997;90:4014-4021
6.
Dworzak MN, Fritsch G, Fröschl G, Printz D, Gadner H.
Four-color flow cytometric investigation of terminal deoxynucleotidyl transferase-positive lymphoid precursors in pediatric bone marrow: CD79a expression precedes CD19 in early B-cell ontogeny.
Blood.
1998;92:3203-3209
7.
Wang YH, Nomura J, Faye-Petersen OM, Cooper MD.
Surrogate light chain production during B cell differentiation: differential intracellular versus cell surface expression.
J Immunol.
1998;161:1132-1139
8.
Ghia P, ten Boekel E, Sanz E, de la Hera A, Rolink A, Melchers F.
Ordering of human bone marrow B lymphocyte precursors by single-cell polymerase chain reaction analyses of the rearrangement status of the immunoglobulin H and L chain gene loci.
J Exp Med.
1996;184:2217-2229
9.
Kersey JH.
Fifty years of studies of the biology and therapy of childhood leukemia.
Blood.
1997;90:4243-4251 10. Greaves M. Molecular genetics, natural history and the demise of childhood leukaemia. Eur J Cancer. 1999;35:173-185.
11.
Biondi A, Cimino G, Pieters R, Pui CH.
Biological and therapeutic aspects of infant leukemia.
Blood.
2000;96:24-33 12. Gu Y, Nakamura T, Alder H, et al. The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene. Cell. 1992;71:701-708[CrossRef][Medline] [Order article via Infotrieve]. 13. Tkachuk DC, Kohler S, Cleary ML. Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias. Cell. 1992;71:691-700[CrossRef][Medline] [Order article via Infotrieve]. 14. Djabali M, Selleri L, Parry P, Bower M, Young B, Evans GA. A trithorax-like gene is interrupted by chromosome 11q23 translocations in acute leukaemias [abstract]. Nat Genet. 1993;4:431[Medline] [Order article via Infotrieve]. 15. Yu BD, Hess JL, Horning SE, Brown GA, Korsmeyer SJ. Altered Hox expression and segmental identity in Mll-mutant mice. Nature. 1995;378:505-508[CrossRef][Medline] [Order article via Infotrieve].
16.
Nakamura T, Alder H, Gu Y, et al.
Genes on chromosomes 4, 9, and 19 involved in 11q23 abnormalities in acute leukemia share sequence homology and/or common motifs.
Proc Natl Acad Sci U S A.
1993;90:4631-4635
17.
Morissey J, Tkachuck DC, Milatovich A, Francke U, Link M, Cleary ML.
A serine-proline rich protein is fused to HRX in t(4;11) acute leukemias.
Blood.
1993;81:1124-1131
18.
Isnard P, Core N, Naquet P, Djabali M.
Altered lymphoid development in mice deficient for the mAF4 proto-oncogene.
Blood.
2000;96:705-710 19. Dobson CL, Warren AJ, Pannell R, Forster A, Rabbitts TH. Tumorigenesis in mice with a fusion of the leukaemia oncogene Mll and the bacterial lacZ gene. EMBO J. 2000;19:843-851[CrossRef][Medline] [Order article via Infotrieve].
20.
Shah N, Oseth L, LeBien TW.
Development of a model for evaluating the interaction between human pre-B acute lymphoblastic leukemic cells and the bone marrow stromal cell microenvironment.
Blood.
1998;92:3817-3828 21. Pribyl JAR, Shah N, Dittel BN, LeBien TW. In: Lefkovits I, ed. The Immunology Methods Manual. New York, NY: Academic Press; 1997:902-923. 22. Dorshkind K. In vitro differentiation of B lymphocytes from primitive hemopoietic precursors present in long-term bone marrow cultures. J Immunol. 1986;136:422-429[Abstract]. 23. Wormann B, Anderson JM, Liberty JA, et al. Establishment of a leukemic cell model for studying human pre-B to B cell differentiation. J Immunol. 1989;142:110-117[Abstract].
24.
Stong RC, Korsmeyer SJ, Parkin JL, Arthur DC, Kersey JH.
Human acute leukemia cell line with the t(4;11) chromosomal rearrangement exhibits B lineage and monocytic characteristics.
Blood.
1985;65:21-31 25. Pocock CF, Malone M, Booth M, et al. BCL-2 expression by leukaemic blasts in a SCID mouse model of biphenotypic leukaemia associated with the t(4;11)(q21;q23) translocation. Br J Haematol. 1995;90:855-867[Medline] [Order article via Infotrieve].
26.
Li Q, Frestedt JL, Kersey JH.
AF4 encodes a ubiquitous protein that in both native and MLL-AF4 fusion types localizes to subnuclear compartments.
Blood.
1998;92:3841-3847
27.
Shiokawa S, Mortari F, Lima JO, et al.
IgM heavy chain complementarity-determining region 3 diversity is constrained by genetic and somatic mechanisms until two months after birth.
J Immunol.
1999;162:6060-6070
28.
Billips LG, Nunez CA, Bertrand FE, et al.
Immunoglobulin recombinase gene activity is modulated reciprocally by interleukin 7 and CD19 in B cell progenitors.
J Exp Med.
1995;182:973-982
29.
Martin D, Huang RQ, LeBien T, Van Ness B.
Induced rearrangement of kappa genes in the BLIN-1 human pre-B cell line correlates with germline J-C kappa and V kappa transcription.
J Exp Med.
1991;173:639-645 30. Bertrand FE, Eckfeldt CE, Lysholm AS, LeBien TW. Notch-1 and Notch-2 exhibit unique patterns of expression in human B-lineage cells. Leukemia. 2000;14:2095-2102[CrossRef][Medline] [Order article via Infotrieve]. 31. van Dongen JJ, Macintyre EA, Gabert JA, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease: report of the BIOMED-1 Concerted Action investigation of minimal residual disease in acute leukemia. Leukemia. 1999;13:1901-1928[CrossRef][Medline] [Order article via Infotrieve]. 32. Dittel BN, LeBien TW. The growth response to IL-7 during normal human B cell ontogeny is restricted to B-lineage cells expressing CD34. J Immunol. 1995;154:58-67[Abstract]. 33. Brouns GS, de Vries E, van Noesel CJM, Mason DY, van Lier RAW, Borst J. The structure of the µ/pseudo light chain complex on human pre-B cells is consistent with a function in signal transduction. Eur J Immunol. 1993;23:1088-1097[Medline] [Order article via Infotrieve].
34.
Bossy D, Salamero J, Olive D, Fougereau M, Schiff C.
Structure, biosynthesis, and transduction properties of the µ-
35.
Lassoued K, Illges H, Benlagha K, Cooper MD.
Fates of surrogate light chains in B-lineage cells.
J Exp Med.
1996;183:421-429
36.
Mortuza FY, Moreira IM, Papaioannou M, et al.
Immunoglobulin heavy-chain gene rearrangement in adult lymphoblastic leukemia reveals preferential usage of JH-proximal variable region gene segments.
Blood.
2001;97:2716-2726 37. Meffre E, Casellas R, Nussenzweig MC. Antibody regulation of B cell development. Nat Immunol. 2000;1:379-385[CrossRef][Medline] [Order article via Infotrieve]. 38. Gathings WE, Lawton AR, Cooper MD. Immunofluorescent studies of the development of pre-B cells, B lymphocytes and immunoglobulin isotype diversity in humans. Eur J Immunol. 1977;7:804-810[Medline] [Order article via Infotrieve]. 39. Lassoued K, Nunez C, Billips L, et al. Expression of surrogate light chain receptors is restricted to a late stage in pre-B cell differentiation. Cell. 1993;73:73-86[CrossRef][Medline] [Order article via Infotrieve]. 40. Kurosaka D, LeBien TW, Pribyl JAR. Comparative studies of different stromal cell microenvironments in support of human B-cell development. Exp Hematol. 1999;27:1271-1281[CrossRef][Medline] [Order article via Infotrieve]. 41. Gobbi A, Di Berardino C, Scanziani E, et al. A human acute lymphoblastic leukemia line with the t(4;11) translocation as a model of minimal residual disease in SCID mice. Leuk Res. 1997;21:1107-1114[CrossRef][Medline] [Order article via Infotrieve]. 42. Inukai T, Sugita K, Iijima K, et al. Leukemic cells with 11q23 translocations express granulocyte colony-stimulating factor (G-CSF) receptor and their proliferation is stimulated with G-CSF. Leukemia. 1998;12:382-389[CrossRef][Medline] [Order article via Infotrieve].
43.
Parkin JL, Arthur DC, Abramson CS, et al.
Acute leukemia associated with the t(4;11) chromosome rearrangement: ultrastructural and immunologic characteristics.
Blood.
1982;60:1321-1331
44.
Crist WM, Cleary ML, Grossi CE, et al.
Acute leukemias associated with the 4;11 chromosome translocation have rearranged immunoglobulin heavy chain genes.
Blood.
1985;66:33-38
45.
Mirro J, Kitchingman G, Williams D, et al.
Clinical and laboratory characteristics of acute leukemia with the 4;11 translocation.
Blood.
1986;67:689-697 46. Hagemeijer A, van Dongen JJ, Slater RM, et al. Characterization of the blast cells in acute leukemia with translocation (4;11): report of eight additional cases and of one case with a variant translocation. Leukemia. 1987;1:24-31[Medline] [Order article via Infotrieve]. 47. Ludwig WD, Bartram CR, Harbott J, et al. Phenotypic and genotypic heterogeneity in infant acute leukemia, I: acute lymphoblastic leukemia. Leukemia. 1989;3:431-439[Medline] [Order article via Infotrieve].
48.
Pui CH, Frankel LS, Carroll AJ, et al.
Clinical characteristics and treatment outcome of childhood acute lymphoblastic leukemia with the t(4;11)(q21;q23): a collaborative study of 40 cases.
Blood.
1991;77:440-447 49. Secker-Walker LM, Craig JM, Hawkins JM, Hoffbrand AV. Philadelphia positive acute lymphoblastic leukemia in adults: age distribution, BCR breakpoint and prognostic significance. Leukemia. 1991;5:196-199[Medline] [Order article via Infotrieve]. 50. Schardt C, Ottmann OG, Hoelzer D, Ganser A. Acute lymphoblastic leukemia with the (4;11) translocation: combined cytogenetic, immunological and molecular genetic analyses. Leukemia. 1992;6:370-374[Medline] [Order article via Infotrieve]. 51. Santoli D, Yang YC, Clark SC, Kreider BL, Caracciolo D, Rovera G. Synergistic and antagonistic effects of recombinant human interleukin (IL) 3, IL-1 alpha, granulocyte and macrophage colony-stimulating factors (G-CSF and M-CSF) on the growth of GM-CSF-dependent leukemic cell lines. J Immunol. 1987;139:3348-3354[Abstract].
52.
Cohen A, Grunberger T, Vanek W, et al.
Constitutive expression and role in growth regulation of interleukin-1 and multiple cytokine receptors in a biphenotypic leukemic cell line.
Blood.
1991;78:94-102 53. Greil J, Gramatzki M, Burger R, et al. The acute lymphoblastic leukaemia cell line SEM with t(4;11) chromosomal rearrangement is biphenotypic and responsive to interleukin- 7. Br J Haematol. 1994;86:275-283[Medline] [Order article via Infotrieve].
54.
Johansson B, Moorman AV, Haas OA, et al.
Hematologic malignancies with t(4;11)(q21;q23) 55. Kersey JH, Wang D, Oberto M. Resistance of t(4;11) (MLL-AF4 fusion gene) leukemias to stress-induced cell death: possible mechanism for extensive extramedullary accumulation of cells and poor prognosis. Leukemia. 1998;12:1561-1564[CrossRef][Medline] [Order article via Infotrieve].
56.
Pribyl JA, LeBien TW.
Interleukin 7 independent development of human B cells.
Proc Natl Acad Sci U S A.
1996;93:10348-10353 57. Ford AM, Ridge SA, Cabrera ME, et al. In utero rearrangements in the trithorax-related oncogene in infant leukaemias. Nature. 1993;363:357-360. 58. Cimino G, Lanza C, Elia L, et al. Multigenetic lesions in infant acute leukaemias: correlations with ALL-1 gene status. Br J Haematol. 1997;96:308-313[CrossRef][Medline] [Order article via Infotrieve]. 59. Dimartino JF, Cleary ML. Mll rearrangements in haematological malignancies: lessons from clinical and biological studies. Br J Haematol. 1999;106:614-626[CrossRef][Medline] [Order article via Infotrieve]. 60. Liu B, Li Q, Kersey JH. Inhibition of hematopoietic differentiation by the MLL-AF-4 oncogene [abstract]. Blood. 2000;94:56.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. Miremadi, M. Z. Oestergaard, P. D.P. Pharoah, and C. Caldas Cancer genetics of epigenetic genes Hum. Mol. Genet., April 15, 2007; 16(R1): R28 - R49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Attarbaschi, G. Mann, M. Konig, M. Steiner, S. Strehl, A. Schreiberhuber, B. Schneider, C. Meyer, R. Marschalek, A. Borkhardt, et al. Mixed Lineage Leukemia-Rearranged Childhood Pro-B and CD10-Negative Pre-B Acute Lymphoblastic Leukemia Constitute a Distinct Clinical Entity. Clin. Cancer Res., May 15, 2006; 12(10): 2988 - 2994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Gleissner, N. Goekbuget, H. Rieder, R. Arnold, S. Schwartz, H. Diedrich, C. Schoch, B. Heinze, C. Fonatsch, C. R. Bartram, et al. CD10- pre-B acute lymphoblastic leukemia (ALL) is a distinct high-risk subgroup of adult ALL associated with a high frequency of MLL aberrations: results of the German Multicenter Trials for Adult ALL (GMALL) Blood, December 15, 2005; 106(13): 4054 - 4056. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Johnson, N. Shah, A. Panoskaltsis-Mortari, and T. W. LeBien Murine and Human IL-7 Activate STAT5 and Induce Proliferation of Normal Human Pro-B Cells J. Immunol., December 1, 2005; 175(11): 7325 - 7331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Shah, R. J. Asch, A. S. Lysholm, and T. W. LeBien Enhancement of stress-induced apoptosis in B-lineage cells by caspase-9 inhibitor Blood, November 1, 2004; 104(9): 2873 - 2878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Wang, Z. Zhang, P. D. Burrows, H. Kubagawa, S. L. Bridges Jr, H. W. Findley, and M. D. Cooper V(D)J recombinatorial repertoire diversification during intraclonal pro-B to B-cell differentiation Blood, February 1, 2003; 101(3): 1030 - 1037. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
light chain on BLIN-3 after at least 20 weeks of continuous
culture.
, no reverse
transcriptase. (B) Analysis of TdT protein expression in
µ
consensus primer and a C
an X chromosome gain and trisomy 8 were the most
common.