SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Melendez, A. J. Articles by Allen, J. M. Search for Related Content PubMed PubMed Citation Articles by Melendez, A. J. Articles by Allen, J. M. Related Collections Phagocytes Signal Transduction Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 1 December 2001, Vol. 98, No. 12, pp. 3421-3428 PHAGOCYTES Functional coupling of FcRI to nicotinamide adenine dinucleotide phosphate (reduced form) oxidative burst and immune complex trafficking requires the activation of phospholipase D1 Alirio J. Melendez, Luce Bruetschy, R. Andres Floto, Margaret M. Harnett, and Janet M. Allen From the Department of Molecular and Cellular Biology, Pfizer Global Research and Development, Fresnes, France; the Department of Medicine, Imperial College School of Medicine, London, United Kingdom; and the Department of Immunology, the Department of Medicine and Therapeutics, and the Division of Biochemistry and Molecular Biology, University of Glasgow, Scotland.     Abstract Top Abstract Introduction Materials and methods Results Discussion References Immunoglobulin G (IgG) receptors (FcRs) on myeloid cells are responsible for the internalization of immune complexes. Activation of the oxidase burst is an important component of the integrated cellular response mediated by Fc receptors. Previous work has demonstrated that, in interferon--primed U937 cells, the high-affinity receptor for IgG, FcRI, is coupled to a novel intracellular signaling pathway that involves the sequential activation of phospholipase D (PLD), sphingosine kinase, and calcium transients. Here, it is shown that both known PLD isozymes, PLD1 and PLD2, were present in these cells. With the use of antisense oligonucleotides to specifically reduce the expression of either isozyme, PLD1, but not PLD2, was found to be coupled to FcRI activation and be required to mediate receptor activation of sphingosine kinase and calcium transients. In addition, coupling of FcRI to activation of the nicotinamide adenine dinucleotide phosphate (reduced form) (NADPH) oxidase burst was inhibited by pretreating cells with 0.3% butan-1-ol, indicating an absolute requirement for PLD. Furthermore, use of antisense oligonucleotides to reduce expression of PLD1 or PLD2 demonstrated that PLD1 is required to couple FcRI to the activation of NADPH oxidase and trafficking of internalized immune complexes for degradation. These studies demonstrate the critical role of PLD1 in the intracellular signaling cascades initiated by FcRI and its functional role in coordinating the response to antigen-antibody complexes. (Blood. 2001;98:3421-3428) © 2001 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References Receptors for the constant region (Fc) of immunoglobulins play a pivotal role linking the humoral and cellular arms of the immune system. On leukocytes, aggregation of receptors (FcRs) for immunoglobulin G (IgG) leads to a number of cellular responses, including the internalization of immune complexes, release of proteases, activation of the respiratory burst, and release of cytokines. Receptor aggregation can ultimately lead to targeted cell killing through antibody-directed cellular cytotoxicity.1,2 These Fc receptors, therefore, play critical roles in host defense mechanisms against invading pathogens, in autoimmune diseases,3 and in cancer surveillance.4 We have recently reported that, in cytokine-primed U937 cells, aggregation of the high-affinity receptor for IgG (FcRI)5 activates, through nonreceptor tyrosine kinases, a novel signaling pathway that involves the sequential activation of phospholipase D (PLD) and sphingosine kinase.6 This pathway is necessary for efficient intracellular trafficking of FcRI-internalized immune complexes to lysosomes for degradation and release of calcium from intracellular stores.6,7 Phosphatidylcholine-specific PLD (PC-PLD) catalyzes the hydrolysis of the terminal diester bond of phosphatidylcholine to liberate phosphatidic acid and choline.8 PC-PLD was first identified in plants but has subsequently been shown to be highly conserved across all species and present in large amounts in bacteria, yeast, and mammalian cells.9,10 In mammalian cells, activation of PC-PLD has been proposed to control signal transduction pathways regulating a wide range of physiological processes, including membrane trafficking and cytoskeletal reorganization,11-17 mitogenesis,18,19 neuronal and cardiac stimulation,20,21 phagocytosis,22 the respiratory burst in neutrophils,23,24 inflammation, and diabetes.25 The immediate products of PLD hydrolysis of phosphatidylcholine are phosphatidic acid and choline.8 A role for phosphatidic acid as a key intracellular signaling molecule has been proposed as it has been shown to directly activate protein kinases,18,19,26,27 protein tyrosine phosphatase,28-30 phospholipase C,31 phosphoinositol-4-kinase,32 sphingosine kinase,33 and small molecular weight guanosine triphosphatase-activating proteins.34 Phosphatidic acid has also been shown to promote the release of calcium from intracellular compartments35,36 and, in neutrophils, to activate the oxidative burst through nicotinamide adenine dinucleotide phosphate (reduced form) (NADPH) oxidase.24,27 Phosphatidic acid itself can also act as a precursor for other intracellular signaling molecules. Thus, phosphatidic acid can be converted into diacyl glycerol (DAG) by phosphatidic acid-phosphohydrolase10,23 or to the mitogen lyso-phosphatidic acid (LPA) by phospholipase A2.10,23 DAG is an established activator of conventional and novel protein kinase C (PKC) isoforms37,38 and LPA, which, following release from cells, acts on G-protein-coupled receptors to further stimulate cells or adjacent cells.39 Phosphatidic acid can also be subject to acid hydrolases followed by lipo-oxygenase, leading to the formation of oxygen radicals and lipid peroxides that cause tissue damage.40 In mammalian cells, 2 isoforms of PLD (PLD1 and PLD2) have been cloned, sequenced, and characterized.17,41,42 Furthermore, PLD1 is expressed as 2 splice variants, namely, PLD1a and PLD1b.43 Both PLD1 and PLD2 use phosphatidylcholine as substrate. In previous studies, we have shown that coupling of FcRI to PLD activation results in activation of sphingosine kinase6,7 and calcium transients. However, in these previous studies, the nature of the PLD isozyme activated by FcRI was not defined, and the relationship of the activation of PLD to the various signaling enzyme cascades following FcRI aggregation was unknown. Here, we demonstrate that coupling of FcRI to NADPH oxidase has an absolute requirement on the activation of PLD. Although both isozymes of PLD (PLD1 and PLD2) are present in U937 cells, only PLD1, but not PLD2, functionally couples FcRI to intracellular effectors, such as the activation of sphingosine kinase and cytosolic calcium transients. PLD1, but not PLD2, is also required for FcRI-mediated activation of the oxidative burst and trafficking of immune complexes.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Cell culture U937 cells were cultured in RPMI 1640 (Gibco, Rockville, MD) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 10 U/mL penicillin, and 10 µg/mL streptomycin at 37°C in 6.8% carbon dioxide in a water-saturated atmosphere. The cells were treated with interferon (IFN)- (200 ng/mL) (Bender Wien, Vienna, Austria) for 16 hours. Antisense oligonucleotides were purchased from Oswell DNA Service (Southampton, United Kingdom); 24-mers were synthesized and capped at either end by the phosphothiorate linkages (first 2 and last 2 linkages); these 24-mers corresponded to the reverse complement of the first 8 amino acids for either PLD1 or PLD2. The sequences of the oligonucleotides were as follows: 5'CCGTGGCTCGTTTTTCAGTGACAT3' for PLD1 and 5'GAGGCTCTCAGGGGTCGCCGTCAT3' for PLD2. Cells were incubated in 10 µM oligonucleotide for a total of 36 hours (20 hours prior to, and then for the duration of culture with IFN-). Reverse-transcriptase-polymerase chain reaction Cells were either primed with IFN- or differentiated to a macrophage phenotype with dibutyryl cyclic adenosine monophosphate (dbcAMP)6 and messenger RNA (mRNA)-isolated (Quiagen midi kit for mRNA extraction). Specific forward and reverse primers were designed for either PLD1 or PLD2: PLD1 forward, GTGGGCTCACCATGAGAAGC; PLD1 reverse, GCAATGTCATGCCAGGGCATC; PLD2 forward, CTGCACTTTACTTACAGGACCCTG; and PLD2 reverse, CTGCTCATAGATATTGGCGTTGC. The PLD1 primers were designed against an overlapping region in the sequence of both PLD1 isoforms to yield a fragment of approximate 640 base pairs (bp) for PLD1a and another fragment of approximate 520 bp for PLD1b.43 Specific primers designed for PLD2 would yield a 450-bp fragment. The reaction was carried out as described previously.43 Receptor aggregation Cells were harvested by centrifugation and then incubated at 4°C for 45 minutes with 1 µM human monomeric IgG (Serotec, Oxford, United Kingdom) to occupy surface FcRI in the presence or absence of inhibitors or alcohols. Excess unbound ligand was removed by dilution and centrifugation of the cells. Cells were resuspended in ice-cold RPMI 1640/10 mM Hepes/0.1% bovine serum albumin (BSA) (RHB medium), and surface immune complexes were formed by incubating with cross-linking antibody (sheep antihuman IgG; 1:50) in the continued presence of inhibitors or alcohols. Cells were then warmed to 37°C for the times specified in each assay as described previously.44,45 Immunoprecipitation of PLDs PLD1 and PLD2 were immunoprecipitated from cell lysates prior to Western blot analysis of the desired proteins. Rabbit polyclonal antibody (2 µg), either anti-PLD1 or anti-PLD2 (QCB, Hopkinton, MA), were incubated with 50 µL 50% protein A-agarose and 450 µL buffer for 2 hours on a rocking platform at 4°C in order to form precipitating complexes. Then, the antibody-protein A-agarose mix was washed to remove unbound antibody. Following this, 500 µL cell lysate containing 200 µg protein was mixed with the precipitating (antibody-protein A-agarose) complex and placed in a tumbler at 4°C for 4 hours. Following incubation, the precipitating complex was centrifuged and washed prior to addition of Laemlli buffer for loading onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Gel electrophoresis and Western blots Proteins were resolved on 8% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45-µm nitrocellulose membranes. After blocking overnight at 4°C with 5% nonfat milk in Tris-buffered saline and 0.1% Tween 20 and washing, the membranes were incubated with the relevant antibodies for 4 hours at room temperature. The membranes were washed extensively in the washing buffer and bands visualized by means of the appropriate horseradish peroxidase-conjugated secondary antibody and ECL Western Blotting Detection System (Amersham, Buckinghamshire, United Kingdom). Measurement of phospholipase D activity PLD activity was measured as previously described in Melendez et al,7 by means of the transphosphatidylation assay. Briefly, U937 cells were labeled (106 cells/mL) with [3H] palmitic acid (5 µCi/mL [185 kBq/mL]) (Amersham) in the cell culture medium for 16 hours. Following washing, the cells were incubated at 37°C for 15 minutes in RHB medium containing butan-1-ol (0.3% final). Following FcRI aggregation, cells were incubated for a further 30 minutes and then extracted by Bligh-Dyer phase separation. The accumulated phosphatidylbutanol was assayed as described previously.7 Measurement of rate of trafficking of immune complexes Trafficking of immune complexes was measured with a protocol similar to that used in previous studies.44,45 FcRI was aggregated as described above, but surface immune complexes were formed by using radiolabeled cross-linking antibody ([125I]-rabbit antihuman IgG; 1:50) (R&D Systems, Abington, United Kingdom). Supernatant trichloroacetic acid (TCA)-soluble counts were measured to provide the rate of intracellular trafficking.45,46 The results were expressed as a percentage of the total cell surface counts at time zero. Oxidase assays Whole cell superoxide production following FcRI aggregation or N-formyl-1-methionyl-1-leucyl-1-phenylalamine (f-MLP) stimulation was measured in IFN--primed U937 cells, pretreated or not with butan-1-ol, butan-2-ol, or antisense oligonucleotides for PLD1 or PLD2. Cells were assayed in RPMI-1% FCS without phenol red placed in a 96-well plate. For each well, 200 000 cells suspended in 80 µL were mixed with 20 µL luminol-based substrate (Diogenes, National Diagnostics, Atlanta, GA) at the same time as the cross-linking antibody, or f-MLP (1 µM). Luminescence was measured with a luminometer (Wallac 1420 Multilabel counter, Cambridge, United Kingdom). Cytosolic calcium assays Cytosolic calcium was measured as described previously except the cuvette buffer was calcium supplemented (final concentration, 1.5 mM Ca++).7 Briefly, cells were loaded with 1 µg/mL Fura-2-AM (Molecular Probes, Leiden, The Netherlands) and 1 µM human monomeric IgG (Serotec) in phosphate-buffered saline (PBS), 1.5 mM Ca++, and 1% BSA. After removal of excess reagents by dilution and centrifugation, the cells were resuspended in 1.5 mM calcium-supplemented PBS and warmed to 37°C in the cuvette. Cell surface-bound IgG was aggregated by the addition of goat anti-human IgG (1:50 dilution) (Sigma, Poole, United Kingdom). Fluorescence was measured at 340 and 380 nm, and the background-corrected 340:380 ratio was calibrated as previously described.6 Sphingosine kinase assays Activation of sphingosine kinase was measured as described previously.7,33 Briefly, cells were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4) containing 20% glycerol, 1 mM mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCL2, 1 mM sodium orthovanadate, and 15 mM sodium fluoride), protease inhibitors (10 µg/mL leupeptin, 10 µg/mL aprotinin, and 1 mM phenylmethyl sulfonyl fluoride), and 0.5 mM 4-deoxypyridoxine, disrupted by freeze-thawing and centrifuged at 105 000g for 90 minutes at 4°C. Supernatants were assayed for sphingosine kinase activity by incubating with sphingosine (Sigma) and [32P]-adenosine triphosphate (2 µCi, 5 mM [74 kBq]) for 30 minutes at 37°C, and products were separated by thin-layer chromatography on silica gel G60 (Whatman, Maidstone, United Kingdom) by means of chloroform/methanol/acetic acid/water (90:90:15:6) and visualized by autoradiography. The radioactive spots corresponding to sphingosine phosphate were scraped and counted in a scintillation counter. The activity of sphingosine kinase following in vitro activation by phosphatidic acid was measured in cell lysates by addition of L--phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) (Sigma Aldrich, Paris, France) at 10 mol 1% Triton X-100.     Results Top Abstract Introduction Materials and methods Results Discussion References Both PLD1 and PLD2 are expressed in U937 cells, but only PLD1 is coupled to FcRI activation PLD expression profiles in the human monocytic cell line U937. The isozymes of PLD expressed in U937 cells were determined by means of reverse-transcriptase-polymerase chain reaction (RT-PCR), Northern analysis, and Western analysis. Relative levels of expression were compared in untreated cells, cytokine (IFN-)-primed cells, and cells differentiated to a macrophage phenotype by means of dbcAMP.47 RT-PCR analysis of mRNAs extracted from untreated, IFN--primed or dbcAMP-differentiated cells revealed that both known PLD isozymes, PLD1 and PLD2, were present. In addition, both splice variants of PLD1 (PLD1a and PLD1b) were present.43 The profile of the RT-PCR products was not altered by treating cells with IFN- or following differentiation (Figure 1A). At the protein level, Western blot analysis of immunoprecipitated PLDs revealed immunoreactive bands corresponding to the predicted molecular weights for PLD1a, PLD1b, and PLD2. The PLD expression profile did not alter following priming of cells with IFN- or cell differentiation by dbcAMP (Figure 1B). View larger version (53K): [in this window] [in a new window]   Figure 1. PLD expression profiles in U937 cells. (A) RT-PCR was performed with mRNA extracted from untreated, IFN--primed and dbcAMP-differentiated U937 cells. Specific primers for PLD1 (which yield 2 fragments corresponding to PLD1a, 640bp, and PLD1b, 520bp) and primers specific for PLD2 amplifying a 450-bp fragment, were used. The results shown are typical from 3 separate experiments. (B) Western blot analysis of immunoprecipitates of PLD1 or PLD2, from cell lysates from untreated, IFN--primed and dbcAMP-differentiated U937 cells, were resolved by SDS/PAGE 8% polyacrylamide gels. Proteins were transferred to nitrocellulose and probed with anti-PLD1 or anti-PLD2 antibodies. The results shown are typical from 3 separate experiments. Mw indicates molecular weight. FcRI aggregation stimulates PLD1. As both isozymes for PLD are expressed in U937 cells, experiments were performed to examine their respective roles, in particular, their activities following FcRI aggregation. For this purpose, specific antisense oligonucleotides were designed against each of the PLD isozymes to specifically knock down the expression of each enzyme (ie, antisense to PLD1 and antisense to PLD2). We have previously shown that U937 cells are sensitive to antisense manipulation.6,48 IFN--primed cells were treated with 1 of the 2 antisense oligonucleotides, and PLD activity was assayed in unstimulated cells to measure basal levels of activity or after stimulation with either FcRI activation by immune complexes or with phorbolmyristate acetate (PMA) treatment (PMA was used as control). The specificity of the antisense oligonucleotides on relative PLD isozyme expression was checked by Western analysis (Figure 2A). Thus, in cells treated with antisense to PLD1, there was a reduction in PLD1 immunoreactivity whereas PLD2 immunoreactivity was unaffected. Conversely, in cells treated with antisense to PLD2, there was a reduction in PLD2 immunoreactivity whereas PLD1 immunoreactivity remained unchanged. Each antisense oligonucleotide, therefore, acted as an internal control for the other. View larger version (37K): [in this window] [in a new window]   Figure 2. Use of antisense oligonucleotides to reduce specific expression of either PLD1 or PLD2 demonstrates that only PLD1 is coupled to FcRI aggregation. (A) Western blot analysis of immunoprecipitates of either PLD1 or PLD2 to assess expression of either isozyme in IFN--primed U937 cells following treatment for 36 hours with antisense oligonucleotides (10 µM) specific for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2), and control cells (control). The results shown are typical from 3 separate experiments. (B) PLD activity following FcRI aggregation in IFN--primed U937 cells pretreated with 10 µM antisense oligonucleotides for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. FcRI aggregation (XL control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. FcRI aggregation in cells pretreated with antisense PLD1 (XL a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. FcRI aggregation in cells pretreated with antisense PLD2 (XL a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from 3 separate experiments. PtdBut indicates phosphatidylbutanol. (C) PLD activity following PMA stimulation (1 µM) in IFN--primed U937 cells pretreated with antisense oligonucleotides (10 µM) for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. PMA stimulation (PMA control); 3. basal level in cells pretreated with antisense PLD1 (basal a.s.PLD1); 4. PMA stimulation in cells pretreated with antisense PLD1 (PMA a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2); 6. PMA stimulation in cells pretreated with antisense PLD2 (PMA a.s.PLD2). Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments. Tot. indicates total. Treatment of cells with the antisense oligonucleotide to PLD1 resulted in no change in basal activity. However, following aggregation of FcRI, the increase in PLD activity was significantly reduced compared with the control cells (P < .01) (Figure 2B). The reduction in the increase after FcRI activation was 77% ± 8% in cells treated with antisense PLD1 compared with control cells and was proportional to the observed reduction in protein expression by Western analysis. In contrast, treatment of cells with the antisense oligonucleotide to PLD2 significantly reduced basal PLD activity (P < .01). FcRI-mediated activation of PLD was marginally reduced in cells treated with the antisense to PLD2, but this reduction was entirely accounted for by the reduction in basal levels; the increment over the basal level was identical in control (untreated) cells and those pretreated with PLD2 antisense oligonucleotide (Figure 2B). In contrast to PLD activation by FcRI, PLD activity stimulated by PMA was significantly reduced in cells pretreated with either of the 2 antisense oligonucleotides, indicating that PMA is able to stimulate both forms of PLD (Figure 2C). Thus, PMA-stimulated PLD activity was reduced by 50% ± 5% in cells pretreated with PLD1 antisense and by 33% ± 5% in cells pretreated with PLD2 antisense. A combination of treatment with both antisense oligonucleotides (PLD1 and PLD2) proved toxic to the cells. These data demonstrate that PLD2 contributes to the basal, unstimulated PLD activity in these cells, whereas PLD1, but not PLD2, is coupled to FcRI activation. PLD1 but not PLD2 is required to couple FcRI to intracellular signaling cascades As the coupling of FcRI to sphingosine kinase6 and cytosolic calcium transients6,7 requires PLD activation, the nature of the isozyme involved in this coupling was investigated by means of antisense oligonucleotides to specifically downregulate either PLD1 or PLD2. Previously, we have shown that aggregation of FcRI in cytokine-primed cells results in PLD-dependent release of calcium from intracellular stores and subsequent cytosolic calcium transients.7 Here, the specific dependence for this response on PLD1 and not PLD2 is shown. Reduction in expression of PLD1 by pretreatment of cells with antisense PLD1 oligonucleotide resulted in an attenuation of peak cytosolic calcium spike observed after aggregation of FcRI (Figure 3A). Reducing expression of PLD2 had no effect on the calcium transients compared with controls. View larger version (23K): [in this window] [in a new window]   Figure 3. Coupling of FcRI to downstream intracellular signaling pathways requires PLD1 and not PLD2. (A) Intracellular cytosolic calcium changes following aggregation of FcRI. Responses were compared in control cells and cells pretreated with antisense oligonucleotides (10 µM) to either PLD1 or PLD2. Traces shown are as follows: left, XL FcRI control cells = FcRI aggregation in IFN--primed control cells; upper right panel, FcRI aggregation in IFN--primed cells pretreated with antisense to PLD1 (XL FcRI a.s.PLD1); lower right panel, FcRI aggregation in IFN--primed cells pretreated with antisense to PLD2 (XL FcRI a.s.PLD2). The arrow marks the addition of the goat antihuman IgG antibody to create cell surface immune complexes. Traces are typical from fura-2-loaded cells from 3 separate experiments. (B) FcRI coupling to sphingosine kinase. Following aggregation of FcRI in IFN--primed U937 cells, cells were harvested at given time points to measure sphingosine kinase activity. Sphingosine kinase activity was assayed from basal control cells (basal control); following FcRI aggregation in control cells (XL control) and in cells pretreated with antisense oligonucleotides (10 µM) for either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Lysates from these cells were treated with phosphatidic acid (L--phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) in vitro to ensure sphingosine kinase activity (P.A.a.s.PLD1 and P.A.a.s.PLD2).33 Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments. Previous studies have shown that sphingosine kinase is activated by FcRI aggregation in cytokine-primed U937 cells and that PLD activation is necessary for coupling the receptor to this kinase.7 Pretreating cells with the antisense oligonucleotide to PLD1 to knock down isozyme expression significantly reduced the peak activation of sphingosine kinase following aggregation of FcRI in IFN--primed cells by 70% ± 6% (P < .01). The reduction in the peak activation was proportional to the loss of PLD enzyme expressed in these cells as assessed by Western analysis. Reduction in expression of PLD2 had no effect on the ability of FcRI to couple to sphingosine kinase activation. To ensure that the loss of sphingosine kinase activity after FcRI activation in cells treated with the antisense oligonucleotide to PLD1 was a feature of the loss of coupling of the receptor and not some direct effect of the PLD1 antisense oligonucleotide on sphingosine kinase, enzyme activity was measured in lysates following activation of sphingosine kinase with exogenous phosphatidic acid (L--phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate). Addition of phosphatidic acid to the cell lysates from control cells or cells treated with either antisense PLD1 or antisense PLD2 resulted in an identical increase in sphingosine kinase activity (Figure 3B). These data indicate that the reduction in sphingosine kinase activity following FcRI activation resulting from PLD1 antisense reflects blockage of this pathway and uncoupling of FcRI to sphingosine kinase activation (Figure 3B). Thus, in keeping with the observed coupling of FcRI to PLD1 but not PLD2, receptor-mediated activation of sphingosine kinase and cytosolic calcium transients were found to be attenuated in cells following the specific downregulation of PLD1. PLD1 but not PLD2 functionally couples FcRI to intracellular effectors FcRI is functionally coupled to NADPH oxidase through PLD activation. Fc receptors are coupled to the oxidative burst, and activation of NADPH oxidase is an important functional consequence of aggregation of these receptors by opsonized particles or immune complexes to assist in destruction of pathogens.49,50 Here, we show an absolute requirement for PLD in the coupling of FcRI aggregation to the activation of NADPH oxidase in IFN--primed U937 cells. Thus, formation of surface immune complexes and warming to 37°C result in a transient activation of NADPH oxidase as measured by the oxidative burst (Figure 4A). Pretreatment of cells with 0.3% butan-1-ol completely abolished this response whereas pretreatment with 0.3% butan-2-ol had no effect and cells demonstrated a normal response (Figure 4A). Butan-1-ol but not butan-2-ol can act as an acceptor for the phosphatidyl moiety, thereby generating phosphatidylbutanol instead of phosphatidic acid.7 As butan-2-ol cannot act as an acceptor, it serves as a control for nonspecific effects of the alcohol. This absolute dependence on PLD activation was not observed for other receptors known to be coupled to NADPH oxidase in these cells. Thus, f-MLP also initiates an oxidase burst in these cells. However, in contrast to FcRI, pretreatment of cells with 0.3% butan-1-ol decreased the oxidase burst activated by f-MLP by only about 50% (Figure 4B). Again, 0.3% butan-2-ol was without effect on this response. View larger version (22K): [in this window] [in a new window]   Figure 4. NADPH oxidase activity stimulated by FcRI aggregation. NADPH oxidase activity stimulated by FcRI aggregation has an absolute dependence on PLD. (A) FcRI-mediated activation of the oxidase burst in control cells (XL control) or cells pretreated for 20 minutes with either 0.3% butan-1-ol (XL but-1-ol) or 0.3% butan-2-ol (XL but-2-ol). The results shown are typical from 3 separate experiments. RLU = relative luminescence units. (B) Activation of oxidase by 1 µM f-MLP stimulation (fMLP control) in control cells and in cells pretreated for 20 minutes with either 0.3% butan-1-ol (fMLP but-1-ol) or 0.3% butan-2-ol (fMLP but-2-ol). The results shown are typical of 3 separate experiments. RLU = relative luminescence units. PLD1 and not PLD2 couples FcRI to the activation of NADPH oxidase. A role for PLD1 but not PLD2 in mediating the activation of NADPH oxidase by FcRI was demonstrated. Treatment of IFN--primed U937 cells with the antisense oligonucleotide to PLD1 to specifically knock down expression of this isozyme resulted in an attenuation of the activation of NADPH oxidase by FcRI aggregation (peak activity, approximately 30% of control) (Figure 5A). Similar treatment of cells with the antisense oligonucleotide to PLD2 did not alter FcRI activation of NADPH oxidase compared with control cells despite decreasing PLD2 expression (Figure 5A). Treatment of cells with either antisense oligonucleotide (PLD1 or PLD2) did not alter the response of NADPH oxidase to activation by the low-affinity IgG receptor FcRIIa, which has previously been shown to be coupled to phospholipase C and is independent of PLD activation (Figure 5B).6 View larger version (20K): [in this window] [in a new window]   Figure 5. FcRI-mediated activation of NADPH oxidase. FcRI-mediated activation of NADPH oxidase is dependent on PLD1 and not PLD2. (A) Superoxide production in response to FcRI in control cells (XL control) compared with cells pretreated with antisense oligonucleotide (10 µM) to either PLD1 (XL a.s.PLD1) or PLD2 (a.s.PLD2). The trace results shown are typical from 3 separate experiments. (B) Superoxide production in response to FcRIIa in control cells (XL FcRIIa control) compared with cells pretreated with antisense (10 µM) to PLD1 (FcRIIa a.s.PLD1) or PLD2 (FcRIIa a.s.PL2). FcRIIa was specifically aggregated by means of an anti-FcRII-specific monoclonal antibody.7 The trace results shown are typical from 3 separate experiments. PLD1 is necessary for trafficking of immune complexes for degradation. Formation of surface immune complexes on myeloid cells results in their rapid internalization44 and trafficking to lysosomes for degradation.45 We have previously shown that endocytosis (the initial internalization of immune complexes to early endosomes) mediated by FcRI is independent of PLD activation but that subsequent intracellular trafficking of immune complexes is significantly delayed in cells treated with 0.3% butan-1-ol.7 Here, using antisense oligonucleotides to downregulate either PLD1 or PLD2, we demonstrate that FcRI is functionally coupled to PLD1 and not PLD2 to mediate the intracellular trafficking of immune complexes. Trafficking of immune complexes to lysosomes for degradation can be readily monitored by means of radiolabeled immune complexes and the appearance of TCA-soluble counts in the cells over time.46 Following FcRI aggregation in cytokine-primed U937 cells, almost 50% of the initial radiolabel internalized as immune complexes appears as TCA-soluble counts in the supernatant of these cells after 120 minutes' incubation at 37°C.7,47 Consistent with previous findings that PLD activation is not necessary for the initial endocytosis of immune complexes mediated by FcRI,44 downregulation of either PLD1 or PLD2 by pretreating cells with either antisense oligonucleotide did not alter the rate of initial endocytosis of radiolabeled immune complexes (data not shown). However, pretreatment of cells with the antisense PLD1 oligonucleotide significantly changed the rate of appearance of TCA-soluble counts in the supernatant of the cells whereas pretreatment with antisense PLD2 did not. In control and antisense PLD2-treated cells, 50% ± 2% and 49 ± 2% of the initial internalized counts appeared in the supernatant in the TCA-soluble fraction after 120 minutes' incubation whereas for cells treated with antisense PLD1, only 24% ± 1% of counts appeared in this fraction (Figure 6). These data demonstrate that PLD1 but not PLD2 activation is required to mediate the trafficking of FcRI-internalized immune complexes in U937 cells. View larger version (21K): [in this window] [in a new window]   Figure 6. Effect of PLD1 on coupling of FcRI to trafficking of immune complexes. PLD1 functionally couples FcRI to trafficking of immune complexes. Trafficking of radiolabeled immune complexes is monitored by the appearance of TCA-soluble counts in cell supernatants. Following aggregation of FcRI, radiolabeled surface-bound counts are rapidly internalized. During 120 minutes incubation, appearance of radiolabel in the supernatant as TCA-soluble counts (XL control) is compared between control cells and cells pretreated with antisense oligonucleotides (10 µM) to either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Results shown for each time point are the counts in the incubation supernatant soluble in TCA expressed as a percentage of the total counts bound at time zero. Results are the mean ± SD for triplicate measurements and are representative of the results from at least 3 separate experiments.     Discussion Top Abstract Introduction Materials and methods Results Discussion References In this study, we have shown that FcRI is functionally coupled to PLD1 but not PLD2 in IFN--primed U937 cells even though both enzymes are expressed in these cells. Further, we show that PLD1 but not PLD2 is required for FcRI-mediated activation of the NADPH oxidase burst and intracellular trafficking of immune complexes for degradation. Two forms of PLD have been characterized in mammalian cells, and PLD1 exists as a number of splice variants although the significance of these is not known. Here we show that both isozymes are expressed in U937 cells and that priming with IFN- or differentiation with dbcAMP did not significantly alter the expression levels of the 2 enzymes. Specific roles for the 2 enzymes, PLD1 and PLD2, are unclear. Cell lines appear to differ in their expression of the different isozymes.51 Thus, a number of cell lines have been reported to express both isozymes although some cells appear to express one isozyme or the other exclusively. Thus, Jurkat cells only express PLD2 whereas 2 human monoblastic cell types, THP1 and HL60, express predominantly PLD1 in resting state; this contrasts with our report here for U937, cells which are also monoblastic in nature. The expression of PLD1 and PLD2 in U937 cells appeared to be relatively stable. Neither mRNA nor protein levels were altered by priming with IFN- or differentiation with dbcAMP. This contrasts with observations made for HL60 cells, where differentiation to a neutrophil phenotype with dbcAMP over 3 days resulted in the upregulation of PLD1 and a 20-fold induction of PLD2.52 In these cells, despite the large increase in PLD2 expression, the coupling of f-MLP to the oxidase burst correlated with PLD1 not PLD2 in these differentiated cells.53 In vitro studies have shown that the activity of these 2 enzymes is regulated differently. Both PLD1 and PLD2 have an absolute requirement for phosphatidylinositol(4,5)P2 (PIP2) for activation.41,42 Activity of PLD1 has been shown to be stimulated in vitro by 3 additional factors; adenosine diphosphate-ribosylation factor (ARF), Rho, and PKC54 through protein-protein interactions. In contrast, PLD2 is insensitive to these 3 factors and, in the absence of other factors apart from PIP2, PLD2 is very active.17 Consistent with these in vitro observations, our data here indicate that, within the intact U937 cell, PLD2 contributes to the basal activity of PLD whereas PLD1 is coupled to cell activation through FcRI aggregation by immune complexes. Recent data studying PLD1 activation in intact cells suggest that mechanisms similar to those observed in vitro may occur within cells55,56 although there is a growing body of evidence that ARF6, not ARF1, is responsible for coupling receptors to PLD activation.20,57-59 Our recent studies have demonstrated a role for ARF6 and PKC in coupling FcRI to the activation of PLD1 through protein-protein interactions.59 Although FcRI is coupled to signaling cascades through the activation of tyrosine kinases, tyrosine phosphorylation of PLD1 is not thought to play a role in regulating the enzyme.9,10 Consistent with the finding that FcRI specifically activates PLD1 and not PLD2, antisense knock-down experiments demonstrated a specific role for PLD1 and not PLD2 in coupling this receptor to sphingosine kinase activation and calcium transients. The immediate product of PLD is phosphatidic acid, and this has been shown in vitro to directly activate sphingosine kinase.33 Furthermore, here we demonstrate that PLD1 but not PLD2 is required for the functional coupling of FcRI to cellular effectors, such as NADPH oxidase activation and intracellular vesicular trafficking of immune complexes from endosomes to lysosomes for degradation. High local production of phosphatidic acid has been proposed to alter membrane properties and facilitate membrane fusion and budding events,13,60 which are important in vesicular trafficking within the cell. Recent work has demonstrated that phagocytosis, which similarly depends on membrane fusion events and vesicular trafficking, is dependent on PLD activation.24 The regulation of assembly of the subunits of NADPH oxidase to form active enzyme and the subsequent oxidase burst is complex. Here, we demonstrate a surprising absolute requirement on PLD activity for the coupling of FcRI to NADPH oxidase activation. Thus, treatment of cells with butan-1-ol completely abolished the oxidase burst in response to FcRI aggregation by immune complexes. By contrast, the oxidase burst in response to f-MLP was reduced by only about 50%. Receptor-coupled activation of oxidase assembly is regulated through the phosphorylation of the p47phox component, and PKCs are widely recognized as playing a major role in this phosphorylation event.61 Previous work has shown that, in these IFN--primed U937 cells, the PKC isozymes , , and  are activated by FcRI62 and, surprisingly, all PKC activity lies downstream of PLD activation.59 Thus, PLD may couple FcRI to NADPH oxidase through the activation of these PKC isozymes. However, there is also growing evidence that phosphatidic acid can itself activate NADPH oxidase through both kinase-dependent and kinase-independent mechanisms. Thus, data have implied that a phosphatidic acid-dependent kinase is able to phosphorylate p47phox and p22phox to regulate NADPH oxidase assembly.63,64 In addition, recent data using a cell-free system revealed that phosphatidic acid and diacyl glycerol were able to activate NADPH oxidase in a kinase-independent manner.65 Our findings that PLD1-mediated generation of phosphatidic acid drives these monocyte biological responses demonstrates the pivotal role of PLD1 in the intracellular signaling cascades initiated by FcRI and in the functional coupling of this receptor to provide a coordinated response that can ultimately lead to targeted cell killing through antibody-directed cellular cytotoxicity, an important host defense mechanism to combat invading pathogens and important in cancer surveillance.     Acknowledgments We thank Drs Andrew Morris and Michael Frohman, Department of Pharmacology, State University of New York, for helpful advice in discussions of material in this manuscript.     Footnotes Submitted April 11, 2001; accepted July 23, 2001. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Janet M. Allen, Inpharmatica, 60 Charlotte Street, London WIT 2NU, England, United Kingdom; e-mail: janet.allen{at}inpharmatica.co.uk.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Graziano RF, Fanger MW. FcRI and FcRII on monocytes and granulocytes are cytotoxic trigger molecules for tumor cells. J Immunol. 1987;139:3536-3541[Abstract]. 2. Fanger MW, Shen L, Graziano RF, Guyre PM. Cytotoxicity mediated by human Fc receptors for IgG. Immunol Today. 1989;10:92-99[CrossRef][Medline] [Order article via Infotrieve]. 3. Hulett MD, Hogarth PM. Molecular basis of Fc receptor function. Adv Immunol. 1994;57:1-127[Medline] [Order article via Infotrieve]. 4. Ely P, Wallace PK, Givan AL, Guyre PM, Fanger MW. Bispecific-armed, interferon gamma-primed macrophage-mediated phagocytosis of malignant non-Hodgkin's lymphoma. Blood. 1996;86:3813-3821. 5. Allen JM, Seed B. Isolation and expression of functional high-affinity Fc receptor complementary DNAs. Science. 1989;243:378-381[Abstract/Free Full Text]. 6. Melendez A, Floto RA, Gillooly DJ, Harnett MM, Allen JM. FcRI coupling to phospholipase D initiates sphingosine kinase-mediated calcium mobilization and vesicular trafficking. J Biol Chem. 1998;273:9393-9402[Abstract/Free Full Text]. 7. Melendez A, Floto RA, Cameron AJ, Gillooly DJ, Harnett MM, Allen JM. A molecular switch changes the signalling pathway used by the FcRI antibody receptor to mobilise calcium. Curr Biol. 1998;8:210-221[CrossRef][Medline] [Order article via Infotrieve]. 8. Exton JH. Phosphatidylcholine breakdown and signal transduction. Biochim Biophys Acta. 1994;1212:26-42[Medline] [Order article via Infotrieve]. 9. Morris AJ, Engebrecht J, Frohman MA. Structure and regulation of phospholipase D. Trends Pharm Sci. 1996;17:182-185[CrossRef][Medline] [Order article via Infotrieve]. 10. Exton JH. Phospholipase D: enzymology, mechanisms of regulation, and function. Physiol Rev. 1997;77:303-320[Abstract/Free Full Text]. 11. Ktistakis NT, Brown HA, Waters MG, Sternweis PC, Roth MG. Evidence that phospholipase D mediates ADP ribosilation factor-dependent formation of Golgi coated vesicles. J Cell Biol. 1996;134:295-306[Abstract/Free Full Text]. 12. Morgan CP, Sengelov H, Whatmore J, Borregaard N, Cockcroft S. ADP-ribosylation-factor-regulated phospholipase D activity localizes to secretory vesicles and mobilizes to the plasma membrane following N-formylmethionyl-leucyl-phenylalanine stimulation of human neutrophils. Biochem J. 1997;325:581-585. 13. Siddhanta A, Shields D. Secretory vesicle budding from the trans-Golgi network is mediated by phosphatidic acid levels. J Biol Chem. 1998;273:17995-17998[Abstract/Free Full Text]. 14. Brown FD, Thomson N, Saqib KM, et al. Phospholipase D1 localises to secretory granules and lysosomes and is plasma-membrane translocated on cellular stimulation. Curr Biol. 1998;8:835-838[CrossRef][Medline] [Order article via Infotrieve]. 15. Arneson LS, Kunz J, Anderson RA, Traub LM. Coupled inositide phosphorylation and phospholipase D activation initiates clathrin-coat assembly on lysosomes. J Biol Chem. 1999;274:17794-17805[Abstract/Free Full Text]. 16. Cross MJ, Roberts S, Ridley AJ, et al. Stimulation of actin stress fibre formation mediated by activation of phospholipase D. Curr Biol. 1996;6:588-597[CrossRef][Medline] [Order article via Infotrieve]. 17. Colley WT, Sung TC, Roll R, et al. Phospholipase D2, a PLD1-related isoform with novel regulatory properties and discrete subcellular localization that provokes cytoskeletal reorganization. Curr Biol. 1997;7:191-201[CrossRef][Medline] [Order article via Infotrieve]. 18. Ghosh S, Strum JC, Sciorra VA, Daniel L, Bell RM. Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid: phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells. J Biol Chem. 1996;271:8472-8480[Abstract/Free Full Text]. 19. Rizzo MA, Shome K, Vasudevan C, et al. Phospholipase D and its product, phosphatidic acid, mediate agonist-dependent raf-1 translocation to the plasma membrane and the activation of the mitogen-activated protein kinase pathway. J Biol Chem. 1999;174:1131-1139. 20. Caumont A-S, Galas M-C, Vitale N, Aunis D, Bader M-F. Regulated exocytosis in chromaffin cells: translocation of ARF6 stimulates a plasma membrane-associated phospholipase D. J Biol Chem. 1998;273:1373-1379[Abstract/Free Full Text]. 21. Dhalla NS, Xu Y-J, Sheu S-S, Tappia PS, Panagia V. Phosphatidic acid: a potential signal transducer for cardiac hypertrophy. J Mol Cell Cardiol. 1997;29:2865-2871[CrossRef][Medline] [Order article via Infotrieve]. 22. Kusner DJ, Hall CF, Jackson S. Fc receptor-mediated activation of phospholipase D regulates macrophage phagocytosis of IgG-opsonized particles. J Immunol. 1999;162:2266-2274[Abstract/Free Full Text]. 23. English D, Cui Y, Sidiqui RA. Messenger functions of phosphatidic acid. Chem Phys Lipids. 1996;80:117-132[CrossRef][Medline] [Order article via Infotrieve]. 24. Olson SC, Lambeth JD. Biochemistry and cell biology of phospholipase D in human neutrophils. Chem Phys Lipids. 1996;80:3-19[CrossRef][Medline] [Order article via Infotrieve]. 25. Ortmeyer Y, Mohsenin V. Inhibition of phospholipase D and superoxide generation by glucose in diabetic neutrophils. Life Sci. 1996;59:255-262[CrossRef][Medline] [Order article via Infotrieve]. 26. Bocckine SB, Wilson PB, Exton JH. Phosphatidate-dependent protein phosphorylation. Proc Natl Acad Sci U S A. 1991;88:6210-6213[Abstract/Free Full Text]. 27. Waite KA, Wallin R, Qualliotine-Mann D, McPhail LC. Phosphatidic acid-mediated phosphorylation of the NADPH oxidase component p47-phox. J Biol Chem. 1997;272:15569-15578[Abstract/Free Full Text]. 28. Zhao Z, Shen SH, Fischer EH. Stimulation by phospholipids of a protein-tyrosine-phosphatase containing two src homology 2 domains. Proc Natl Acad Sci U S A. 1993;90:4251-4255[Abstract/Free Full Text]. 29. Cui Y, English K. Phosphatidic acid-mediated regulation of neutrophil plasma membrane CD45-phosphotyrosine phosphatase. Cell Signal. 1997;9:257-263[CrossRef][Medline] [Order article via Infotrieve]. 30. Kishikawa K, Chalfant CE, Perry DK, Bielawska A, Hannun YA. Phosphatidic acid is a potent and selective inhibitor of protein phosphatase 1 and an inhibitor of ceramide-mediated responses. J Biol Chem. 1999;274:21335-21341[Abstract/Free Full Text]. 31. Jackowski S, Rock CO. Stimulation of phosphatidylinositol-4,5-bisphosphate phospholipase C activity by phosphatidic acid. Arch Biochem Biophys. 1989;268:516-524[CrossRef][Medline] [Order article via Infotrieve]. 32. Moritz A, Graan PND, Gispen WH, Wirtz KW. Phosphatidic acid is a specific activator of phosphatidylinositol-4-phosphate kinase. J Biol Chem. 1992;267:7207-7210[Abstract/Free Full Text]. 33. Olivera A, Rosenthal J, Spiegel S. Effect of acidic phospholipids on sphingosine kinase. J Cell Biochem. 1996;60:529-537[CrossRef][Medline] [Order article via Infotrieve]. 34. Tsai MH, Yu CL, Wei FS, Stacey DW. The effect of GTPase activating protein upon ras is inhibited by mitogenically responsive lipids. Science. 1989;243:522-526[Abstract/Free Full Text]. 35. Limas CJ. Phosphatidate releases calcium from cardiac sarcoplasmic reticulum. Biochem Biophys Res Commun. 1980;95:541-546[CrossRef][Medline] [Order article via Infotrieve]. 36. Xu YJ, Panagia V, Shao Q, Wang X, Dhalla NS. Phosphatidic acid increases intracellular free calcium and cardiac contractile force. Am J Physiol. 1996;271:H651-H659[Abstract/Free Full Text]. 37. Nishizuka Y. The molecular heterogeneity of protein kinase C. Science. 1988;334:661-663. 38. Hug H, Sarre TF. Protein kinase C isoenzymes: divergence in signal transduction? Biochem J. 1993;291:329-334. 39. Guo Z, Liliom K, Fischer DJ, et al. Molecular cloning of a high-affinity receptor for the growth factor-like lipid mediator lysophosphatidic acid from Xenopus oocytes. Proc Natl Acad Sci U S A. 1996;93:14367-14372[Abstract/Free Full Text]. 40. Ryu SB, Wang X. Activation of phospholipase D and the possible mechanism of activation in wound-induced lipid hydrolysis in castor bean leaves. Biochim Biophys Acta. 1996;1303:243-250[Medline] [Order article via Infotrieve]. 41. Hammond SM, Altshuller YM, Sung T-C, et al. Human ADP-ribosylation factor-activated phosphatidylcholine-specific phospholipase D defines a new and highly conserved gene family. J Biol Chem. 1995;270:29640-29643[Abstract/Free Full Text]. 42. Lopez I, Arnold RS, Lambeth JD. Cloning and initial characterization of a human phospholipase D2 (hPLD2). J Biol Chem. 1998;273:12846-12852[Abstract/Free Full Text]. 43. Hammond SM, Jenco JM, Nakashima S, et al. Characterization of two alternatively spliced forms of phospholipase D1. J Biol Chem. 1997;272:3860-3868[Abstract/Free Full Text]. 44. Harrison PT, Davis W, Norman JC, Hockaday A, Allen JM. Binding of monomeric IgG triggers FcRI-mediated endocytosis. J Biol Chem. 1994;269:24396-24400[Abstract/Free Full Text]. 45. Norman JC, Harrison PT, Davis W, Floto RA, Allen JM. Lysosomal routing of FcRI from early endosomes requires recruitment of tyrosine kinases. Immunology. 1998;94:48-55[CrossRef][Medline] [Order article via Infotrieve]. 46. Miettinen HM, Rose JK, Mellman I. Fc receptor isoforms exhibit distinct abilities for coated pit localization as a result of cytoplasmic domain heterogeneity. Cell. 1989;58:317-327[CrossRef][Medline] [Order article via Infotrieve]. 47. Sheth B, Dransfield I, Partridge LJ, Barker MD, Burton DR. Dibutyryl cyclic AMP stimulation of a monocytic cell line, U937: a model for monocyte chemotaxis and Fc receptor-related functions. Immunology. 1988;63:483-490[Medline] [Order article via Infotrieve]. 48. Melendez AJ, Gillooly DJ, Harnett MM, Allen JM. Aggregation of the human high affinity immunoglobulin G receptor (FcRI) activates both tyrosine kinase and G protein-coupled phosphoinositide 3-kinase isoforms. Proc Natl Acad Sci U S A. 1998;95:2169-2174[Abstract/Free Full Text]. 49. Pfefferkorn LC, Fanger MW. Transient activation of the NADPH oxidase through FcRI: oxidase deactivation precedes internalization of cross-linked receptors. J Immunol. 1989;143:2640-2649[Abstract]. 50. Pound JD, Lund J, Jefferis R. Human FcRI triggering of the mononuclear phagocyte respiratory burst. Mol Immunol. 1993;30:469-478[CrossRef][Medline] [Order article via Infotrieve]. 51. Gibbs TC, Meier KE. Expression and regulation of phospholipase D isoforms in mammalian cell lines. J Cell Physiol. 2000;182:77-87[CrossRef][Medline] [Order article via Infotrieve]. 52. Nakashima S, Ohguchi K, Frohman MA, Nozawa Y. Increased mRNA expression of phospholipase D (PLD) isozymes during granulocytic differentiation of HL60 cells. Biochim Biophys Acta. 1998;1389:173-177[Medline] [Order article via Infotrieve] 53. Meier KE, Gibbs TC, Knoepp SM, Ella KM. Expression of phospholipase D isoforms in mammalian cells. Biochim Biophys Acta. 1999;1439:199-213[Medline] [Order article via Infotrieve]. 54. Sung T-C, Zhang Y, Morris AJ, Frohman MA. Structural analysis of human phospholipase D1. J Biol Chem. 1999;274:3659-3666[Abstract/Free Full Text]. 55. Zhang Y, Altshuller YM, Hammond SM, Morris AJ, Frohman MA. Loss of receptor regulation by a phospholipase D1 mutant inresponsive to protein kinase C. EMBO J. 1999;18:6339-6348[CrossRef][Medline] [Order article via Infotrieve]. 56. Meacci E, Vasta V, Moorman JP, et al. Effect of Rho and ADP-ribosylation factor GTPases on phospholipase D activity in intact human adenocarcinoma A549 cells. J Biol Chem. 1999;274:18605-18612[Abstract/Free Full Text]. 57. Le Stunff H, Dokhac L, Bourgoin S, Bader MF, Harbon S. Phospholipase D in rat myometrium: occurrence of a membrane-bound ARF6 (ADP-ribosylation factor 6)-regulated activity controlled by betagamma subunits of heterotrimeric G-proteins. Biochem J. 2000;352:491-499. 58. Dana RR, Eigesti C, Holmes KL, Leto TL. A regulatory role for ADP-ribosylation factor 6 (ARF6) in activation of the phagocyte NADPH oxidase. J Biol Chem. 2000;275:32566-32571[Abstract/Free Full Text]. 59. Melendez AJ, Harnett MM, Allen JM. Crosstalk between ARF6 and protein kinase C alpha in FcRI-mediated activation of phospholipase D1. Curr Biol. 2001;11:869-874[CrossRef][Medline] [Order article via Infotrieve]. 60. Rudge SA, Morris AJ, Engebrecht J. Relocalization of phospholipase D activity mediates membrane formation during meiosis. J Cell Biol. 1998;140:81-90[Abstract/Free Full Text]. 61. El Benna J, Faust RP, Johnson JL, Babior BM. Phosphorylation of the respiratory burst oxidase subunit p47phos as determined by two-dimensional phosphopeptide mapping: phosphorylation by protein kinase C, protein kinase A, and a mitogen activated protein kinase. J Biol Chem. 1996;271:6374-6378[Abstract/Free Full Text]. 62. Melendez AJ, Harnett MM, Allen JM. Differentiation-dependent switch in protein kinase C isoenzyme activation by FcRI, the human high-affinity receptor for immunoglobulin G. Immunology. 1999;96:457-464[CrossRef][Medline] [Order article via Infotrieve]. 63. Waite KA, Wallin R, Qualliotine-Mann D, McPhail LC. Phosphatidic acid-mediated phosphorylation of the NADPH oxidase component p47-phox: evidence that phosphatidic acid may activate a novel protein kinase. J Biol Chem. 1997;272:15569-15578. 64. Regier DS, Waite KA, Wallin R, McPhail LC. A phosphatidic-acid protein kinase and conventional protein kinase C isoforms phosphorylate p22phox, an NADPH oxidase component. J Biol Chem. 1999;274:36601-36608[Abstract/Free Full Text]. 65. Palicz A, Foubert TR, Jesaitis AJ, Marodi L, McPhail LC. Phosphatidic acid and diacylglycerol directly activate NADPH oxidase by interacting with enzyme components. J Biol Chem. 2001;276:3090-3097[Abstract/Free Full Text]. © 2001 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: X. Dai, M. Jayapal, H. K. Tay, R. Reghunathan, G. Lin, C. T. Too, Y. T. Lim, S. H. Chan, D. M. Kemeny, R. A. Floto, et al. Differential signal transduction, membrane trafficking, and immune effector functions mediated by Fc{gamma}RI versus Fc{gamma}RIIa Blood, July 9, 2009; 114(2): 318 - 327. [Abstract] [Full Text] [PDF] P. N. Pushparaj, H. K. Tay, S. C. H'ng, N. Pitman, D. Xu, A. McKenzie, F. Y. Liew, and A. J. Melendez The cytokine interleukin-33 mediates anaphylactic shock PNAS, June 16, 2009; 106(24): 9773 - 9778. [Abstract] [Full Text] [PDF] S. Sethu, G. Mendez-Corao, and A. J. Melendez Phospholipase D1 Plays a Key Role in TNF-{alpha} Signaling J. Immunol., May 1, 2008; 180(9): 6027 - 6034. [Abstract] [Full Text] [PDF] J. Gomez-Cambronero, M. Di Fulvio, and K. Knapek Understanding phospholipase D (PLD) using leukocytes: PLD involvement in cell adhesion and chemotaxis J. Leukoc. Biol., August 1, 2007; 82(2): 272 - 281. [Abstract] [Full Text] [PDF] T. Hitomi, J. Zhang, L. M. Nicoletti, A. C. G. Grodzki, M. C. Jamur, C. Oliver, and R. P. Siraganian Phospholipase D1 regulates high-affinity IgE receptor-induced mast cell degranulation Blood, December 15, 2004; 104(13): 4122 - 4128. [Abstract] [Full Text] [PDF] J. M. Beekman, J. E. Bakema, J. van der Linden, B. Tops, M. Hinten, M. van Vugt, J. G. J. van de Winkel, and J. H. W. Leusen Modulation of Fc{gamma}RI (CD64) Ligand Binding by Blocking Peptides of Periplakin J. Biol. Chem., August 6, 2004; 279(32): 33875 - 33881. [Abstract] [Full Text] [PDF] K. H. Han, K.-H. Hong, J.-H. Park, J. Ko, D.-H. Kang, K.-J. Choi, M.-K. Hong, S.-W. Park, and S.-J. Park C-Reactive Protein Promotes Monocyte Chemoattractant Protein-1--Mediated Chemotaxis Through Upregulating CC Chemokine Receptor 2 Expression in Human Monocytes Circulation, June 1, 2004; 109(21): 2566 - 2571. [Abstract] [Full Text] [PDF] H. K. Tay and A. J. Melendez Fc{gamma}RI-triggered Generation of Arachidonic Acid and Eicosanoids Requires iPLA2 but Not cPLA2 in Human Monocytic Cells J. Biol. Chem., May 21, 2004; 279(21): 22505 - 22513. [Abstract] [Full Text] [PDF] F. A. J. van de Loo, M. B. Bennink, O. J. Arntz, R. L. Smeets, E. Lubberts, L. A. B. Joosten, P. L. E. M. van Lent, C. J. J. Coenen-de Roo, S. Cuzzocrea, B. H. Segal, et al. Deficiency of NADPH Oxidase Components p47phox and gp91phox Caused Granulomatous Synovitis and Increased Connective Tissue Destruction in Experimental Arthritis Models Am. J. Pathol., October 1, 2003; 163(4): 1525 - 1537. [Abstract] [Full Text] [PDF] B. J. PETTUS, J. BIELAWSKI, A. M. PORCELLI, D. L. REAMES, K. R. JOHNSON, J. MORROW, C. E. CHALFANT, L. M. OBEID, and Y. A. HANNUN The sphingosine kinase 1/sphingosine-1-phosphate pathway mediates COX-2 induction and PGE2 production in response to TNF-{alpha} FASEB J, August 1, 2003; 17(11): 1411 - 1421. [Abstract] [Full Text] [PDF] A. C. MacKinnon, A. Buckley, E. R. Chilvers, A. G. Rossi, C. Haslett, and T. Sethi Sphingosine Kinase: A Point of Convergence in the Action of Diverse Neutrophil Priming Agents J. Immunol., December 1, 2002; 169(11): 6394 - 6400. [Abstract] [Full Text] [PDF] A. J. Melendez and A. K. Khaw Dichotomy of Ca2+ Signals Triggered by Different Phospholipid Pathways in Antigen Stimulation of Human Mast Cells J. Biol. Chem., May 3, 2002; 277(19): 17255 - 17262. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Melendez, A. J. Articles by Allen, J. M. Search for Related Content PubMed PubMed Citation Articles by Melendez, A. J. Articles by Allen, J. M. Related Collections Phagocytes Signal Transduction Social Bookmarking                   What's this?

	Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020