| |
|
|
|
|
|
|
|||
|
PLENARY PAPER
From the Fred Hutchinson Cancer Research Center and
University of Washington, Seattle, WA; and Vaccine Research Center,
National Institute of Allergy and Infectious Diseases, and Department
of Experimental Transplantation and Immunology, Medicine Branch,
National Cancer Institute, National Institutes of Health, Bethesda, MD.
The duration of immunodeficiency following marrow transplantation
is not known. Questionnaires were used to study the infection rates in
72 patients surviving 20 to 30 years after marrow grafting. Furthermore, in 33 of the 72 patients and in 16 donors (siblings who
originally donated the marrow) leukocyte subsets were assessed by flow
cytometry. T-cell receptor excision circles (TRECs), markers of T cells
generated de novo, were quantitated by real-time polymerase chain
reaction. Immunoglobulin G2 (IgG2) and
antigen-specific IgG levels were determined by enzyme-linked
immunosorbent assay. Infections diagnosed 15 years after
transplantation occurred rarely. The average rate was 0.07 infections per patient-year (one infection every 14 years), excluding
respiratory tract infections, gastroenteritis, lip sores, and hepatitis
C. The counts of circulating monocytes, natural killer cells, B cells,
CD4 T cells, and CD8 T cells in the patients were not lower than in the
donors. The counts of TREC+ CD4 T cells in transplant
recipients younger than age 18 years (at the time of transplantation)
were not different from the counts in their donors. In contrast, the
counts of TREC+ CD4 T cells were lower in transplant
recipients age 18 years or older, even in those with no history of
clinical extensive chronic graft-versus-host disease, compared with
their donors. The levels of total IgG2 and specific IgG
against Haemophilus influenzae and Streptococcus
pneumoniae were similar in patients and donors. Overall, the
immunity of patients surviving 20 to 30 years after
transplantation is normal or near normal. Patients who received
transplants in adulthood have a clinically insignificant deficiency of
de novo-generated CD4 T cells, suggesting that in these patients the
posttransplantation thymic insufficiency may not be fully reversible.
(Blood. 2001;98:3505-3512) More than 125 000 allogeneic and syngeneic
hematopoietic cell transplantations (HCTs) have been performed
worldwide for hematologic malignancies, aplastic anemia, and inborn
errors of hematolymphopoietic cells.1-3 Immunodeficiency
follows HCT and lasts for more than 1 year.4-11 Because
HCT only came into general practice in the 1980s, there has been, up
until now, no opportunity to observe the immunity of very long-term
survivors. There are conflicting views about what might happen to the
immunity of these patients. On the one hand, infection rates as well as
laboratory parameters of immunity like CD4 T-cell counts gradually
improve in the first 5 years after transplantation (reviewed in Parkman
and Weinberg4 and Storek and Witherspoon5).
Thus, by 20 years, one might expect relatively complete recovery. On
the other hand, there is the possibility that the replicative potential
of the transplanted immune cells and/or their precursors might be
limited.12 This possibility could result in late onset
immune deficiency. We have undertaken a study of a unique cohort of
patients, the first group surviving 20 to 30 years after
transplantation. We have asked the following questions: (1) What are
the counts of immune cells in this group of patients? CD4 T cells were
of particular interest because low CD4 T-cell counts have been
associated with high rates of postengraftment infections and because
the duration of CD4 T lymphocytopenia in adult marrow transplant
recipients is not known (CD4 T-cell counts remain low for at least 5 years after transplantation).13-15 (2) What are the counts
of T cells generated de novo (from hematolymphopoietic cells)? This
question is important because concerns have been raised that the
grafted hematolymphopoietic cells or the host thymus cannot sustain de
novo T lymphopoiesis for more than 14 years after
transplantation.12 (3) What are the levels of
immunoglobulin (Ig)G2 and IgG against the capsular polysaccharides of commonly encountered encapsulated bacteria? Low
levels have been associated with infections in HCT recipients, and the
duration of this selective immunoglobulin deficiency is not known
(levels remain low for at least 2 to 5 years after
transplantation).16-20 (4) How frequently do the very late
survivors develop infections? Infections, the incidence of which is the
most clinically relevant measure of immunity, have been described to
cause significant morbidity and mortality even between 2 and 16 years
after transplantation.21,22
Patients
Enumeration of mononuclear cell subsets
Quantitation of T-cell receptor excision circle (TREC) levels (number of TREC copies per 100 000 CD3+CD4+ or CD3+CD8+ cells sorted by flow-activated cell sorter) was performed by real-time quantitative polymerase chain reaction (PCR) as described.25 Briefly, sorted cells were lysed in 100 µg/mL proteinase K at 107 cells/mL. The 5'-nuclease (Taqman) assay was performed on 5 µL cell lysate (equivalent to 50 000 cells) with the primers CACATCCCTTTCAACCATGCT and GCCAGCTGCAGGGTTTAGG and the probe FAM-ACACCTCTGGTTTTTGTAAAGGTGCCCACT-TAMRA (MegaBases, Chicago, IL). PCR reactions contained 0.5 U Taq polymerase, 3.5 mM MgCl2, 0.2 mM dNTPs, 500 nM of each primer, 150 nM probe, and Blue-636 reference (MegaBases). The reactions were run at 95°C for 5 minutes, then 95°C for 5 minutes and 60°C for 1 minute for 40 cycles, using ABI7700 system (PE Biosystems, Norwalk, CT). Samples were analyzed in duplicates. A standard curve was plotted, and TREC levels (the number of TREC copies per 100 000 CD4 or CD8 T cells) were calculated by the ABI7700 software. The TREC levels reflect not only the de novo generation of T cells but also the postrearrangement expansion of thymocytes or T cells. For example, the TREC levels drop when peripheral T cells proliferate as a result of an infection. In contrast, the absolute count of TREC-containing (TREC+) T cells (per unit blood volume) is not influenced by postrearrangement proliferation and thus serves as a better indicator of the quantity of de novo-generated T cells. Therefore, we calculated the absolute count of TREC+ CD4 (CD8) T cells (per microliter) as the TREC level (per 100 000 cells) multiplied by the absolute CD4 (CD8) T-cell count (per microliter) and divided by 100 000. The immunophenotypic subsets were determined in all 33 patients. The counts of TREC+ T cells were determined in 32 patients because of a technical error in one case. Determination of antibody levels Serum levels of total IgG2 and IgG specific for tetanus toxoid, for Haemophilus influenzae capsular polysaccharide, or for a mixture of 23 common pneumococcal polysaccharide serotypes were determined by enzyme-linked immunosorbent assay (ELISA), using kits purchased from The Binding Site (Birmingham, United Kingdom). Questionnaires asking whether the patients and the donors had been vaccinated against tetanus, H influenzae, or Streptococcus pneumoniae since transplantation were sent to them at the time of the blood draw. Specific IgG levels of only the unvaccinated patients/donors are presented.Enumeration of infections Questionnaires were sent annually (at the end of each posttransplantation year) to the patients and their primary physicians, asking about events (including infections and vaccinations) occurring since the time of the last returned questionnaire and about current medications. We counted infections occurring in the 16th year after transplantation through the last year covered by a questionnaire returned to us for a total of 591 patient-years. We included infections occurring in the 16th to the 19th year after transplantation to expand the number of years of follow-up for infections and thus to make a more accurate determination of the infection rate. (If we evaluated only infections occurring in the 20th year through the last questionnaire year, the infection rate would have been determined based on only 282 patient-years.) Respiratory tract infections, gastroenteritis, and lip sores were not counted because these were minor infections that had probably been underreported. Hepatitis C was not counted, as this infection likely started in the peritransplantation period.Statistics Significance of differences between patients and donors was tested by Wilcoxon signed-rank test (paired). It was also tested by Mann-Whitney rank sum test (nonpaired) to allow the inclusion of patients whose donors were not evaluated.Because of the limited number of the original marrow donors, the patients were also compared with unrelated healthy adult volunteers (unrelated controls) studied in our laboratory (n = 101 for immunophenotypic cell subsets, n = 32 for TRECs, and n = 66 for immunoglobulin levels). These comparisons were done by using Mann-Whitney rank sum test (nonpaired). For the comparison of TREC+ T-cell counts, which used unrelated controls carefully matched for age (1:1), Wilcoxon signed-rank test (paired) was also used. The 32 age-matched unrelated controls were chosen from a pool of 51 controls, whose TREC+ T-cell counts had been determined in our laboratory, according to the following criteria: (1) Match as many patients as possible with controls less than 1 year older or younger than the patient. Such controls were found for 25 of 32 (78%) patients. (2) Match the remaining patients with controls as close in age as possible. Three patients were matched to a 2-year older or younger control, 3 patients were matched to a 3-year older or younger control, and one patient was matched to a 6-year older control. Whenever 2 controls of equal age difference from the patient were available, the control was chosen randomly (by a coin toss). Two-tailed P values are given.
Mononuclear cell subset counts As shown in Figure 1, the counts of monocytes, natural killer (NK) cells, total B cells, IgD+ B cells, IgD B cells, total CD4 T cells, CD28+
CD4 T cells, CD28 CD4 T cells, CD45RAlow/ CD4
T cells, CD45RAhigh CD4 T cells, total CD8 T cells,
CD28+ CD8 T cells, CD28 CD8 T cells,
CD11ahigh CD8 T cells, CD11alow CD8 T cells,
and TREC+ CD8 T-cell counts were not significantly lower in
the patients compared with their donors. These counts were also not
significantly lower in the patients compared with the unrelated
controls (data not shown). TREC+ CD4 T-cell counts were
lower in the patients compared with the donors
(Ppaired = .005,
Pnonpaired = .06) as well as compared with the
unrelated controls (Ppaired = .007,
Pnonpaired = .008).
The reconstitution of TRECs might be influenced by irradiation,
graft-versus-host disease (GVHD), or patient age (Douek et al,25 Chung et al,26 Weinberg et
al,27 and Storek et al68). We observed no
significant difference in the counts of TREC+ CD4 or CD8 T
cells between patients conditioned with versus without total body
irradiation, allogeneic versus syngeneic graft recipients, patients who
had versus had not developed grade 2 to 4 acute GVHD, or patients who
had versus had not developed clinical extensive chronic GVHD. Also,
there was no significant difference between patients with versus
without chronic hepatitis C or patients treated versus not treated with
interferon. However, there were significant differences between
patients who received transplants before the age of 18 years (n = 17)
and patients who received transplants at the age of 18 years or older
(n = 15) (median TREC+ CD4 T-cell counts, 27.5 versus
4.5 × 106/L, P = .004; median
TREC+ CD8 T-cell counts, 17.5 versus
3.2 × 106/L, P = .006). Because even in
healthy individuals the quantity of TRECs declines with
age,28 we next compared the patients with their sibling
donors as well as unrelated age-matched controls (for the size and
median age of these subgroups, see the legend to Figure
2). In the younger patients, the counts
of TREC+ CD4 T cells and TREC+ CD8 T cells were
not significantly different from the counts in their donors or the
age-matched unrelated controls. In contrast, the older patients'
TREC+ CD4 T-cell counts (but not TREC+ CD8
T-cell counts) were significantly lower compared with the donors
(Ppaired = .004,
Pnonpaired = .005) or to the age-matched unrelated controls (Ppaired = .05,
Pnonpaired = .04) (Figure 2). In agreement
with that finding, the older patients' (but not the younger
patients') CD45RAhigh CD4 T-cell counts were lower
compared with the donors' counts (median 203 versus
409 × 106/L, Ppaired = .004,
Pnonpaired = .03). For both older and younger patients, the counts of monocytes, NK cells, total B cells,
IgD+ B cells, IgD
Older patients have a higher propensity to develop chronic GVHD than young patients,29 and chronic GVHD and/or its treatment may inhibit de novo T lymphopoiesis.27 To evaluate whether the low TREC+ CD4 T-cell counts in our older patients could be attributed to chronic GVHD and/or its treatment, we next analyzed only the patients who received transplants at the age of 18 years or older who had no history of clinical extensive chronic GVHD (n = 11). Their TREC+ CD4 T-cell counts were lower compared with their donors (median 4.6 versus 38.3 × 106/L, Ppaired = .03, Pnonpaired = .04) and tended to be lower compared with their unrelated age-matched controls (median 4.6 versus 31.0 × 106/L, Ppaired = .12, Pnonpaired = .25). Thus, the long-lasting thymic insufficiency in the older patients was not due to a high incidence of clinical extensive chronic GVHD or its treatment. Because of insufficient data, we could not exclude a role of clinical limited or subclinical chronic GVHD. Antibody levels There were no significant differences between the patients and their donors in the serum concentrations of total IgG2, H influenzae polysaccharide-specific IgG (evaluated in only 29 patients and 15 donors not vaccinated since the transplantation), and S pneumoniae polysaccharide-specific IgG (evaluated in only 26 patients and 15 donors not vaccinated since the transplantation) (Figure 3). The following facts constitute further evidence that the IgG2 and antipolysaccharide IgG levels in our patients were normal: (1) Median IgG2 level determined in 102 healthy adult individuals by the kit manufacturer (3.57 g/L; 95 percentile range, 1.65-5.45; package insert) was close to the median IgG2 level in our patients (3.04 g/L). (We did not determine IgG2 levels in our unrelated controls.) (2) H influenzae and S pneumoniae IgG levels in 66 unrelated controls determined in our laboratory were similar to the levels in the patients (Figure 3), even though some of the unrelated controls may have received H influenzae or S pneumoniae vaccines.
Tetanus toxoid-specific IgG levels, evaluated in 8 patients and 10 donors who were not vaccinated since the transplantation, were lower in the patients (Ppaired = .03, Pnonpaired = .04) (Figure 3). The tetanus IgG levels in the patients also tended to be lower compared with those in our 66 unrelated controls (Pnonpaired = .11). Infections Infections occurring in the 591 patient-years were described in 361 patient questionnaires and/or 323 physician questionnaires returned to us. It means that 361 of 591 (61%) years were covered by patient questionnaires and 323 of 591 (55%) years by physician questionnaires filled out at the end of the posttransplantation year, whereas the remaining years were covered by questionnaires filled out later. For all 72 patients, we received at least one patient or physician questionnaire.A total of 41 infections occurred over the 591 patient-years between
the 16th and the 30th year after transplantation. Thus, the rate was
0.07 infections per year (one infection every 14 years). In the
patients who received transplants before age 18, the rate was 0.06 per
year (one infection every 18 years). In the patients who received
transplants at age 18 years or older, the rate was 0.09 per year (one
infection every 11 years). Details on the infections are given in Table
3. It should be noted that infections
were rare despite the fact that some patients suffered from conditions
known to be associated with increased susceptibility to infections,
such as diabetes or cancer (Table 1).
The 72 of 389 very late survivors may have been highly selected for those who had normal or near-normal immunity already early after transplantation. To ascertain whether the 72 patients were immunocompromised early after transplantation, we reviewed their records and counted early postengraftment infections, excluding respiratory tract infections, gastroenteritis, and lip sores. Early postengraftment infections were defined as infections diagnosed between day 30 and day 365 (65 of 72 patients reached sustained absolute neutrophil count > 500 × 106/L by day 30; the remaining 7 patients engrafted by day 43 and did not have an infection between day 30 and the day of engraftment). A total of 85 early postengraftment infections occurred (rate of 1.29 infections per year). This rate is 18 times higher than the rate around 20 years after transplantation (0.07 infections per year). Thus, these patients were immunocompromised early after transplantation. Deaths Five deaths occurred between year 20 and the time of the last contact. One was due to pneumonia in a patient who appeared to have had ongoing chronic GVHD (cachexia and advanced scleroderma with leg ulcers and contractures were reported during the last 4 years of life). Four additional deaths were not attributed to infection; one due to lung graft rejection, one due to polycystic liver disease, one due to advanced esophageal cancer, and one due to metastatic cancer of uncertain origin.
This is the first study on the immunity of transplant recipients surviving 20 years or more. Given the extremely low infection rates, normal counts of monocytes, NK cells, total B cells, total CD4 T cells and total CD8 T cells, and normal levels of antibodies against commonly encountered encapsulated bacteria, we conclude that the immunity has recovered to normal or near normal by 20 years after transplantation. In theory, a limited replicative potential of the grafted immune
cells and/or their precursors12 or a limited ability of adult patients to generate T cells de novo (Storek et
al,15 Mackall et al,30 Jendro et
al,31 Weinberg et al,32 Dumont-Girard et
al,33 and Storek et al68) could have caused
long-lasting immunodeficiency after HCT. Data shown here suggest that
the limit of replication extends beyond 20 years after transplantation, as patients surviving 20 years or more did not have low counts of
monocytes, NK cells, B cells, CD4 T cells, or CD8 T cells. This finding
is in agreement with the recent studies of Rufer et al34
and Mathioudakis et al,35 showing that immunocyte telomeres are only slightly shorter in patients surviving 10 to 27 years after transplantation than in their donors and that the slope
indicating the shortening of telomeres over time is not steeper. In our
study, even the counts of the T-cell subsets expected to have the
shortest telomeres (memory/effector cells and CD28 It is not clear why the patients who received transplants in adulthood had a deficiency of de novo-generated CD4 but not CD8 T cells. In mice, extrathymic CD8 but not CD4 T lymphopoiesis de novo has been well documented.40-42 Perhaps, in the patients the putative extrathymic T-lymphopoietic organ was not damaged or has fully recovered by 20 years after transplantation, leading to the normalization of the counts of phenotypically naive and TREC+ CD8 T cells, whereas the thymus has not fully recovered by 20 years after transplantation in the older patients, leading to extremely long-lasting deficiency of phenotypically naive and TREC+ CD4 T cells. The deficiency of de novo-generated CD4 T cells in the patients 18 year or older was mild (Figure 2) and clinically insignificant (not associated with frequent infections). However, we studied only transplant recipients younger than 40 years of age, because none of the 29 recipients in Seattle who were older than 40 years of age before January 1, 1978, survived 20 years or more. We have not excluded the possibility that, in transplant recipients older than 40 years of age, the deficiency of de novo-generated T cells might be greater. Because de novo generation results in diverse repertoire,43 transplant recipients older than 40 years of age might have limited T-cell repertoire. Theoretically, this could result in old HCT recipients' ability to mount T-cell responses against only a limited number of pathogens. The finding of normal counts of phenotypically naive and
TREC+ T cells in our patients who received transplants
before age 18 years contrasts with the recent report of Patel et
al12 showing that, after an initial increase of
phenotypically naive T cells and TREC levels in the first 2 years after
transplantation, there was a decline to values approaching zero by 14 years after transplantation. Our patients received T-cell-replete
marrow after myeloablative conditioning for treatment of aplastic
anemia or leukemia, whereas most of Patel's patients received
T-cell-depleted marrow without conditioning for treatment of severe
combined immunodeficiency. The former transplant type usually leads to
full chimerism (both T and myeloid cells of donor
origin)44,45 presumably with the engraftment of abundant
donor hematolymphopoietic progenitors. In contrast, the latter
transplant type usually leads to selective T-cell chimerism (T cells of
donor origin and myeloid cells of host origin)46,47 with
the engraftment of only a limited number of donor hematolymphopoietic
progenitors (in 2 cases studied Low TREC+ CD4 T-cell counts with normal total CD4 T-cell counts could be caused by a low rate of de novo T lymphopoiesis or by increased peripheral turnover (expansion and death) of de novo-generated T cells. The association between older patient age and lower TREC+ CD4 T-cell counts favors a low rate of de novo T lymphopoiesis as the more likely explanation. In mice given allogeneic T cells, donor T cells (both alloreactive cells and "innocent bystanders") undergo significant proliferation and activation-induced cell death during the first 2 weeks after transplantation.50 It is not known whether the high cell turnover can persist long term. It was not known whether posttransplantation patients recover from the deficiency of total IgG2 and IgG specific for the capsular polysaccharides of commonly encountered encapsulated bacteria. Our results show that they can recover as the total IgG2 level and the levels of S pneumoniae and H influenzae IgG were not low. Because only patients not vaccinated since the transplantation were included in our analysis, it is likely that the normalization of the specific IgG levels resulted from natural exposure to H influenzae and S pneumoniae. After a decline in the first several months after transplantation, levels of specific antibodies to protein antigens frequently encountered after transplantation (eg, cytomegalovirus in patients who were cytomegalovirus-seropositive before transplantation) return to pretransplantation levels within 1 year.51,52 In contrast, antibodies to protein antigens that are unlikely encountered after transplantation (eg, tetanus, measles, and polio) continue to decline.53-57 However, it was not known whether the decline was faster than the natural decline observed in healthy individuals.58 Our results document that the decline is faster, because the levels of tetanus IgG were lower in the patients than in their donors (both not vaccinated since transplantation). Surprisingly, the decline may not lead to complete disappearance of the specific IgG even by 20 years after transplantation, as 8 of 8 patients not vaccinated since transplantation had tetanus IgG levels above the sensitivity level of the ELISA (0.009 IU/mL) and 5 of 8 patients had protective levels (> 0.15 IU/mL59). It is unlikely that this finding could be due to natural exposure to tetanus toxin. Tetanus antibodies have been detected in unvaccinated individuals living in a developing country under primitive conditions60 but not in 119 of 119 unvaccinated individuals living in a developed country.61 The 8 patients we studied lived in developed countries. Therefore, the continued production of tetanus IgG at 20 years or more after transplantation is most likely attributable to the immunization of the donors and/or the patients before transplantation. Given the lower tetanus IgG levels in our patients versus their donors, we support the recommendation of posttransplantation vaccination.62-64 The very low average infection rate (one infection every 14 years) might be attributed to underreporting, because only 361 of 591 (61%) patient-years were covered by patient questionnaires filled out at the end of the posttransplantation year. The remaining 230 patient-years (39%) were covered by patient questionnaires filled out later, usually at the end of the next posttransplantation year. At that time patients may have no longer remembered minor infections from the previous year(s). We believe, however, that any serious infections would have been remembered and recorded by the patients. In addition, physician questionnaires and medical records from the primary physician were used as a further source of information. Thus, we have likely captured a significant majority of serious infections. It would be interesting to directly compare the rates of infections in the patients and their donors or unrelated controls. Unfortunately, we have not been sending the questionnaires to the donors, and a study on infection rates in healthy adult volunteers has not been published to our knowledge. Because most of the measured laboratory parameters of immunity were normal and because infections occurred rarely in the very long-term survivors, we concluded that their immunity recovered to normal or near normal by 20 years after transplantation. However, there may be an alternative explanation of the results. Instead of gradually improving their immunity over the first 2 decades after transplantation, the patients surviving 20 years or more may have had normal immunity early after transplantation, whereas the patients with poor immunity early died by 20 years after transplantation. Two observations suggest that this situation was not the case. First, among 105 allogeneic marrow recipients we recently studied on day 80 only one had CD4 T-cell count more than 350 × 106/L.65 Second, in the patients surviving 20 to 30 years after transplantation the rate of significant infections between the time of neutrophil engraftment and day 365 after transplantation was 18-fold higher than the rate of infections around 20 years after transplantation. This finding suggests that the very late survivors were severely immunocompromised in the early period after engraftment and that their immunity subsequently improved. Nevertheless, it is possible that the very late survivors were less immunocompromised early after transplantation than patients who died by 20 years after transplantation, as high infection rates between day 50 and day 730 have been associated with high nonrelapse mortality in the first 5 years after transplantation.10 In conclusion, patients surviving 20 years or more after transplantation are no longer significantly immunocompromised. Compared with healthy individuals of similar age, transplant recipients may be more susceptible to rare diseases for which children are commonly vaccinated like tetanus, polio, or measles, unless revaccinated after transplantation. Continued follow-up of patients who received transplants in adulthood is needed to determine whether their counts of de novo-generated T cells will ultimately reach normal levels.
We thank the patients who agreed to participate in the study as well as their physicians who kindly provided us with annual updates on the clinical status of the patients and facilitated the blood draw. We also appreciate the hard work of the staff of the Fred Hutchinson Cancer Research Center Long-Term Follow-Up Department, particularly Judy Campbell, Mary-Joy Lopez, Kathy Erne, and Jane Jocom, who diligently gathered clinical information. We also thank Dr Lawrence Corey and Dr Meei-Li Huang for facilitating the TREC assay. Dr German Espino currently works at Complejo Hospitalario Metropolitano CSS, Panama, Republica de Panama. Dr Keith M. Sullivan currently works at the Division of Medical Oncology and Transplantation, Duke University Medical Center, Durham, NC 27712.
Submitted April 13, 2001; accepted July 19, 2001.
Supported by grants AI46108, CA68496, CA18221, CA18029, CA15704, HL36444 from the National Institutes of Health and by a Leukemia and Lymphoma Society Translational Research Award 6540-00.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jan Storek, FHCRC, D1-100, 1100 Fairview Ave N, Seattle, WA 98109-1024; e-mail: jstorek{at}fhcrc.org.
1. International Bone Marrow Transplant Registry: Report on State of the Art in Blood and Marrow Transplantation. 2000. Available at: http://www.ibmtr.org/infoserv/info_sums.html. Accessed September 28, 2001. 2. Thomas ED, Blume KG, Forman SJ. Hematopoietic Cell Transplantation. 2nd ed. Malden, MA: Blackwell Science; 1999. 3. Atkinson K. Clinical Bone Marrow and Blood Stem Cell Transplantation. 2nd ed. Cambridge, United Kingdom: Cambridge University Press; 2000. 4. Parkman R, Weinberg KI. Immunological reconstitution following hematopoietic stem cell transplantation. In: Thomas ED,Blume KG,Forman SJ, eds. Hematopoietic Cell Transplantation. Malden, MA: Blackwell Science; 1999:704-711. 5. Storek J, Witherspoon RP. Immunologic reconstitution after hematopoietic stem cell transplantation. In: Atkinson K, ed. Clinical Bone Marrow and Blood Stem Cell Transplantation. Cambridge United Kingdom: Cambridge University Press; 2000:111-146.
6.
Atkinson K, Farewell V, Storb R, et al.
Analysis of late infections after human bone marrow transplantation: role of genotypic nonidentity between marrow donor and recipient and of nonspecific suppressor cells in patients with chronic graft-versus-host disease.
Blood.
1982;60:714-720
7.
Marks DI, Cullis JO, Ward KN, et al.
Allogeneic bone marrow transplantation for chronic myeloid leukemia using sibling and volunteer unrelated donors: a comparison of complications in the first 2 years.
Ann Intern Med.
1993;119:207-214 8. Sullivan KM, Mori M, Sanders J, et al. Late complications of allogeneic and autologous marrow transplantation. Bone Marrow Transplant. 1992;10(suppl 1):127-134. 9. Morrison VA, Haake RJ, Weisdorf DJ. Non-Candida fungal infections after bone marrow transplantation: risk factors and outcome. Am J Med. 1994;96:497-503[CrossRef][Medline] [Order article via Infotrieve].
10.
Ochs L, Shu XO, Miller J, et al.
Late infections after allogeneic bone marrow transplantation: comparison of incidence in related and unrelated donor transplant recipients.
Blood.
1995;86:3979-3986
11.
Storek J, Dawson MA, Storer B, et al.
Immune reconstitution after allogeneic marrow versus blood stem cell transplantation.
Blood.
2001;97:3380-3389
12.
Patel DD, Gooding ME, Parrott RE, Curtis KM, Haynes BF, Buckley RH.
Thymic function after hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency.
N Engl J Med.
2000;342:1325-1332 13. Small TN, Avigan D, Dupont B, et al. Immune reconstitution following T-cell depleted bone marrow transplantation: effect of age and posttransplant graft rejection prophylaxis. Biol Blood Marrow Transplant. 1997;3:65-75[Medline] [Order article via Infotrieve]. 14. Storek J, Gooley T, Witherspoon RP, Sullivan KM, Storb R. Infectious morbidity in long-term survivors of allogeneic marrow transplantation is associated with low CD4 T cell counts. Am J Hematol. 1997;54:131-138[CrossRef][Medline] [Order article via Infotrieve]. 15. Storek J, Witherspoon RP, Storb R. T cell reconstitution after bone marrow transplantation into adult patients does not resemble T cell development in early life. Bone Marrow Transplant. 1995;16:413-425[Medline] [Order article via Infotrieve].
16.
Sheridan JF.
Immunoglobulin G subclass deficiency and pneumococcal infection after allogeneic BMT.
Blood.
1990;75:1583-1586 17. Riches PG, Walker SA, Rogers TR, Hobbs JR. Relative deficiency of serum IgA, IgG2 and IgG4 during reconstitution following BMT: relationship to infection. Bone Marrow Transplant. 1986;1(suppl 1):53[Medline] [Order article via Infotrieve].
18.
Aucouturier P, Barra A, Intrator L, et al.
Long lasting IgG subclass and antibacterial polysaccharide antibody deficiency after allogeneic bone marrow transplantation.
Blood.
1987;70:779-785
19.
Winston DJ, Ho WG, Schiffman G, Champlin RE, Feig SA, Gale RP.
Pneumococcal vaccination of recipients of bone marrow transplants.
Arch Intern Med.
1983;143:1735-1737 20. Guinan EC, Molrine DC, Antin JH, et al. Polysaccharide conjugate vaccine responses in bone marrow transplant patients. Transplantation. 1994;57:677-684[Medline] [Order article via Infotrieve].
21.
Kulkarni S, Powles R, Treleaven J, et al.
Chronic graft versus host disease is associated with long-term risk for pneumococcal infections in recipients of bone marrow transplants.
Blood.
2000;95:3683-3686
22.
Socie G, Stone JV, Wingard JR, et al.
Long-term survival and late deaths after allogeneic bone marrow transplantation. Late Effects Working Committee of the International Bone Marrow Transplant Registry.
N Engl J Med.
1999;341:14-21 23. Storek J, Dawson MA, Maloney DG. Comparison of two flow cytometric methods enumerating CD4 T cells and CD8 T cells. Cytometry. 1998;33:76-82[CrossRef][Medline] [Order article via Infotrieve]. 24. Storek J, Ferrara S, Ku N, Giorgi JV, Champlin RE, Saxon A. B cell reconstitution after human bone marrow transplantation: recapitulation of ontogeny? Bone Marrow Transplant. 1993;12:387-398[Medline] [Order article via Infotrieve]. 25. Douek DC, Vescio RA, Betts MR, et al. Assessment of thymic output in adults after haematopoietic stem-cell transplantation and prediction of T-cell reconstitution. Lancet. 2000;355:1875-1881[CrossRef][Medline] [Order article via Infotrieve].
26.
Chung B, Barbara-Burnham L, Barsky L, Weinberg K.
Radiosensitivity of thymic interleukin-7 production and thymopoiesis after bone marrow transplantation.
Blood.
2001;98:1601-1606
27.
Weinberg K, Blazar BR, Wagner JE, et al.
Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation.
Blood.
2001;97:1458-1466 28. Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic function with age and during the treatment of HIV infection. Nature. 1998;396:690-695[CrossRef][Medline] [Order article via Infotrieve].
29.
Vogelsang GB.
How I treat chronic graft-versus-host disease.
Blood.
2001;97:1196-1201
30.
Mackall CL, Fleisher TA, Brown MR, et al.
Distinctions between CD8+ and CD4+ T-cell regenerative pathways result in prolonged T-cell subset imbalance after intensive chemotherapy.
Blood.
1997;89:3700-3707 31. Jendro MC, Ganten T, Matterson EL, Weyand CM, Goronzy JJ. Emergence of oligoclonal T cell populations following therapeutic T cell depletion in rheumatoid arthritis. Arthritis Rheum. 1995;38:1242-1251[Medline] [Order article via Infotrieve]. 32. Weinberg K, Annett G, Kashyap A, Lenarsky C, Forman SJ, Parkman R. The effect of thymic function on immunocompetence following bone marrow transplantation. Biol Blood Marrow Transplant. 1995;1:18-23[Medline] [Order article via Infotrieve].
33.
Dumont-Girard F, Roux E, van Lier RA, et al.
Reconstitution of the T-cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants.
Blood.
1998;92:4464-4471
34.
Rufer N, Brummendorf TH, Chapuis B, Helg C, Lansdorp PM, Roosnek E.
Accelerated telomere shortening in hematological lineages is limited to the first year following stem cell transplantation.
Blood.
2001;97:575-577
35.
Mathioudakis G, Storb R, McSweeney PA, et al.
Polyclonal hematopoiesis with variable telomere shortening in human long-term allogeneic marrow graft recipients.
Blood.
2000;96:3991-3994
36.
Weng NP, Levine BL, June CH, Hodes RJ.
Human naive and memory T lymphocytes differ in telomeric length and replicative potential.
Proc Natl Acad Sci U S A.
1995;92:11091-11094
37.
Rufer N, Brummendorf TH, Kolvraa S, et al.
Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood.
J Exp Med.
1999;190:157-167
38.
Monteiro J, Batliwalla F, Ostrer H, Gregersen PK.
Shortened telomeres in clonally expanded CD28 39. Muller-Hermelink HK, Sale GE, Borisch B, Storb R. Pathology of the thymus after allogeneic bone marrow transplantation in man. Am J Pathol. 1987;129:242-256[Abstract]. 40. Dulude G, Brochu S, Fontaine P, et al. Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients. Exp Hematol. 1997;25:992-1004[Medline] [Order article via Infotrieve]. 41. Hayashi H, Toki J, Lian Z, Inoue K, Ikehara S. Analyses of extrathymic T cell differentiation in nu/nu mice by grafting embryonal organs. Immunobiology. 1997;197:1-15[Medline] [Order article via Infotrieve]. 42. Kennedy JD, Pierce CW, Lake JP. Extrathymic T cell maturation: phenotypic analysis of T cell subsets in nude mice as a function of age. J Immunol. 1992;148:1620-1629[Abstract]. 43. Mackall CL, Gress RE. Thymic aging and T-cell regeneration. Immunol Rev. 1997;160:91-102[CrossRef][Medline] [Order article via Infotrieve].
44.
Roux E, Helg C, Chapuis B, Jeannet M, Roosnek E.
Evolution of mixed chimerism after allogeneic bone marrow transplantation as determined on granulocytes and mononuclear cells by the polymerase chain reaction.
Blood.
1992;79:2775-2883
45.
VanLeeuwen JEM, VanTol MJD, Joosten AM, et al.
Persistence of host-type hematopoiesis after allogeneic bone marrow transplantation for leukemia is significantly related to the recipient's age and/or conditioning regimen, but it is not associated with an increased relapse.
Blood.
1994;83:3059-3067
46.
Dror Y, Gallagher R, Wara DW, et al.
Immune reconstitution in severe combined immunodeficiency disease after lectin-treated, T cell-depleted haplocompatible bone marrow transplantation.
Blood.
1993;81:2021-2030 47. Vossen JM, VanLeeuwen JEM, VanTol MDJ, et al. Chimerism and immune reconstitution following allogeneic bone marrow transplantation for severe combined immunodeficiency disease. Immunodeficiency. 1993;4:311-313[Medline] [Order article via Infotrieve].
48.
Tjonnfjord GE, Steen R, Veiby OP, Friedrich W, Egeland T.
Evidence for engraftment of donor-type multipotent CD34+ cells in a patient with selective T-lymphocyte reconstitution after bone marrow transplantation for B-SCID.
Blood.
1994;84:3584-3589
49.
Muller SM, Kohn T, Schulz AS, Debatin KM, Friedrich W.
Similar pattern of thymic-dependent T-cell reconstitution in infants with severe combined immunodeficiency after human leukocyte antigen (HLA)-identical and HLA-nonidentical stem cell transplantation.
Blood.
2000;96:4344-4349
50.
Brochu S, Rioux-Masse B, Roy J, Roy DC, Perreault C.
Massive activation-induced cell death of alloreactive T cells with apoptosis of bystander postthymic T cells prevents immune reconstitution in mice with graft-versus-host disease.
Blood.
1999;94:390-400 51. Lutz E, Ward KN, Szydlo R, Goldman JM. Cytomegalovirus antibody avidity in allogeneic bone marrow recipients: evidence for primary or secondary humoral responses depending on donor immune status. J Med Virol. 1996;49:61-65[CrossRef][Medline] [Order article via Infotrieve]. 52. Engelhard D, Weinberg M, Or R, et al. Immunoglobulins A, G, and M to cytomegalovirus during recurrent infection in recipients of allogeneic bone marrow transplantation. J Infect Dis. 1991;163:628-630[Medline] [Order article via Infotrieve].
53.
Ljungman P, Lewensohn-Fuchs I, Hammarstrom V, et al.
Long-term immunity to measles, mumps and rubella after allogeneic bone marrow transplantation.
Blood.
1994;84:657-663 54. Wahren B, Gahrton G, Linde A, et al. Transfer and persistence of viral antibody-producing cells in bone marrow transplantation. J Infect Dis. 1984;150:358-365[Medline] [Order article via Infotrieve]. 55. LiVolti S, Mauro L, DiGregorio F, et al. Immune status and immune response to diphtheria-tetanus and polio vaccines in allogeneic bone marrow-transplanted thalassemic patients. Bone Marrow Transplant. 1994;14:225-227[Medline] [Order article via Infotrieve]. 56. Ljungman P, Wiklund-Hammarsten M, Duraj V, et al. Response to tetanus toxoid immunization after allogeneic bone marrow transplantation. J Infect Dis. 1990;162:496-500[Medline] [Order article via Infotrieve]. 57. Parkkali T, Ruutu T, Stenvik M, et al. Loss of protective immunity to polio, diphtheria and Haemophilus influenzae type b after allogeneic bone marrow transplantation. APMIS. 1996;104:383-388[Medline] [Order article via Infotrieve]. 58. Simonsen O, Badsberg JH, Kjeldsen K, Moller-Madsen B, Heron I. The fall-off in serum concentration of tetanus antitoxin after primary and booster vaccination. Acta Pathol Microbiol Immunol Scand [C]. 1986;94:77-82[Medline] [Order article via Infotrieve].
59.
Gergen PJ, McQuillan GM, Kiely M, Ezzati-Rice TM, Sutter RW, Virella G.
A population-based serologic survey of immunity to tetanus in the United States.
N Engl J Med.
1995;332:761-766 60. Ehrengut W, Sarateanu DE, AgRhaly A, Koumare B, Simaga SY, Diallo D. [Naturally acquired tetanus antitoxin in the serum of children and adults in Mali]. Immun Infekt. 1983;11:229-232[Medline] [Order article via Infotrieve]. 61. Takahashi M, Komiya T, Fukuda T, et al. A comparison of young and aged populations for the diphtheria and tetanus antitoxin titers in Japan. Jpn J Med Sci Biol. 1997;50:87-95[Medline] [Order article via Infotrieve]. 62. Singhal S, Mehta J. Reimmunization after blood or marrow stem cell transplantation. Bone Marrow Transplant. 1999;23:637-646[CrossRef][Medline] [Order article via Infotrieve]. 63. Ljungman P. Immunization of transplant recipients. Bone Marrow Transplant. 1999;23:635-636[CrossRef][Medline] [Order article via Infotrieve]. 64. Dykewicz CA, Jaffe HW. Guidelines for preventing opportunistic infections among hematopoietic stem cell transplant recipients. Biol Blood Marrow Transplant. 2000;6:659-727[Medline] [Order article via Infotrieve].
65.
Storek J, Espino G, Dawson MA, Storer B, Flowers MED, Maloney DG.
Low B cell and monocyte counts on day 80 are associated with high infection rates between day 100 and 365 after allogeneic marrow transplantation.
Blood.
2000;96:3290-3293
66.
Storb R, Doney KC, Thomas ED, et al.
Marrow transplantation with or without donor buffy coat cells for 65 transfused aplastic anemia patients.
Blood.
1982;59:236-246
67.
Thomas ED, Buckner CD, Banaji M, et al.
One hundred patients with acute leukemia treated by chemotherapy, total body irradiation, and allogeneic marrow transplantation.
Blood.
1977;49:511-533 68. Storek J, Joseph A, Dawson MA, Douek DC, Storer B, Maloney DG. Factors influencing Tlymphopoiesis after allogeneic hematopoietic cell transplantation. Transplantation. In press.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S. Sarantopoulos, K. E. Stevenson, H. T. Kim, C. S. Cutler, N. S. Bhuiya, M. Schowalter, V. T. Ho, E. P. Alyea, J. Koreth, B. R. Blazar, et al. Altered B-cell homeostasis and excess BAFF in human chronic graft-versus-host disease Blood, April 16, 2009; 113(16): 3865 - 3874. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Alpdogan, S. X. Lu, N. Patel, S. McGoldrick, D. Suh, T. Budak-Alpdogan, O. M. Smith, J. Grubin, C. King, G. L. Goldberg, et al. Rapidly proliferating CD44hi peripheral T cells undergo apoptosis and delay posttransplantation T-cell reconstitution after allogeneic bone marrow transplantation Blood, December 1, 2008; 112(12): 4755 - 4764. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vrisekoop, R. van Gent, A. B. de Boer, S. A. Otto, J. C. C. Borleffs, R. Steingrover, J. M. Prins, T. W. Kuijpers, T. F. W. Wolfs, S. P. M. Geelen, et al. Restoration of the CD4 T Cell Compartment after Long-Term Highly Active Antiretroviral Therapy without Phenotypical Signs of Accelerated Immunological Aging J. Immunol., July 15, 2008; 181(2): 1573 - 1581. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Goldberg, O. Alpdogan, S. J. Muriglan, M. V. Hammett, M. K. Milton, J. M. Eng, V. M. Hubbard, A. Kochman, L. M. Willis, A. S. Greenberg, et al. Enhanced Immune Reconstitution by Sex Steroid Ablation following Allogeneic Hemopoietic Stem Cell Transplantation J. Immunol., June 1, 2007; 178(11): 7473 - 7484. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tichelli and G. Socie Considerations for Adult Cancer Survivors Hematology, January 1, 2005; 2005(1): 516 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Krenger, H. Schmidlin, G. Cavadini, and G. A. Hollander On the Relevance of TCR Rearrangement Circles as Molecular Markers for Thymic Output during Experimental Graft-versus-Host Disease J. Immunol., June 15, 2004; 172(12): 7359 - 7367. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hakki, S. R. Riddell, J. Storek, R. A. Carter, T. Stevens-Ayers, P. Sudour, K. White, L. Corey, and M. Boeckh Immune reconstitution to cytomegalovirus after allogeneic hematopoietic stem cell transplantation: impact of host factors, drug therapy, and subclinical reactivation Blood, October 15, 2003; 102(8): 3060 - 3067. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Nash, J. D. Bowen, P. A. McSweeney, S. Z. Pavletic, K. R. Maravilla, M.-s. Park, J. Storek, K. M. Sullivan, J. Al-Omaishi, J. R. Corboy, et al. High-dose immunosuppressive therapy and autologous peripheral blood stem cell transplantation for severe multiple sclerosis Blood, October 1, 2003; 102(7): 2364 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Socie, N. Salooja, A. Cohen, A. Rovelli, E. Carreras, A. Locasciulli, E. Korthof, J. Weis, V. Levy, and A. Tichelli Nonmalignant late effects after allogeneic stem cell transplantation Blood, May 1, 2003; 101(9): 3373 - 3385. [Full Text] [PDF] |
||||
![]() |
M. Malphettes, G. Carcelain, P. Saint-Mezard, V. Leblond, H. K. Altes, J.-P. Marolleau, P. Debre, J.-C. Brouet, J.-P. Fermand, and B. Autran Evidence for naive T-cell repopulation despite thymus irradiation after autologous transplantation in adults with multiple myeloma: role of ex vivo CD34+ selection and age Blood, March 1, 2003; 101(5): 1891 - 1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Waldschmidt, A. Panoskaltsis-Mortari, R. T. McElmurry, L. T. Tygrett, P. A. Taylor, and B. R. Blazar Abnormal T cell-dependent B-cell responses in SCID mice receiving allogeneic bone marrow in utero Blood, December 15, 2002; 100(13): 4557 - 4564. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Antin Long-Term Care after Hematopoietic-Cell Transplantation in Adults N. Engl. J. Med., July 4, 2002; 347(1): 36 - 42. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||