Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Björck, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Björck, P.
Related Collections
Right arrow Immunobiology
Right arrow Plenary Papers
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 December 2001, Vol. 98, No. 13, pp. 3520-3526

PLENARY PAPER

Isolation and characterization of plasmacytoid dendritic cells from Flt3 ligand and granulocyte-macrophage colony-stimulating factor-treated mice

Pia Björck

From the Department of Dermatology, University of Pittsburgh, PA.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Interferon alpha /beta plays an important role in the first-line defense against viral infections and can modulate cytokine responses by T-helper cells. Type 1 interferons (IFNs) are clinically important in infectious diseases and in the treatment of leukemia and lymphomas. Many different cell types have the capacity to produce IFN-alpha after encounter with virus and bacteria. The major, natural type 1 IFN-producing cell in humans was recently described as the plasmacytoid T cell, or pDC2, and it can differentiate into dendritic cells (DCs) on culture. This study describes the murine natural IFN-alpha -producing cell, or pDC2, that shares morphologic features with its human counterpart but has some distinct phenotypical characteristics. Murine plasmacytoid DCs can be differentially isolated based on their expression of CD11c, B220 (CD45R), and Thy1.2 (CD90). They lack expression of myeloid (eg, CD11b) antigens and CD8alpha , a marker used to isolate lymphoid DCs. Like human pDC2, murine plasmacytoid DCs exhibit their maximal type 1 IFN-producing capacity at a precursor stage; pDCs isolated from bone marrow responded to viral stimulation with higher IFN-alpha production than cells of the same phenotype isolated from spleen. Mobilization of mice with Flt3 ligand (Flt3L) or Flt3L and granulocyte-macrophage colony-stimulating factor, hematopoietic factors that specifically enhance DC growth, resulted in strikingly increased numbers of pDC in bone marrow and spleen. The isolation of this novel murine DC subset may serve as a useful tool in the study of viral immunobiology and for the design of treatments for murine malignancies. (Blood. 2001;98:3520-3526)

© 2001 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Dendritic cells (DCs) are rare sentinel cells that provide a first defense against invading microbial and viral pathogens.1,2 Encounter with these antigens induces DC maturation and allows for the subsequent activation of naive, antigen-specific T cells and B cells.2,3 DCs can be divided into distinct subsets based on differential phenotype and function. In humans, myeloid DCs (or DC1) express "myeloid" markers CD13, CD33, high levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) receptors, and accessory molecules. They can induce T-cell proliferation and TH1-like cytokine profiles.2 Human lymphoid DCs or DC24,5 do not express the CD11c antigen; instead, they express high levels of interleukin-3R (IL-3R), CD68, CD4, CD45R, and the inhibitory receptor IL-T3.6 Type 1 interferons are clinically important in infectious diseases and in the treatment of leukemia and lymphoma. Many different cell types have the capacity to produce interferon alpha  (IFN-alpha ) after encounter with virus and bacteria. Human precursors of DC2---plasmacytoid (p)DC2---produce large amounts of type 1 IFN in response to viral contact,7 and viruses can induce their differentiation into mature DC-2, with the resultant antigen-presenting cells (APCs) stimulating CD4+ T cells to produce IFN-gamma and IL-10. IL-3, but not GM-CSF, also induces the maturation of pDC2. Once mature, these APCs can promote TH2 cytokine production (ie, IL-4, IL-5, and IL-10).8

In contrast to human DCs, mouse DC subsets described so far express CD11c.9,10 Murine myeloid DCs can be isolated based on the coexpression of CD11c and CD11b and can induce a strong allogeneic mixed-lymphocyte reaction (MLR).11 The lymphoid-related DC expresses CD11c and CD8alpha as a homodimer,12 was originally isolated from thymus, and was therefore termed lymphoid based on the expression of this T-lineage marker. Lymphoid-related DCs have been shown to express Fas ligand13 and may serve a regulatory function because they induce a comparatively low MLR.13,14 Moreover, recent data suggest that although DCs can be generated from common lymphoid precursors and hence are of lymphoid origin, DCs generated from myeloid precursor cells can give rise to CD8alpha -expressing DC upon adoptive transfer, suggesting expression of CD8alpha may be more related to maturation than to serving as a lineage marker.15 However, CD8alpha may serve as a tool to isolate this distinct DC subset.

The origin of plasmacytoid DCs remains controversial. In humans, a recent study on immunoglobulin (Ig) gene arrangement suggests a lymphoid origin.16 However, as their original terms---plasmacytoid T cells17 and plasmacytoid monocytes18---indicate, these cells could give rise to lymphomas with myeloid and lymphoid characteristics.18

To identify the mouse natural IFN-producing cell, or pDC, total leukocyte populations were isolated from different tissues and stimulated with herpes simplex virus (HSV), and culture supernatants were analyzed for IFN-alpha by specific enzyme-linked immunosorbent assay (ELISA). In addition, mice were treated with Flt3 ligand (Flt3L), an agent known to mobilize DCs in vivo,9,11 either alone or with GM-CSF. Flt3L with or without GM-CSF mobilization resulted in a dramatic elevation in the number of DCs capable of producing IFN-alpha .

Using multicolor fluorescence-activated cell sorting (FACS), the phenotype murine pDC could be determined. It was found to exhibit a phenotype slightly different from that of its human counterpart in that it expressed CD11c, but they were similar in expressing CD45R and low levels of CD4 and IL-3R. Short-term culture of murine pDC in media containing IL-3 and anti-CD40 antibodies induced maturation, resulting in the evolution of long cellular protrusions and high expression of major histocompatibility complex class 2 and accessory molecules.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Mice

Balb/c and C57BL/6 6- to 8-week-old female mice were purchased from Jackson Laboratory (Bar Harbor, ME). Animals were maintained according to institutional guidelines in the Central Animal Facility of the Biomedical Science Tower at the University of Pittsburgh under an Institutional Animal Care & Use Committee (IACUC)-approved protocol.

Reagents

Recombinant murine (rm) Flt3L and rmGM-CSF for in vivo use were the generous gifts of Pharmacia (St Louis, MO). rmGM-CSF and rmIL-4 for in vitro culture were the kind gifts of Schering-Plough (Kenilworth, NJ). Herpes simplex virus (KOS strain) was a kind gift from Dr N. DeLuca (Department of Molecular Biology and Genetics, University of Pittsburgh). Stimulatory cytosine poly-guanine (CpG) motifs specific for the induction of IFN-alpha (GGGGTCAACGTTGAGGGGGG), IL-12 (TCGTCGTTTTGTCGTTTTGTCGTT), and a control CpG motif (CTGGGCTTTCTGGTTTTTTTCTGG) were the kind gifts of Dr A. Krieg (University of Iowa). rmIL-3 was purchased from R&D Systems (Minneapolis, MN). Staphylococcus aureus Cowan strain I (SAC; Pansorbin) was purchased from Calbiochem (La Jolla, CA), lipopolysaccharide (LPS) was obtained from Sigma, and stimulatory anti-CD40 (IgM) antibodies were from Pharmingen (San Diego, CA). All antibodies for cell separation and fluorochrome-conjugated antibodies for FACS and analysis were purchased from Pharmingen. Brefeldin A was obtained from Sigma. MACS magnetic beads directly conjugated with antibodies to CD11c or CD11b or with anti-rat immunoglobulin were purchased from Miltenyi Biotec (Auburn, CA).

Cytokine mobilization

Mice were mobilized with recombinant Flt3L ± GM-CSF or combinations thereof at a concentration of 20 µg/mouse per day in phosphate-buffered saline (PBS) by subcutaneous injections in the neck for 7 consecutive days under an IACUC-approved protocol.

Cell preparation

Bone marrow cells were obtained by flushing femurs and tibias with PBS using a 23-gauge needle. Red cells were hypotonically lysed, and the residual cells were washed and kept on ice until used. Spleens were isolated, and a single-cell suspension was made by passing the spleen through a nylon cell strainer (Falcon; Becton Dickinson, Franklin Lakes, NJ). After lysis of red cells by ammonium chloride solution, cells were incubated with antibodies to block FcR interactions (FcR-block, CD16/CD32, Pharmingen, at 1 µg/1 × 106 cells at 10 × 106/mL in PBS) for 15 minutes on ice. For isolation of CD11c+ cells using directly conjugated MACS magnetic beads (Miltenyi Biotec), CD11c beads were added according to the manufacturer's instructions. After incubation for 20 minutes at 4°C, cells were washed and passed over a MACS column. Positively selected cells were isolated and suspended in appropriate buffer. Purity was checked routinely by FACS and was found to be greater than 97% (not shown). For analysis by FACS, cells were stained with directly conjugated antibodies.

Fluorescence-activated cell sorting

Splenocytes were isolated as described above. After blocking of FcR-binding sites, T and B cells were depleted using antibodies to CD3 and surface immunoglobulin, respectively. After incubation, goat anti-rat-coated magnetic beads (MACS) were added, and, after further incubation, cells were passed over a MACS column. The negative fraction was collected, washed, and stained with antibodies to CD3-fluorescein isothiocyanate (FITC), sIgM-FITC, CD11c-phycoerythrin (PE), and CD11b-APC. Cells were sorted on a FACS Star Plus (Becton Dickinson, Mountain View, CA). Gates were set to exclude debris and dead cells. T and B cells were further excluded by gating on the FITC-negative population. CD11c+CD11b+ and CD11c+ CD11b- cells were collected. Cell purity usually exceeded 96% (data not shown). Alternatively, total DCs were isolated using directly conjugated CD11c antibody-coated magnetic beads. After they were washed, DCs were stained with antibodies to CD8alpha -PE, B220-APC, and a cocktail of FITC-labeled antibodies (CD11b, sIg, CD3). Gates were set to exclude monocytes, T cells, and B cells, and DCs were sorted based on the expression of CD8alpha and B220. Purity exceeded 96% (data not shown).

Cell culture

All cell cultures were performed in complete RPMI-1640 (Gibco Life Technologies, Grand Island, NY) supplemented with 5% fetal calf serum (Gibco), 2 mM L-glutamine, penicillin, streptomycin, and 1 mM HEPES buffer (Gibco).

ELISA for detection of IFN-alpha 2 and IL-12

ELISA was performed using standard procedures. In brief, for the detection of IFN-alpha 2, 96-well flat-bottomed plates (Costar, Corning, NY) were coated with 5 µg/mL sheep anti-mouse IFN-alpha /beta (a kind gift from Schering-Plough Research Institute) overnight at 4°C. After blocking with 3% bovine serum albumin in PBS-Tween 20 for 1 hour at 37°C, plates were washed, and standard rmIFN-alpha 2 (a kind gift from Schering-Plough) and culture supernatants were added (standard rmIFN-alpha 2 had been titrated in parallel against a known rmIFN-alpha 2 standard provided by the National Institute of Allergy and Infectious Diseases reference reagent repository). Plates were then incubated at 4°C overnight. After washing, a rat anti-mouse IFN-alpha 2 antibody (4E-A1 [IgG1]; Seikagaku America, Falmouth, MA) was added, and plates were incubated at room temperature for 2 hours. After washing, peroxidase-conjugated goat anti-rat immunoglobulin antibody (Jackson Laboratory) was added, and plates were further incubated for 1 hour. After washing, plates were developed using tetramethylbenzidine (TMB) substrate (Kirkegaard & Perry, Gaithersburg, MD) and were stopped by the addition of 1 M sulfuric acid. For determination of IL-12 (p70), plates were coated with 5 µg/mL rat anti-mouse IL-12 (p70) (Pharmingen) in PBS overnight. After blocking with bovine serum albumin, supernatants and standard (rmIL-12, a kind gift from the Genetics Institute, Cambridge, MA) was added. After incubation overnight at 4°C, a biotinylated rat anti-mouse IL-12 (p40/p70) antibody was added, and plates were incubated for 2 hours at room temperature. After washing, extravidin-peroxidase (Sigma) was added and plates were further incubated for 1 hour. Finally, plates were developed using TMB substrate as above.

Electron microscopy

Transmission electron microscopy was performed on sorted, CD11c+B220+ DCs. Cells were fixed in 2.5% glutaraldehyde in cacodylate buffer and postfixed in 1% OsO4 solution. Cells were dehydrated in a series of alcohol solutions and embedded in epoxide. Sections were examined using a JEOL 1210 microscope (JEOL, Peabody, MA).

Staining for intracellular cytokines

Cells were cultured for 24 hours together with HSV (10 plaque-forming units [PFU]/cell), and Brefeldin A was added during the last 5 hours of culture. For preparation and staining of cytospins, cells were spun onto slides and fixed for 20 minutes with 2% formaldehyde. Thereafter, cells were permeabilized for 20 minutes using PBS containing 0.55% saponin, 5% fetal calf serum (FCS), and 2 mM HEPES. All subsequent steps were performed in buffer containing saponin. After washing and blocking with 10% goat serum and 5% FCS for 30 minutes, primary rat anti-mouse IFN-alpha (4E-A1; Seikagaku) or an isotype-matched control antibody was added, and slides were incubated overnight. Rabbit anti-rat immunoglobulin antibodies (Dako a/s, Glostrup, Denmark) were added, slides were incubated for 30 minutes and washed, and rat APAAP (Dako) was added. Incubation with rabbit anti-rat immunoglobulin and rat APAAP was repeated. Finally, slides were developed using Fast Red substrate (Dako).

For intracellular staining of IL-12 (p40), total CD11c+ DCs separated using MACS magnetic beads were cultured for 24 hours together with stimulatory anti-CD40 antibodies (25 µg/mL), SAC (10 µg/mL), or LPS (10µg/mL), and Brefeldin A (10 µg/mL) was added during the last 5 hours of culture. Surface staining of cells was performed using directly FITC-conjugated antibodies to CD11c, CD11b, and B220. After washing, cells were fixed in 2% PFA for 20 minutes and then permeabilized for 30 minutes in PBS containing 0.55% saponin, 5% FCS, and 2 mM HEPES. Directly PE-conjugated rat anti-mouse IL-12 (p40) antibodies (5 µg/mL) were added, and cells were further incubated for 30 minutes. After washing, cells were analyzed by flow cytometry.

Measurement of T-cell stimulation

For alloreaction, serial dilutions of irradiated DC (2000 cGy) that had been preactivated for 24 hours with stimulatory CD40 antibodies (IgM subclass; Pharmingen), and 2 × 105 total allogeneic CD4+ T cells were cultured for 6 days in round-bottomed, 96-well plates at a final volume of 200 µL. 3H-thymidine (1 µCi/well [0.037 MBq/well]) was added during the last 18 hours of culture. Proliferation was measured in a beta -scintillation counter.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Isolation of murine plasmacytoid dendritic cells from spleen and bone marrow

Mice were mobilized for 7 days with Flt3L, a hematopoietic growth factor known to specifically expand DCs in vivo,9,11 and were killed 1 day after the last cytokine injection. Bone marrow cells were obtained by flushing resected femurs with PBS. Spleens were harvested and dispersed into single-cell suspensions. Total bone marrow and spleen cells were analyzed by flow cytometry and were found to express high numbers of CD11c+CD11b+ (myeloid) and CD11c+CD11b- (lymphoid) DCs, respectively (data not shown). Because a functional characteristic of human plasmacytoid DCs (pDC2) is their high production of type 1 interferon after encounter with pathogens, isolated bone marrow and spleen cells were cultured overnight in the presence or absence of HSV or SAC. Cells maintained in medium alone were used as control. After 24 hours of culture, supernatants were harvested and analyzed for their IFN-alpha 2 content by specific ELISA. As shown in Figure 1, bone marrow and, to a lesser degree, spleen cells from mice that had been mobilized with Flt3L showed greater production of IFN-alpha 2 in response to HSV than nontreated mice. SAC induced low but reproducible levels of IFN-alpha 2. A significantly greater number of mobilized DCs could be detected when Flt3L was combined in vivo with GM-CSF, a factor known to support DC generation in vitro and also found to have an additive effect when coadministered with Flt3L (P.B. et al, unpublished observation, October 1999). Thus, the combination of Flt3L+GM-CSF was used throughout the rest of this study.


View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Elevated levels of IFN-alpha in Flt3L-treated mice. Mobilization of mice with Flt3L results in elevated levels of IFN-alpha 2 production from (A) BM and (B) spleen cell populations. Total leukocyte populations from BM and spleen from untreated mice or mice mobilized for 7 days with Flt3L were cultured for 24 hours in medium alone (white columns) or with HSV (black columns, 5 PFU/cell) or SAC (gray columns, 10 µg/mL). Supernatants were harvested and analyzed for their IFN-alpha 2 content by specific ELISA. Data from 1 of at least 3 experiments yielding similar results are shown. (C) BM cells and (D) splenocytes were prepared from Flt3L+GM-CSF-treated mice, with either CD11c+ (white columns) or CD11b+ (black columns) cells isolated using directly conjugated magnetic beads (MACS). Cells were cultured for 24 hours in medium alone or with HSV or SAC. Supernatants were collected and analyzed for IFN-alpha 2 by ELISA. Data from 1 of at least 3 experiments yielding comparable results is shown.

Bone marrow cells and splenocytes derived from mice mobilized with Flt3L+GM-CSF were isolated with magnetic beads directly conjugated with antibodies to CD11c or CD11b. Cells were cultured in medium alone or together with HSV or SAC, and supernatants were collected after 24 hours. The major IFN-alpha 2 activity was attributed to the CD11c+ cell population (Figure 1C-D).

Isolated splenocytes from day 7 Flt3L+GM-CSF-mobilized mice were then sorted by FACS based on their expression of the CD11c+CD11b+ (myeloid) and CD11c+CD11b- (lymphoid) phenotypes using fluorochrome-labeled antibodies. Gates were set to exclude dead cells and debris, and B and T cells were further excluded by staining with antibodies to sIg-FITC and CD3-FITC. The purity of sorted cells exceeded 97% (Figure 2A). Sorted cells were cultured overnight in the presence or absence of HSV or SAC. Supernatants were collected and analyzed for their IFN-alpha 2 content by specific ELISA. CD11c+CD11b-, but not CD11c+CD11b+, DCs were found to produce IFN-alpha after stimulation with virus (Figure 2B). SAC induced lower but significant IFN-alpha production yet strongly promoted the production of IL-12 from both CD11c+CD11b- (lymphoid) and CD11c+CD11b+ (myeloid) DC subsets.


View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Murine IFN-alpha -producing cells are present in the lymphoid, CD11c+CD11b- DC population. (A) Myeloid (CD11c+CD11b+) and lymphoid (CD11c+CD11b-) DCs were sorted from spleens of mice mobilized for 7 days with Flt3L+GM-CSF using the directly conjugated CD11c-PE and CD11b-APC antibodies. T and B cells depleted by antibodies to CD3 and surface immunoglobulin and directly conjugated goat anti-rat IgG-coated magnetic beads. FITC-labeled antibodies to CD3 and sIgM were used to further exclude contaminating cells in FACS sorting. Gates were set to exclude dead cells and debris. Purity of sorted cells typically exceeded 97%. (B) CD11c+CD11b+ (black columns) and CD11c+CD11b- (white columns) DCs were cultured for 24 hours in medium alone or with HSV (5 PFU/cell) or SAC (10 µg/mL). Supernatants were collected and analyzed for IFN-alpha 2 and IL-12 (p70) by specific ELISA. Lymphoid CD11c+CD11b- contained the major IFN-alpha activity after stimulation with HSV. SAC induced IFN-alpha and IL-12 production. Data from 1 of 3 experiments with similar results are shown.

Isolation of the major type 1 IFN-producing dendritic cell subset

The CD11c+CD11b- DC subset contains a population of CD11c+CD8alpha + DCs that has been previously shown to be the major IL-12-producing DC subset11,19; however, CD11c+CD8alpha + DCs do not produce significant levels of IFN-alpha after HSV infection. Because this suggested that there was heterogeneity within the CD11c+CD11b- subset responsible for the production of IFN-alpha versus IL-12, DCs were sorted in a manner biased by the phenotype recently reported for human pDC2.7 Human pDC2 expresses CD45R, CD4, and the receptor for IL-3,7 but FACS staining of murine CD11c+CD11b- DCs using antibodies recognizing IL-3R or CD4 showed only weak expression of these antigens (Table 1). However, antibodies to B220 (mouse CD45R) could be readily used to subdivide the DC population further given that flow cytometry of total CD11c+ DCs revealed a distinct subpopulation of CD11c+B220+ cells in day 7 Flt3L+GM-CSF-mobilized mice (Figure 3A) This was also observed to a lesser extent in mice treated with Flt3L alone (data not shown). This CD11c+B220+ population could be found in bone marrow (BM), peripheral blood, spleen, and lymph nodes of mobilized mice. Total CD11c+ cells were isolated by directly conjugated anti-CD11c magnetic beads and were sorted by flow cytometry using fluorochrome-labeled antibodies to CD11b-FITC, CD8alpha -PE, and B220-APC. Anti-CD3- and sIg-FITC-labeled antibodies were used to further exclude contaminating T and B cells. CD11b+ DCs (myeloid) were excluded, and gates were set on CD8alpha +- and B220+- expressing cells, respectively (Figure 3B). FACS analysis of sorted DCs showed that though both populations expressed the CD11c antigen, the CD8alpha + population was typically CD11cbright and the B220+ population was CD11cdim (Table 1). B220+CD11c+ cells expressed Thy1.2 and low, but detectable, levels of IL-3R and CD4. Furthermore, they expressed MHC class 1 (H2-Kd) and class 2 (I-Ad/b) and accessory and adhesion molecules CD86, CD11a, and CD54, but no myeloid antigens or CD19. The expression of Gr-1 varied and was low or undetectable on freshly isolated cells, but it was slightly up-regulated after overnight culture. The CD8alpha +CD11c+ DC population expressed high levels of the MHC class II and CD86 molecules but lacked expression of the CD4, IL-3R, and Thy1.2 antigens. Table 1 provides a summary of the phenotype of the distinct murine DC subpopulations either directly after FACS sorting or after overnight culture in complete medium.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Phenotype of splenic plasmacytoid, lymphoid, and myeloid murine DCs



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Major murine IFN-alpha -producing DC subset expresses a CD11clow, B220+ phenotype and lacks CD8alpha expression. (A) Staining of total splenocytes derived from Flt3L+GM-CSF-treated mice show that, in addition to myeloid CD11c+CD11b+ DC, a subset of CD11c+ DC coexpresses the B220+ antigen. This population is distinct from CD11c+CD8alpha + lymphoid DCs. (B) The CD11c+CD11b- DC subset was further subdivided using antibodies to CD8alpha -PE and B220-APC. Total CD11c+ cells were isolated from the spleens of Flt3L+GM-CSF-treated mice using CD11c-conjugated magnetic beads. FITC-conjugated antibodies to CD11b, CD3, and sIg were used to exclude myeloid DCs, T cells and B cells in FACS sorting. Sorted cells were typically more than 96% pure. (C) Sorted splenic CD11c+B220+ DCs were cultured for 24 hours alone or with HSV, SAC, CD40 antibodies, or 2 µg/mL CpG (ODN). Supernatants were harvested and examined for their IFN-alpha and IL-12 content by specific ELISA. Major HSV-responsive, IFN-alpha 2-producing cells were found in the CD11c+B220+ subset. These cells exhibited the capacity to produce IFN-alpha and IL-12 in response to SAC. (D) CD11c+CD8alpha + lymphoid DCs did not produce IFN-alpha on stimulation with HSV, but SAC induced low levels of IFN-alpha and high levels of IL-12. At least 5 experiments performed gave comparable results.

Freshly isolated and sorted spleen CD11c+B220+ or CD11c+CD8alpha + cells were cultured overnight with or without HSV, SAC, anti-CD40 antibodies, and CpG oligodeoxynucleotides (ODN) motifs to analyze the impact of these stimuli on cytokine production. Culture supernatants were then harvested and examined for their content of secreted IFN-alpha 2 and IL-12 (p70). Figure 3C shows that splenic CD11c+B220+ DCs produced IFN-alpha 2 after viral stimulation. Interestingly, SAC induced both IL-12 and IFN-alpha from this DC subset. However, CD11c+CD8alpha + lymphoid DCs did not produce IFN-alpha after HSV stimulation (Figure 3D), even at high viral multiplicity of infection (ie, 50 PFU/cell), but they could produce low levels after stimulation with SAC. SAC were also the only stimuli that induced the production of IL-12 from lymphoid, myeloid, and CD11c+B220+ DCs as measured by intracellular staining and flow cytometry. The major IL-12-producing DC subset was the CD11c+CD8alpha + lymphoid DC that also responded to stimulatory anti-CD40 antibodies or LPS activation (Figure 4).


View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Production of IL-12 (p40) by DC subsets. Total CD11c+ DCs separated by directly conjugated magnetic beads were stimulated for 24 hours with stimulatory anti-CD40 antibodies (CD40 mAb), LPS (10 µg/mL), or SAC. For the detection of intracellular IL-12, DCs were stained with PE-conjugated antibodies recognizing IL-12 (p40/p70) and directly FITC-labeled antibodies to CD11c, CD11b, and B220. Percentage positive cells are indicated in each quadrant. At least 4 similar experiments were performed.

The key markers used to isolate these 3 different mouse DC subsets are detailed in Figure 5. To obtain myeloid DCs, PE-conjugated antibodies to CD11b were used and CD8alpha -FITC-expressing cells were excluded.


View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. FACS profiles showing key markers for isolation of murine plasmacytoid, lymphoid, and myeloid DCs. Myeloid DCs were obtained by changing the settings for the FACS sorting so that CD11c+CD8alpha + cells were excluded and CD11c+CD11b+ were included. For more detailed analysis, see Table 1.

Mouse pDC develops into dendritic cells after culture and acquires the capacity to stimulate T cells

Visual inspection of cytospins of the CD11c+B220+ DC subset revealed round cells lacking the characteristic dendritic morphology (Figure 6A). Human pDC2 differentiates into typical DC after culture in IL-3 and anti-CD40 antibodies.4 The culture of CD11c+B220+ DCs in media containing IL-3 and anti-CD40 for 2 days similarly revealed "classical" DCs with long protrusions and high MHC class II expression (Figure 6B). Interferon-alpha could be detected by intracellular staining in CD11c+B220+ DCs after culture with HSV overnight (Figure 6C-D). IFN-alpha -producing cells were clearly discernible by their strong cytoplasmic staining. Transmission electron microscopy on freshly isolated, CD11c+B220+ DC confirmed a well-developed endoplasmic reticulum and multiple mitochondria (Figure 6E). Of note, CD11c+B220+ DCs did not proliferate significantly in culture, regardless of the combination of stimulating agents evaluated (ie, IL-3, SAC, CD40, HSV; data not shown).


View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. IFN-alpha -producing plasmacytoid cells differentiate into DCs after culture in IL-3. Cytospins of sorted CD11c+B220+ cells were stained using antibodies to MHC class II, a biotinylated goat anti-rat IgG antibody, and then by streptavidin-alkaline phosphatase and were developed using Fast Red substrate. These data demonstrate that (A) directly after sorting, cells are round and lack DC attributes and that (B) after 2 days in culture with rmIL-3 and activating anti-CD40 antibodies, many cells develop DC morphology with long protrusions and strong MHC class II expression. (C) Cytospins of CD11c+B220+ DCs were infected for 24 hours with HSV (10 PFU/cell) and then stained with isotype control or (D) rat anti-mouse IFN-alpha 2 antibodies and were developed using Fast Red substrate. (E) Transmission electron microscopy of FACS-sorted CD11c+B220+ DCs. White bar represents 2 µm. Original magnification, × 2500. (F) Irradiated CD11c+CD11b+ myeloid DCs (filled triangles) CD11c+B220+ pDC (filled circles) and CD11c+CD8alpha + lymphoid DCs (open circles) were cultured with total allogeneic CD4+ T cells (200 000/well) for 6 days in triplicate in 96-well, round-bottomed plates, and 3H-thymidine was added for the last 18 hours of culture. Cells were harvested, and proliferation was measured in a scintillation counter. Data are representative of 3 experiments yielding comparable data.

T-cell costimulation

A defining characteristic for most DC subsets is T-cell stimulatory capacity. CD11c+B220+ DCs were examined for their capacity to stimulate T-cell proliferation. Isolated DCs were cultured overnight with stimulatory anti-CD40 antibodies (25 µg/mL). After washing, DCs were irradiated (2000 cGy), and serial dilutions of these APCs were cultured with total allogeneic CD4+ T cells (2 × 105/well). T-cell cocultures with CD11c+CD11b+ and CD11c+CD8alpha + DCs were generated in parallel. As shown in Figure 6F, CD40-activated pDC induced T-cell proliferation to levels similar to those observed for CD11c+CD8alpha + lymphoid DCs. Human cultured pDC has also been shown to induce a more potent T-cell stimulation than freshly isolated.4 As expected, myeloid DCs induced comparably strong T-cell stimulation.

In summary, the mouse plasmacytoid DCs exhibited a CD11cdimB220+Thy1.2+ phenotype but did not express the CD8alpha lymphoid or CD11b myeloid DC markers. They are the major producers of type 1 interferon after viral stimulation but can also produce both IFN-alpha and IL-12 when activated by bacterial proteins. Table 2 outlines the characteristics of murine and human DC subsets. Murine pDC are not the strong stimulators of allogeneic T cells their human counterparts are and may possibly serve a regulatory function similar to that of murine lymphoid DCs.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the characteristics of mouse and human DC subsets


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The current study describes the identification of the murine natural type 1 IFN-producing cell20,21 or plasmacytoid DC2,7 with the capacity to produce IFN-alpha after viral challenge. Murine pDC can also produce IL-12 in response to bacterial antigen such as SAC. The kinetics of the pDC response to SAC is different from that of lymphoid CD11c+CD8alpha + DC, the major IL-12 producing DC subset,19 in that it is immediate and transient (not shown). Activating anti-CD40 antibodies were unable to induce IL-12 production in murine pDC, whereas lymphoid CD11c+CD8alpha + DCs responded readily to this stimuli and to stimulation using LPS. Moreover, as shown for human natural IFN-producing cells,22 murine pDC produced low but significant levels of IFN-alpha in response to SAC. This may have in vivo relevance because both IFN-alpha and IL-12 have been reported to promote CD8+ cytotoxic T-lymphocyte and natural killer activity,20,21 thereby providing a link between innate and adaptive immunity. Experiments are under way to analyze what signals regulate IFN-alpha versus IL-12 production in murine pDC.

All murine DC subsets described to date express the CD11c antigen, whereas those for human DCs do not. Murine pDC also express the CD45R (B220) antigen but at lower levels of CD4 and IL-3R than its human counterpart. In addition, murine pDC expressed Thy1.2, a marker expressed on T cells, but did not express the CD8alpha antigen under any conditions evaluated in this study. Recently, CD8alpha has been found on activated, myeloid DCs,15,23 suggesting it may not be a hallmark of lymphoid DC. Instead, expression of CD11c in the absence of CD11b might serve as a more reliable index for distinguishing lymphoid DCs from myeloid DCs.

The existence of the natural IFN-producing cell has been known for some time.24 Although its hematopoietic origin is still a matter of debate, a recent study identified certain transcription factors that regulate T- and B-cell development and pDC2 development, but not DC1, suggesting a lymphoid origin for pDC2.16 Murine pDC express markers associated with lymphoid lineage cells but lack expression of myeloid markers (ie, CD11b) and express low levels of Gr-1 when isolated from BM but not from spleen. However, a low expression of Gr-1 could be found on splenic pDC after overnight culture. A BM-derived cell with the phenotype CD4lowGr-1low that also express low amounts of B220 and Thy-1 was isolated previously25 and found to give rise to both B- and T-lineage cells and to myeloid cells on adoptive transfer. Whether these are the same cells as the plasmacytoid DC described here merits further study. Murine pDC also do not express CD19, a marker that can be found coexpressed with CD11c on a small subset of cells in BM26; this may define an additional subset of DCs.

Flt3L with or without GM-CSF was found to induce and enhance the frequency of the CD11c+B220+DC subset that was correlated with the mobilization of the IFN-alpha -producing cell population. In nontreated mice these cells were found principally in the BM, whereas in Flt3L-treated mice, much of the IFN-alpha production was relocated to the spleen. This finding may prove to be of considerable importance in clinical trials of Flt3L, in which the migration of pDC to peripheral sites is desired.

Type 1 interferons produced by pDC would be anticipated to have multiple effects on the immune system, including the up-regulation of MHC class I on all cell types and functional activation of macrophages and natural killer cells.20,21 IFN-alpha also has proven antiapoptotic effects on CD4+ and CD8+ T cells through the direct induction of BCL-xL and the indirect induction of IL-15.20 TRAIL27 is also up-regulated on activated T cells by treatment with IFN-alpha and is associated with enhanced cytolytic effector function. Each of these effects would be expected to benefit immunotherapies designed to enhance cytotoxic T-lymphocyte viability and activity, such as in patients with cancer.

Most recent data suggest the involvement of pDC in allergic asthma28 and in the autoimmune condition systemic lupus erythematosus.29 Targeting pDC in murine models for these diseases may provide important insights in their pathogenesis.


    Acknowledgments

Dr W. J. Storkus is greatly acknowledged for support, help, and fruitful discussions. I thank Dr L. D. Falo for support, Mr. R. Lakomy for expert help with FACS sorting, and Drs S. Watkins and A. Bursick at the Center for Biological Imaging for help with electron microscopy.


    Footnotes

Submitted March 9, 2001; accepted July 26, 2001.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Pia Björck, Department of Dermatology, University of Pittsburgh, BST W 1546, 200 Lothrop St, Pittsburgh, PA 15213; e-mail: bjorckp{at}msx.upmc.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Ann Rev Immunol. 2000;18:767-811[CrossRef][Medline] [Order article via Infotrieve].

2. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[CrossRef][Medline] [Order article via Infotrieve].

3. Björck P, Flores-Romo L, Liu Y-J. Human interdigitating dendritic cells directly stimulate CD40-activated naive B cells. Eur J Immunol. 1997;27:1266-1274[Medline] [Order article via Infotrieve].

4. Grouard G, Rissoan M-C, Filgueira L, Durand I, Banchereau J, Liu Y-J. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med. 1997;185:1101-1111[Abstract/Free Full Text].

5. Rissoan M-C, Soumelis V, Kadowaki N, et al. Reciprocal control of T helper cell and dendritic cell differentiation. Science. 1999;283:1183-1185[Abstract/Free Full Text].

6. Cella M, Jarrosay D, Facchetti F, et al. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med. 1999;5:919-923[CrossRef][Medline] [Order article via Infotrieve].

7. Siegal FP, Kadowaki N, Shodell M, et al. The nature of the principal type 1 interferon-producing cells in human blood. Science. 1999;284:1835-1837[Abstract/Free Full Text].

8. Kadowaki N, Antonenko S, Lau JY-N, Liu Y-J. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med. 2000;192:219-225[Abstract/Free Full Text].

9. Maraskovsky E, Brasel K, Teepe M, et al. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med. 1996;184:1953-1962[Abstract/Free Full Text].

10. Björck P. Development of dendritic cells and their use in tumor therapy. Clin Immunol. 2000;92:119-127.

11. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997;159:2222-2231[Abstract/Free Full Text].

12. Ardavin C, Wu L, Li CL, Shortman K. Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature. 1993;362:761-763[CrossRef][Medline] [Order article via Infotrieve].

13. Süss G, Shortman K. A subclass of dendritic cells kills CD4 T cells via Fas/Fas-ligand-induced apoptosis. J Exp Med. 1996;183:1789-1796[Abstract/Free Full Text].

14. Kronin V, Vremec D, Winkel K, et al. Are CD8+ dendritic cells (DC) veto cells? the role of CD8 on DC in DC development and in the regulation of CD4 and CD8 T cell responses. Int Immunol. 1997;9:1061-1064[Abstract/Free Full Text].

15. Traver D, Akashi K, Manz M, et al. Development of CD8alpha -positive dendritic cells from a common myeloid progenitor. Science. 2000;290:2152-2154[Abstract/Free Full Text].

16. Spits H, Couwenberg F, Bakker AQ, Weijer K, Uittenbogaart CH. Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre-DC)2 but not into pre-DC1: evidence for a lymphoid origin of pre-DC2. J Exp Med. 2000;192:1775-1783[Abstract/Free Full Text].

17. Brado B, Moller P. The plasmacytoid T cell or plasmacytoid monocyte---a sessile lymphoid cell with unique immunophenotype and unknown function, still awaiting lineage affiliation. Curr Top Pathol. 1990;84:179-192.

18. Facchetti F, de Wolf-Peeters C, Mason DY, et al. Leukemia-associated lymph nodes infiltrates of plasmacytoid monocytes (so-called plasmacytoid T cells): evidence for two distinct histological and immunophenotypical patterns. Am J Surg Pathol. 1990;14:101-112[Medline] [Order article via Infotrieve].

19. Maldonado-Lopez R, De Smedt T, Michel P, et al. CD8alpha + and CD8alpha - subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 1999;189:587-592[Abstract/Free Full Text].

20. Akbar AN, Lord JM, Salmon M. IFN-alpha and IFN-beta: a link between immune memory and chronic inflammation. Immunol Today. 2000;7:337-342.

21. Farrar JD, Murphy KM. Type I interferons and T helper development. Immunol Today. 2000;10:484-489.

22. Svensson H, Cederblad B, Lindahl M, Alm G. Stimulation of natural interferon-alpha/beta-producing cells by Staphylococcus aureus. J Interferon Res. 1996;16:7-16.

23. Merad M, Fong L, Bogenberger J, Engleman EG. Differentiation of myeloid dendritic cells into CD8alpha -positive dendritic cells in vivo. Blood. 2000;96:1865-1872[Abstract/Free Full Text].

24. Facchetti F, de Wolf-Peters C, Mason DY, Pulford K, van den Oord JJ, Desmet VJ. Plasmacytoid T cells: immunohistochemical evidence for their monocyte/macrophage origin. Am J Pathol. 1988;133:15-21[Abstract].

25. Onishi M, Nagayoshi K, Hirai H, Takaku F, Nakauchi H. CD4dull+ hematopoietic progenitor cells in murine bone marrow. Blood. 1993;81:3217[Abstract/Free Full Text].

26. Björck P, Kincade PW. CD19+ pro-B cells can give rise to dendritic cells in vitro. J Immunol. 1998;161:5795-5799[Abstract/Free Full Text].

27. Kayagaki N, Yamaguchi N, Nakayama M, Eto H, Okamura K, Yagita H. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J Exp Med. 1999;189:1451-1460[Abstract/Free Full Text].

28. Jahnsen FL, Lund-Johansen F, Dunne JF, Farkas L, Haye R, Brandtzaeg P. Experimentally induced recruitment of plasmacytoid (CD123high) dendritic cells in human nasal allergy. J Immunol. 2000;154:4062-4068.

29. Farkas L, Beiske K, Lund-Johansen F, Brandtzaeg P, Jahnsen FL. Plasmacytoid dendritic cells (natural interferon-alpha /beta -producing cells) accumulate in cutaneous lupus erythromatosus lesions. Am J Pathol. 2001;159:237-243[Abstract/Free Full Text].

© 2001 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
T. Abe, Y. Kaname, X. Wen, H. Tani, K. Moriishi, S. Uematsu, O. Takeuchi, K. J. Ishii, T. Kawai, S. Akira, et al.
Baculovirus Induces Type I Interferon Production through Toll-Like Receptor-Dependent and -Independent Pathways in a Cell-Type-Specific Manner
J. Virol., August 1, 2009; 83(15): 7629 - 7640.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. L. Wong, L. F. M. Tang, F. C. Lew, H. S. K. Wong, Y. L. Chua, P. A. MacAry, and D. M. Kemeny
CD44high Memory CD8 T Cells Synergize with CpG DNA to Activate Dendritic Cell IL-12p70 Production
J. Immunol., July 1, 2009; 183(1): 41 - 50.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Merad and M. G. Manz
Dendritic cell homeostasis
Blood, April 9, 2009; 113(15): 3418 - 3427.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Koyama, D. Hashimoto, K. Aoyama, K.-i. Matsuoka, K. Karube, H. Niiro, M. Harada, M. Tanimoto, K. Akashi, and T. Teshima
Plasmacytoid dendritic cells prime alloreactive T cells to mediate graft-versus-host disease as antigen-presenting cells
Blood, February 26, 2009; 113(9): 2088 - 2095.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. J. Workman, Y. Wang, K. C. El Kasmi, D. M. Pardoll, P. J. Murray, C. G. Drake, and D. A. A. Vignali
LAG-3 Regulates Plasmacytoid Dendritic Cell Homeostasis
J. Immunol., February 15, 2009; 182(4): 1885 - 1891.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
A W Thomson and P D Robbins
Tolerogenic dendritic cells for autoimmune disease and transplantation
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii90 - iii96.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Bjorck, A. Beilhack, E. I. Herman, R. S. Negrin, and E. G. Engleman
Plasmacytoid Dendritic Cells Take Up Opsonized Antigen Leading to CD4+ and CD8+ T Cell Activation In Vivo
J. Immunol., September 15, 2008; 181(6): 3811 - 3817.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Niikura, S. Kamiya, K. Kita, and F. Kobayashi
Coinfection with Nonlethal Murine Malaria Parasites Suppresses Pathogenesis Caused by Plasmodium berghei NK65
J. Immunol., May 15, 2008; 180(10): 6877 - 6884.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Marafioti, J. C. Paterson, E. Ballabio, K. K. Reichard, S. Tedoldi, K. Hollowood, M. Dictor, M.-L. Hansmann, S. A. Pileri, M. J. Dyer, et al.
Novel markers of normal and neoplastic human plasmacytoid dendritic cells
Blood, April 1, 2008; 111(7): 3778 - 3792.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Fancke, M. Suter, H. Hochrein, and M. O'Keeffe
M-CSF: a novel plasmacytoid and conventional dendritic cell poietin
Blood, January 1, 2008; 111(1): 150 - 159.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. B. Rasmussen, L. N. Sorensen, L. Malmgaard, N. Ank, J. D. Baines, Z. J. Chen, and S. R. Paludan
Type I Interferon Production during Herpes Simplex Virus Infection Is Controlled by Cell-Type-Specific Viral Recognition through Toll-Like Receptor 9, the Mitochondrial Antiviral Signaling Protein Pathway, and Novel Recognition Systems
J. Virol., December 15, 2007; 81(24): 13315 - 13324.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. J. Lamb, R. J. Capocasale, K. E. Duffy, R. T. Sarisky, and M. L. Mbow
Identification and Characterization of Novel Bone Marrow Myeloid DEC205+Gr-1+ Cell Subsets That Differentially Express Chemokine and TLRs
J. Immunol., June 15, 2007; 178(12): 7833 - 7839.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Tang, W. Zhu, P. B. Silver, S.-B. Su, C.-C. Chan, and R. R. Caspi
Autoimmune Uveitis Elicited with Antigen-Pulsed Dendritic Cells Has a Distinct Clinical Signature and Is Driven by Unique Effector Mechanisms: Initial Encounter with Autoantigen Defines Disease Phenotype
J. Immunol., May 1, 2007; 178(9): 5578 - 5587.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Hosmalin and P. Lebon
Type I interferon production in HIV-infected patients
J. Leukoc. Biol., November 1, 2006; 80(5): 984 - 993.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. Yrlid, V. Cerovic, S. Milling, C. D. Jenkins, J. Zhang, P. R. Crocker, L. S. Klavinskis, and G. G. MacPherson
Plasmacytoid Dendritic Cells Do Not Migrate in Intestinal or Hepatic Lymph
J. Immunol., November 1, 2006; 177(9): 6115 - 6121.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Blasius, E. Giurisato, M. Cella, R. D. Schreiber, A. S. Shaw, and M. Colonna
Bone Marrow Stromal Cell Antigen 2 Is a Specific Marker of Type I IFN-Producing Cells in the Naive Mouse, but a Promiscuous Cell Surface Antigen following IFN Stimulation.
J. Immunol., September 1, 2006; 177(5): 3260 - 3265.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. C. Harman, J. P. Miller, N. Nikbakht, R. Gerstein, and D. Allman
Mouse plasmacytoid dendritic cells derive exclusively from estrogen-resistant myeloid progenitors
Blood, August 1, 2006; 108(3): 878 - 885.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Delhaye, S. Paul, G. Blakqori, M. Minet, F. Weber, P. Staeheli, and T. Michiels
Neurons produce type I interferon during viral encephalitis
PNAS, May 16, 2006; 103(20): 7835 - 7840.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Berhanu, J. Huang, S. M. Alber, S. C. Watkins, and W. J. Storkus
Combinational FLt3 Ligand and Granulocyte Macrophage Colony-Stimulating Factor Treatment Promotes Enhanced Tumor Infiltration by Dendritic Cells and Antitumor CD8+ T-Cell Cross-priming but Is Ineffective as a Therapy.
Cancer Res., May 1, 2006; 66(9): 4895 - 4903.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Roghanian, S. E. Williams, T. A. Sheldrake, T. I. Brown, K. Oberheim, Z. Xing, S. E. M. Howie, and J.-M. Sallenave
The Antimicrobial/Elastase Inhibitor Elafin Regulates Lung Dendritic Cells and Adaptive Immunity
Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 634 - 642.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. Yrlid, S. W. F. Milling, J. L. Miller, S. Cartland, C. D. Jenkins, and G. G. MacPherson
Regulation of Intestinal Dendritic Cell Migration and Activation by Plasmacytoid Dendritic Cells, TNF-{alpha} and Type 1 IFNs after Feeding a TLR7/8 Ligand
J. Immunol., May 1, 2006; 176(9): 5205 - 5212.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Wang, J. Arp, X. Huang, W. Liu, S. Ramcharran, J. Jiang, B. Garcia, N. Kanai, W. Min, P. J. O'Connell, et al.
Distinct Subsets of Dendritic Cells Regulate the Pattern of Acute Xenograft Rejection and Susceptibility to Cyclosporine Therapy
J. Immunol., March 15, 2006; 176(6): 3525 - 3535.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Ito, H. Kanzler, O. Duramad, W. Cao, and Y.-J. Liu
Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells
Blood, March 15, 2006; 107(6): 2423 - 2431.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. O. Kvale, J. Dalgaard, F. Lund-Johansen, H. Rollag, L. Farkas, K. Midtvedt, F. L. Jahnsen, J. E. Brinchmann, and J. Olweus
CD11c+ dendritic cells and plasmacytoid DCs are activated by human cytomegalovirus and retain efficient T cell-stimulatory capability upon infection
Blood, March 1, 2006; 107(5): 2022 - 2029.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Suto, H. Nakajima, N. Tokumasa, H. Takatori, S.-i. Kagami, K. Suzuki, and I. Iwamoto
Murine Plasmacytoid Dendritic Cells Produce IFN-{gamma} upon IL-4 Stimulation
J. Immunol., November 1, 2005; 175(9): 5681 - 5689.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
F. Fallarino, C. Orabona, C. Vacca, R. Bianchi, S. Gizzi, C. Asselin-Paturel, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti
Ligand and cytokine dependence of the immunosuppressive pathway of tryptophan catabolism in plasmacytoid dendritic cells
Int. Immunol., November 1, 2005; 17(11): 1429 - 1438.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Tussiwand, N. Onai, L. Mazzucchelli, and M. G. Manz
Inhibition of Natural Type I IFN-Producing and Dendritic Cell Development by a Small Molecule Receptor Tyrosine Kinase Inhibitor with Flt3 Affinity
J. Immunol., September 15, 2005; 175(6): 3674 - 3680.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Chahroudi, R. Chavan, N. Koyzr, E. K. Waller, G. Silvestri, and M. B. Feinberg
Vaccinia Virus Tropism for Primary Hematolymphoid Cells Is Determined by Restricted Expression of a Unique Virus Receptor
J. Virol., August 15, 2005; 79(16): 10397 - 10407.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Rossi and J. W. Young
Human Dendritic Cells: Potent Antigen-Presenting Cells at the Crossroads of Innate and Adaptive Immunity
J. Immunol., August 1, 2005; 175(3): 1373 - 1381.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. S. Angelov, M. Tomkowiak, A. Marcais, Y. Leverrier, and J. Marvel
Flt3 Ligand-Generated Murine Plasmacytoid and Conventional Dendritic Cells Differ in Their Capacity to Prime Naive CD8 T Cells and to Generate Memory Cells In Vivo
J. Immunol., July 1, 2005; 175(1): 189 - 195.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Omatsu, T. Iyoda, Y. Kimura, A. Maki, M. Ishimori, N. Toyama-Sorimachi, and K. Inaba
Development of Murine Plasmacytoid Dendritic Cells Defined by Increased Expression of an Inhibitory NK Receptor, Ly49Q
J. Immunol., June 1, 2005; 174(11): 6657 - 6662.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Asselin-Paturel, G. Brizard, K. Chemin, A. Boonstra, A. O'Garra, A. Vicari, and G. Trinchieri
Type I interferon dependence of plasmacytoid dendritic cell activation and migration
J. Exp. Med., April 4, 2005; 201(7): 1157 - 1167.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Kamogawa-Schifter, J. Ohkawa, S. Namiki, N. Arai, K.-i. Arai, and Y. Liu
Ly49Q defines 2 pDC subsets in mice
Blood, April 1, 2005; 105(7): 2787 - 2792.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Yang, Z.-X. Lian, K. Kikuchi, Y.-J. Liu, A. A. Ansari, S. Ikehara, and M. E. Gershwin
CD4- Plasmacytoid Dendritic Cells (pDCs) Migrate in Lymph Nodes by CpG Inoculation and Represent a Potent Functional Subset of pDCs
J. Immunol., March 15, 2005; 174(6): 3197 - 3203.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Pulendran
Variegation of the Immune Response with Dendritic Cells and Pathogen Recognition Receptors
J. Immunol., March 1, 2005; 174(5): 2457 - 2465.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
I. J. Fugier-Vivier, F. Rezzoug, Y. Huang, A. J. Graul-Layman, C. L. Schanie, H. Xu, P. M. Chilton, and S. T. Ildstad
Plasmacytoid precursor dendritic cells facilitate allogeneic hematopoietic stem cell engraftment
J. Exp. Med., February 7, 2005; 201(3): 373 - 383.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. McKenna, A.-S. Beignon, and N. Bhardwaj
Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity
J. Virol., January 1, 2005; 79(1): 17 - 27.
[Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Cannarile, N. Decanis, J. P. M. van Meerwijk, and T. Brocker
The Role of Dendritic Cells in Selection of Classical and Nonclassical CD8+ T Cells In Vivo
J. Immunol., October 15, 2004; 173(8): 4799 - 4805.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. P. Halford, J. W. Balliet, and B. M. Gebhardt
Re-Evaluating Natural Resistance to Herpes Simplex Virus Type 1
J. Virol., September 15, 2004; 78(18): 10086 - 10095.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Fallarino, C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti
Murine Plasmacytoid Dendritic Cells Initiate the Immunosuppressive Pathway of Tryptophan Catabolism in Response to CD200 Receptor Engagement
J. Immunol., September 15, 2004; 173(6): 3748 - 3754.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Schlecht, S. Garcia, N. Escriou, A. A. Freitas, C. Leclerc, and G. Dadaglio
Murine plasmacytoid dendritic cells induce effector/memory CD8+ T-cell responses in vivo after viral stimulation
Blood, September 15, 2004; 104(6): 1808 - 1815.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Palamara, S. Meindl, M. Holcmann, P. Luhrs, G. Stingl, and M. Sibilia
Identification and Characterization of pDC-Like Cells in Normal Mouse Skin and Melanomas Treated with Imiquimod
J. Immunol., September 1, 2004; 173(5): 3051 - 3061.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Burke, A. J. Stagg, P. A. Bedford, N. English, and S. C. Knight
IL-10-Producing B220+CD11c- APC in Mouse Spleen
J. Immunol., August 15, 2004; 173(4): 2362 - 2372.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Diao, E. Winter, W. Chen, C. Cantin, and M. S. Cattral
Characterization of Distinct Conventional and Plasmacytoid Dendritic Cell-Committed Precursors in Murine Bone Marrow
J. Immunol., August 1, 2004; 173(3): 1826 - 1833.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al.
From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development
PNAS, June 15, 2004; 101(24): 8981 - 8986.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F.-X. Hubert, C. Voisine, C. Louvet, M. Heslan, and R. Josien
Rat Plasmacytoid Dendritic Cells Are an Abundant Subset of MHC Class II+ CD4+CD11b-OX62- and Type I IFN-Producing Cells That Exhibit Selective Expression of Toll-Like Receptors 7 and 9 and Strong Responsiveness to CpG
J. Immunol., June 15, 2004; 172(12): 7485 - 7494.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Blasius, W. Vermi, A. Krug, F. Facchetti, M. Cella, and M. Colonna
A cell-surface molecule selectively expressed on murine natural interferon-producing cells that blocks secretion of interferon-alpha
Blood, June 1, 2004; 103(11): 4201 - 4206.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Franchini, H. Hefti, S. Vollstedt, B. Glanzmann, M. Riesen, M. Ackermann, P. Chaplin, K. Shortman, and M. Suter
Dendritic Cells from Mice Neonatally Vaccinated with Modified Vaccinia Virus Ankara Transfer Resistance against Herpes Simplex Virus Type I to Naive One-Week-Old Mice
J. Immunol., May 15, 2004; 172(10): 6304 - 6312.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Mazzoni and D. M. Segal
Controlling the Toll road to dendritic cell polarization
J. Leukoc. Biol., May 1, 2004; 75(5): 721 - 730.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Bjorck
Dendritic Cells Exposed to Herpes Simplex Virus In Vivo Do Not Produce IFN-{alpha} after Rechallenge with Virus In Vitro and Exhibit Decreased T Cell Alloreactivity
J. Immunol., May 1, 2004; 172(9): 5396 - 5404.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. J. Masten, G. K. Olson, D. F. Kusewitt, and M. F. Lipscomb
Flt3 Ligand Preferentially Increases the Number of Functionally Active Myeloid Dendritic Cells in the Lungs of Mice
J. Immunol., April 1, 2004; 172(7): 4077 - 4083.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Schiavoni, F. Mattei, P. Borghi, P. Sestili, M. Venditti, H. C. Morse III, F. Belardelli, and L. Gabriele
ICSBP is critically involved in the normal development and trafficking of Langerhans cells and dermal dendritic cells
Blood, March 15, 2004; 103(6): 2221 - 2228.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Salio, M. J. Palmowski, A. Atzberger, I. F. Hermans, and V. Cerundolo
CpG-matured Murine Plasmacytoid Dendritic Cells Are Capable of In Vivo Priming of Functional CD8 T Cell Responses to Endogenous but Not Exogenous Antigens
J. Exp. Med., February 17, 2004; 199(4): 567 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Dakic, Q.-x. Shao, A. D'Amico, M. O'Keeffe, W.-f. Chen, K. Shortman, and L. Wu
Development of the Dendritic Cell System during Mouse Ontogeny
J. Immunol., January 15, 2004; 172(2): 1018 - 1027.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Asselin-Paturel, G. Brizard, J.-J. Pin, F. Briere, and G. Trinchieri
Mouse Strain Differences in Plasmacytoid Dendritic Cell Frequency and Function Revealed by a Novel Monoclonal Antibody
J. Immunol., December 15, 2003; 171(12): 6466 - 6477.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. F. Hoyne
Notch signaling in the immune system
J. Leukoc. Biol., December 1, 2003; 74(6): 971 - 981.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
F. J. Hernandez-Ilizaliturri, V. Jupudy, J. Ostberg, E. Oflazoglu, A. Huberman, E. Repasky, and M. S. Czuczman
Neutrophils Contribute to the Biological Antitumor Activity of Rituximab in a Non-Hodgkin's Lymphoma Severe Combined Immunodeficiency Mouse Model
Clin. Cancer Res., December 1, 2003; 9(16): 5866 - 5873.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Hartmann, B. Wollenberg, S. Rothenfusser, M. Wagner, D. Wellisch, B. Mack, T. Giese, O. Gires, S. Endres, and G. Hartmann
Identification and Functional Analysis of Tumor-Infiltrating Plasmacytoid Dendritic Cells in Head and Neck Cancer
Cancer Res., October 1, 2003; 63(19): 6478 - 6487.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. D'Amico and L. Wu
The Early Progenitors of Mouse Dendritic Cells and Plasmacytoid Predendritic Cells Are within the Bone Marrow Hemopoietic Precursors Expressing Flt3
J. Exp. Med., July 21, 2003; 198(2): 293 - 303.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Karsunky, M. Merad, A. Cozzio, I. L. Weissman, and M. G. Manz
Flt3 Ligand Regulates Dendritic Cell Development from Flt3+ Lymphoid and Myeloid-committed Progenitors to Flt3+ Dendritic Cells In Vivo
J. Exp. Med., July 21, 2003; 198(2): 305 - 313.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. D. Edwards, D. Chaussabel, S. Tomlinson, O. Schulz, A. Sher, and C. Reis e Sousa
Relationships Among Murine CD11chigh Dendritic Cell Subsets as Revealed by Baseline Gene Expression Patterns
J. Immunol., July 1, 2003; 171(1): 47 - 60.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. Muraille, C. De Trez, B. Pajak, F. A. Torrentera, P. De Baetselier, O. Leo, and Y. Carlier
Amastigote Load and Cell Surface Phenotype of Infected Cells from Lesions and Lymph Nodes of Susceptible and Resistant Mice Infected with Leishmania major
Infect. Immun., May 1, 2003; 71(5): 2704 - 2715.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Smith, G. T. Belz, N. S. Wilson, J. A. Villadangos, K. Shortman, F. R. Carbone, and W. R. Heath
Cutting Edge: Conventional CD8{alpha}+ Dendritic Cells Are Preferentially Involved in CTL Priming After Footpad Infection with Herpes Simplex Virus-1
J. Immunol., May 1, 2003; 170(9): 4437 - 4440.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J.-F. Fonteneau, M. Gilliet, M. Larsson, I. Dasilva, C. Munz, Y.-J. Liu, and N. Bhardwaj
Activation of influenza virus-specific CD4+ and CD8+ T cells: a new role for plasmacytoid dendritic cells in adaptive immunity
Blood, May 1, 2003; 101(9): 3520 - 3526.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Krug, R. Veeraswamy, A. Pekosz, O. Kanagawa, E. R. Unanue, M. Colonna, and M. Cella
Interferon-producing Cells Fail to Induce Proliferation of Naive T Cells but Can Promote Expansion and T Helper 1 Differentiation of Antigen-experienced Unpolarized T Cells
J. Exp. Med., April 7, 2003; 197(7): 899 - 906.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Dalod, T. Hamilton, R. Salomon, T. P. Salazar-Mather, S. C. Henry, J. D. Hamilton, and C. A. Biron
Dendritic Cell Responses to Early Murine Cytomegalovirus Infection: Subset Functional Specialization and Differential Regulation by Interferon {alpha}/{beta}
J. Exp. Med., April 7, 2003; 197(7): 885 - 898.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. M. Woltman and C. van Kooten
Functional modulation of dendritic cells to suppress adaptive immune responses
J. Leukoc. Biol., April 1, 2003; 73(4): 428 - 441.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. Pullarkat, P. P. Lee, R. Scotland, V. Rubio, S. Groshen, C. Gee, R. Lau, J. Snively, S. Sian, S. L. Woulfe, et al.
A Phase I Trial of SD-9427 (Progenipoietin) with a Multipeptide Vaccine for Resected Metastatic Melanoma
Clin. Cancer Res., April 1, 2003; 9(4): 1301 - 1312.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Vollstedt, M. Franchini, H. P. Hefti, B. Odermatt, M. O'Keeffe, G. Alber, B. Glanzmann, M. Riesen, M. Ackermann, and M. Suter
Flt3 Ligand-treated Neonatal Mice Have Increased Innate Immunity Against Intracellular Pathogens and Efficiently Control Virus Infections
J. Exp. Med., March 3, 2003; 197(5): 575 - 584.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z.-X. Lian, T. Okada, X.-S. He, H. Kita, Y.-J. Liu, A. A. Ansari, K. Kikuchi, S. Ikehara, and M. E. Gershwin
Heterogeneity of Dendritic Cells in the Mouse Liver: Identification and Characterization of Four Distinct Populations
J. Immunol., March 1, 2003; 170(5): 2323 - 2330.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kambayashi, E. Assarsson, A. E. Lukacher, H.-G. Ljunggren, and P. E. Jensen
Memory CD8+ T Cells Provide an Early Source of IFN-{gamma}
J. Immunol., March 1, 2003; 170(5): 2399 - 2408.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Oida, X. Zhang, M. Goto, S. Hachimura, M. Totsuka, S. Kaminogawa, and H. L. Weiner
CD4+CD25- T Cells That Express Latency-Associated Peptide on the Surface Suppress CD4+CD45RBhigh-Induced Colitis by a TGF-{beta}-Dependent Mechanism
J. Immunol., March 1, 2003; 170(5): 2516 - 2522.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. O'Keeffe, H. Hochrein, D. Vremec, B. Scott, P. Hertzog, L. Tatarczuch, and K. Shortman
Dendritic cell precursor populations of mouse blood: identification of the murine homologues of human blood plasmacytoid pre-DC2 and CD11c+ DC1 precursors
Blood, February 15, 2003; 101(4): 1453 - 1459.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A H Lau and A W Thomson
Dendritic cells and immune regulation in the liver
Gut, February 1, 2003; 52(2): 307 - 314.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Boonstra, C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y.-J. Liu, and A. O'Garra
Flexibility of Mouse Classical and Plasmacytoid-derived Dendritic Cells in Directing T Helper Type 1 and 2 Cell Development: Dependency on Antigen Dose and Differential Toll-like Receptor Ligation
J. Exp. Med., January 6, 2003; 197(1): 101 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. L. Miller and E. M. Anders
Virus-cell interactions in the induction of type 1 interferon by influenza virus in mouse spleen cells
J. Gen. Virol., January 1, 2003; 84(1): 193 - 202.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Aliberti, O. Schulz, D. J. Pennington, H. Tsujimura, C. R. e Sousa, K. Ozato, and A. Sher
Essential role for ICSBP in the in vivo development of murine CD8alpha + dendritic cells
Blood, January 1, 2003; 101(1): 305 - 310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Brawand, D. R. Fitzpatrick, B. W. Greenfield, K. Brasel, C. R. Maliszewski, and T. De Smedt
Murine Plasmacytoid Pre-Dendritic Cells Generated from Flt3 Ligand-Supplemented Bone Marrow Cultures Are Immature APCs
J. Immunol., December 15, 2002; 169(12): 6711 - 6719.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. Schiavoni, F. Mattei, P. Sestili, P. Borghi, M. Venditti, H. C. Morse III, F. Belardelli, and L. Gabriele
ICSBP Is Essential for the Development of Mouse Type I Interferon-producing Cells and for the Generation and Activation of CD8{alpha}+ Dendritic Cells
J. Exp. Med., December 2, 2002; 196(11): 1415 - 1425.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Krug, R. Uppaluri, F. Facchetti, B. G. Dorner, K. C. F. Sheehan, R. D. Schreiber, M. Cella, and M. Colonna
Cutting Edge: IFN-Producing Cells Respond to CXCR3 Ligands in the Presence of CXCL12 and Secrete Inflammatory Chemokines upon Activation
J. Immunol., December 1, 2002; 169(11): 6079 - 6083.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. J. Weigel, N. Nath, P. A. Taylor, A. Panoskaltsis-Mortari, W. Chen, A. M. Krieg, K. Brasel, and B. R. Blazar
Comparative analysis of murine marrow-derived dendritic cells generated by Flt3L or GM-CSF/IL-4 and matured with immune stimulatory agents on the in vivo induction of antileukemia responses
Blood, December 1, 2002; 100(12): 4169 - 4176.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. O'Keeffe, H. Hochrein, D. Vremec, I. Caminschi, J. L. Miller, E. M. Anders, L. Wu, M. H. Lahoud, S. Henri, B. Scott, et al.
Mouse Plasmacytoid Cells: Long-lived Cells, Heterogeneous in Surface Phenotype and Function, that Differentiate Into CD8+ Dendritic Cells Only after Microbial Stimulus
J. Exp. Med., November 18, 2002; 196(10): 1307 - 1319.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Ferrero, W. Held, A. Wilson, F. Tacchini-Cottier, F. Radtke, and H. R. MacDonald
Mouse CD11c+ B220+ Gr1+ plasmacytoid dendritic cells develop independently of the T-cell lineage
Blood, September 26, 2002; 100(8): 2852 - 2857.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. M.M. den Haan and M. J. Bevan
Constitutive versus Activation-dependent Cross-Presentation of Immune Complexes by CD8+ and CD8- Dendritic Cells In Vivo
J. Exp. Med., September 16, 2002; 196(6): 817 - 827.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. H. Ahn, Y. Lee, C. Jeon, S.-J. Lee, B.-H. Lee, K. D. Choi, and Y.-S. Bae
Identification of the genes differentially expressed in human dendritic cell subsets by cDNA subtraction and microarray analysis
Blood, August 13, 2002; 100(5): 1742 - 1754.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Martin, G. M. del Hoyo, F. Anjuere, C. F. Arias, H. H. Vargas, A. Fernandez-L, V. Parrillas, and C. Ardavin
Characterization of a new subpopulation of mouse CD8alpha + B220+ dendritic cells endowed with type 1 interferon production capacity and tolerogenic potential
Blood, June 28, 2002; 100(2): 383 - 390.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Gilliet, A. Boonstra, C. Paturel, S. Antonenko, X.-L. Xu, G. Trinchieri, A. O'Garra, and Y.-J. Liu
The Development of Murine Plasmacytoid Dendritic Cell Precursors Is Differentially Regulated by FLT3-ligand and Granulocyte/Macrophage Colony-Stimulating Factor
J. Exp. Med., April 1, 2002; 195(7): 953 - 958.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Björck, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Björck, P.
Related Collections
Right arrow Immunobiology
Right arrow Plenary Papers
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020