| |
|
|
|
|
|
|
|||
|
RED CELLS
From the Transfusion Medicine Laboratory, Department of
Medical Research, and the Immunohematology Reference Laboratory, Mackay
Memorial Hospital, Taipei, Taiwan.
The human blood group i and I antigens are characterized as linear
and branched repeats of N-acetyllactosamine, respectively. Conversion of the i to the I structure requires the activity of I-branching In 1956, Wiener et al1 first gave the
name I to an antigen detected by a cold agglutinating autoantibody
called anti-I. They found that red blood cells (RBCs) of only a small
percentage of persons (5 of 22 000) were nonreactive to anti-I, and
this phenotype was called I-negative. Later studies found that cord blood cells contained a very weak I antigen.2,3 In 1960, Marsh and Jenkins4 described the first cold agglutinating
antibody, named anti-i, which behaved in an opposite manner to
anti-I The Ii antigenic determinants have been elucidated through various
studies.13-16 They are carbohydrate structures carried on glycolipids and glycoproteins and are present on the interior structures of the complex carbohydrate chains bearing ABH and Lewis
antigens. Based on type 2 Gal
In 1993, Bierhuizen et al18 reported the expression cloning
of a cDNA encoding an I-branching The adult i phenotype should provide a means of demonstrating the gene
responsible for blood group I antigen expression. Similar investigations have been of great value in confirming the identities of
several blood group genes Molecular genetic analysis of the adult i phenotype may provide a means
of identifying the blood group I gene, but it also may
facilitate progress in uncovering the basis for the association of the
adult i phenotype with a frequent occurrence of congenital cataracts in
Asians. Three Taiwanese adult i pedigrees were previously identified27; the 5 members with adult i phenotype all have congenital cataracts, whereas none of the other 17 members with I
phenotype do. In this report we describe the findings of molecular genetic studies of these 3 pedigrees, in which the 2 reported I-branching Samples
Reverse transcription-polymerase chain reaction and cloning of
the IGnT and C2GnT-M genes
RT-PCR for the PCR amplifications of the 3 exon regions of the IGnT gene were achieved by using primer pairs of IFb and IRd (CCTAATAAAAAGTGGCTGGTTATTCTAAAGCC, antisense sequence, 50 nucleotides downstream of exon 1), IFh (TCCCTTCTCTCATGACTCTCATCTCTACGC, 22 nucleotides upstream of exon 2) and IRk (ACACCAACAGGCAGCGGCCT-AGAAGCATGG, antisense sequence, 14 nucleotides downstream of exon 2), and IFg (GTCGGAGAGTACCTCTAGTATTCTGTAAGTTC, 57 nucleotides upstream of exon 3) and IRc. PCR conditions were similar to those described above, except that annealing occurred at 60°C for 1 minute and extension at 72°C for 1 minute. PCR-sequence specific primer-restriction fragment length polymorphism analysis A PCR-sequence specific primer (SSP) conjoining the restriction fragment length polymorphism (RFLP) method was developed to detect the 1043G A and 1148G A mutations identified in the IGnT alleles. Wild-type and mutant oligonucleotide primers, w
(GGTATTTGTATCTATGGA) and m (GGTATTTGTATCTATGAA), were designed and
annealed to the IGnT gene with wild-type G nucleotide at
position 1043 and to the mutant Ii1
allele with A nucleotide at position 1043 under appropriate
temperatures, respectively. One hundred nanograms genomic DNA and 10 pmol each forward (w or m) and reverse (IRc) primer were combined in
PCR buffer containing 0.2 mM dNTP and 0.5 U hot-start Taq
polymerase. The PCR program included 15 minutes at 95°C followed by
30 cycles of 30 seconds at 94°C, 30 seconds at 54°C (for w+IRc
primers) or 50°C (for m+IRc primers), and 30 seconds at 72°C. The
amplified 218-bp fragment encompasses the 1148 nucleotide position. As
the 1148G A mutation of the mutant Ii2
allele destroys a BstUI recognition sequence (CGCG), the PCR products were subjected to digestion by BstUI restriction
endonuclease and then were analyzed by 2.0% agarose gel
electrophoresis. The 218-bp PCR product amplified from the allele with
wild-type 1148 nucleotide was cleaved into 122- and 96-bp fragments by
BstUI digestion, whereas that from the mutant allele with
1148G A mutation was resistant to digestion.
Functional analyses of the wild-type and mutant IGnT genes cDNA fragments encompassing the region of nucleotides 88 to 1200, which encode the amino acid residues 30 to 400, of the I, Ii1, and Ii2 genes were prepared using the OneStep RT-PCR Kit (Qiagen) and primers of IFw (aattggcccagccggccGATCCAAGCTTCCAAAGGCTAAATATC) and IRx (ttaagggcccAAAATACCAGCTGGGTTGTATCGCAG, antisense sequence), which contained SfiI and ApaI recognition sequences (underlined) at their 5' ends, respectively. Total RNAs obtained from W-1 and W-2 members of pedigree W served as templates. Amplified cDNA fragments were cloned into SfiI and ApaI sites of the mammalian expression vector pSecTaq2A (Invitrogen), which is designed for the secretion of the expressed protein by the N-terminal secretion signal from the V-J2-C region of mouse immunoglobulin chain. Vectors bearing wild-type I,
Ii1, and
Ii2 cDNAs were selected and
sequence-confirmed, leading to the construction of
pSecTaq2A-I, pSecTaq2A-Ii1,
and pSecTaq2A-Ii2, respectively. The 3 constructed and the mock pSecTaq2A plasmids were prepared for
transfection using the EndoFree Plasmid Kit (Qiagen).
COS-7 cells (purchased from the American Type Culture Collection, Manassas, VA) were grown in 90% Dulbecco modified eagle medium and 10% fetal bovine serum containing 50 U/mL penicillin and 50 µg/mL streptomycin. The day before transfection, cells were split into 60-mm culture dishes at a density of 5 × 104/mL; after culture for 24 hours, cells were transfected with 1 µg expression vector. Transfection of the cells was performed using Effectene Transfection Reagent (Qiagen). After culture for an additional 72 hours, the medium was harvested and then concentrated 50-fold by Centriplus YM-10 (Millipore Intertech, Bedford, MA) and directly used for GlcNAc-transferase assay. The GlcNAc-transferase assay was performed in a 25-µL reaction
mixture containing 50 mM cacodylic acid (sodium salt, pH 7.0), 20 mM
MnCl2, 4 mM ATP, 10 mM D-galactonic acid
Missense mutations were identified in the IGnT gene, but not in the C2GnT-M gene, of adult i propositi The coding regions of the IGnT and C2GnT-M of the adult i propositus, member 6 of pedigree S (denoted as S-6), were amplified and cloned, and the sequences were determined. Eight IGnT clones from the S-6 propositus were analyzed, and all were found to have a nucleotide substitution of G to A at position 1043, which predicts an amino acid alteration of Gly to Glu at residue 348 (Figure 2). Direct sequencing of the RT-PCR product of IGnT cDNA also demonstrated the 1043G A
substitution. Taken together, these results suggest that the S-6
propositus was most likely homozygous for the 1043G A mutation in the
IGnT gene. Analysis of sequences of 4 C2GnT-M
clones from S-6 revealed nucleotide substitutions in these clones, but
none had identical mutations. Direct sequencing of the PCR product of
the C2GnT-M gene yielded the expected sequence of the
wild-type gene and suggested that the mutations in the clones were due
to PCR errors. These results support the proposition that the
C2GnT-M gene of the adult i propositus (S-6) had a wild-type coding sequence.
The IGnT gene of another adult i propositus, member 3 of
pedigree W (denoted as W-3), was also analyzed. Three of the 5 IGnT clones from this propositus also demonstrated the
1043G The identified mutant IGnT alleles with the 1043G Linkage of double-dose mutant IGnT alleles with i members, but not with I members, in the 2 pedigrees A PCR-SSP-RFLP analysis was developed to detect the mutations of the Ii1 and Ii2 alleles. By using the plasmid clones bearing the wild-type I, Ii1, and Ii2 cDNA segments as control templates, the system showed specificity in distinguishing the 3 alleles (Figure 3A-B, lower panels). The wild-type I allele yielded a PCR product when the wild-type primer set (w+IRc) was used, but not when the mutant primer set (m+IRc) was used. The amplified 218-bp fragment was cleaved to 122- and 96-bp products by BstUI digestion. PCR product was produced from the Ii1 allele only when the mutant primer set was used. The product was also cleaved into 122- and 96-bp fragments by BstUI. The Ii2 allele yielded 218-bp product from wild-type primer, and the fragment was resistant to the BstUI digestion because of the 1148G A mutation.
Using this method, the I locus genotypes of the
members of pedigrees S and W were demonstrated. As shown in Figure 3A,
another adult i member of the pedigree S, S-7, was demonstrated to be homozygous for the Ii1 allele, as had
been shown for the S-6 propositus. All the other members were I
phenotype and had at least one wild-type I allele, having
either I/I or
I/Ii1 genotypes. In the
pedigree W, the
Ii1/Ii2
genotype was also demonstrated in another i member, W-5 (Figure 3B).
Her sister, W-4, was a heterozygote with the
I/Ii1 genotype and had the
common I phenotype. The father and mother had
I/Ii2 and
I/Ii1 genotypes, respectively,
as demonstrated by cloning and PCR-SSP-RFLP analyses. Obviously the
heterozygous
Ii1/Ii2
genotype of the W-3 and W-5 i adults resulted from the segregation of
the mutant IGnT alleles from her mother and father with
their respective 1043G The Ii1 and Ii2 mutant alleles are rare in the general population The PCR-SSP-RFLP method was used to inspect the incidence of the Ii1 and Ii2 alleles in the general population. Genomic DNA obtained from 51 randomly selected persons were screened, and none of them had the mutations of 1043G A or 1148G A in their IGnT genes
(data not shown). The result indicates that the
Ii1 and Ii2
alleles are infrequent, and agrees with the observation of rareness of
the adult i phenotype.
Deletion of the IGnT gene was observed in a person with adult i phenotype A different molecular basis for the adult i phenotype was observed in the pedigree C (Figure 4). RT-PCR of peripheral blood cell RNA of the member with adult i phenotype (C-3) failed to amplify the IGnT cDNA (Figure 4B). However, RNA samples from other members with I phenotype, C-1, C-2, and C-4, yielded products of IGnT cDNA. Each of the 3 exon regions of the IGnT gene of the families was examined by PCR. PCR products with the expected sizes for IGnT exon 1, exon 2, and exon 3 regions were produced from genomic DNA samples of the 3 I members, whereas genomic DNA sample of C-3 failed to yield any product for the IGnT exon regions (Figure 4C). The -actin and
the C2GnT-M genes served as controls for the RT-PCR and PCR
reactions, respectively, and demonstrated the integrity of RNA and
genomic DNA samples of C-3.
The results showed that the chromosome region of the IGnT gene was totally absent in the C-3 i adult but appeared intact (at least for one allele) and was expressed normally in the other I members. This evidence further supports that the IGnT gene is responsible for the expression of blood group I antigen. Enzyme activity of the I A and 1148G A mutations, respectively, on the enzyme
activity of I 6GlcNAc-T were inspected and compared using a
functional assay. Table 1 lists the
amounts of GlcNAc transferred to the acceptor substrate,
LS-tetrasaccharide c, from the donor substrate UDP-GlcNAc by the
medium concentrates harvested from the cells transfected with the
respective expression vectors. LS-tetrasaccharide c has been shown to
be a good acceptor substrate for 6GlcNAc-T transferase
assay.31 Medium harvested from the cells transfected with
the expression vector bearing the wild-type I cDNA segment
displayed GlcNAc-transferring activity in the assay. In contrast,
medium from the cells transfected with vectors constructed with the
Ii1 and Ii2
cDNAs, respectively, had virtually no detectable activity because the
amounts of GlcNAc transferred were at the same level as the mock
control pSecTaq2A. These findings indicate that the Gly348Glu or
Arg383His alterations in I 6GlcNAc-T totally abolished the original
GlcNAc-transferase activity.
Molecular genetic analyses of the 3 adult i pedigrees demonstrated
3 different molecular origins for the adult i phenotype and suggest
that the IGnT gene is the locus responsible for the expression of the human blood group I antigen. Although the I antigen
was first identified more than 40 years ago, it is one of the few human
blood groups for which the responsible gene locus remains unconfirmed.
Even though the IGnT gene has been identified and its
protein product was demonstrated several years ago to have I-branching
forming capability, it has not been approved as the human blood group
I gene because it is believed that more than one I-branching
enzymes may exist. It has been suggested that different I-branching
enzymes may be responsible for the synthesis of I antigens in different
tissues.10 The identification of another I-branching
enzyme encoding gene, C2GnT-M, has further complicated
efforts to identity the blood group I gene, though it is not
surprising that another I-branching The IGnT gene, identified by Bierhuizen et al18
in 1993, encodes a Confirmation of the I gene locus will allow further
investigation of the gene regulation mechanism(s) for differential
expression of I antigen during developmental and oncogenesis processes,
and it will further assist in the investigations of the molecular genetics that control I antigen expression in secretions and the molecular basis for the association of the adult i phenotype with congenital cataracts in Asians. Synthesis of I antigens in different tissues has been suggested to result from different I-branching enzymes
given that normal quantities of I antigen in saliva, milk, and plasma
of persons with adult i phenotype has been observed.37,38 A similar situation has been demonstrated in the formation of blood
group H antigens in RBC membrane and in saliva, which are synthesized
by the action of different Identification of the molecular origins of the adult i phenotype in the 3 pedigrees still leaves the molecular genetic basis of its association with congenital cataracts in Asians obscure for the present. The association can be explained by either a close linkage between independent I- and cataract-related genes or a pleiotropic effect of the gene responsible for the adult i phenotype on the development of cataracts.24,25 Because of the reduced association between adult i phenotype and congenital cataracts in the white population, the former hypothesis of a close linkage of 2 independent genes was suggested to be the tenable one.28 It has been proposed that the adult i phenotype in Asians, and in some whites, may result from the deletion of a small chromosomal region that also encompasses a nearby gene, and this results in the development of cataracts.10 In our study, chromosomal deletion was detected in one person with adult i in 1 of our 3 pedigrees; however, the molecular basis of the adult i phenotype in the other 2 pedigrees consisted of single nucleotide substitutions in the I gene that occurred at 2 different positions. It is unlikely that 2 different mutational changes would be linked to the same nearby gene that had, by chance, also mutated to a form that resulted in the development of cataracts. Elucidation of the molecular genetic basis of persons with adult i without congenital cataracts may help explain the association in Asians.
Submitted June 11, 2001; accepted August 13, 2001.
Supported in part by National Health Research Institute grant NHRI-EX90-8601SL (M.L.) and National Science Council grant NSC 89-2314-B-195-014 (L.-C.Y.)
Nucleotide sequences reported in this paper have been submitted to the GenBank/EBI Data Bank with accession numbers AF401652 and AF401653.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Marie Lin, Transfusion Medicine Laboratory, Mackay Memorial Hospital, 45 Ming-San Rd, Tamshui, Taipei County 251, Taiwan; e-mail: marilin{at}ms2.mmh.org.tw.
1. Wiener AS, Unger LJ, Cohen L, Feldman J. Type-specific cold auto-antibodies as a cause of acquired hemolytic anemia and hemolytic transfusion reactions: biological test with bovine red cells. Ann Intern Med. 1956;44:221-240. 2. Jenkins WJ, Marsh WL, Noades J, Tippett P, Sanger R, Race RR. The I antigen and antibody. Vox Sang. 1960;5:97-106. 3. Tippett P, Noades J, Sanger R, et al. Further studies of the I antigen and antibody. Vox Sang. 1960;5:107-121. 4. Marsh WL, Jenkins WJ. Anti-i: a new cold antibody [commentary]. Nature (London). 1960;188:753[Medline] [Order article via Infotrieve]. 5. Marsh WL. Anti-i: a cold antibody defining the Ii relationship in human red cells. Br J Haematol. 1961;7:200-209. 6. Marsh WL, Nichols ME, Reid ME. The definition of two I antigen components. Vox Sang. 1971;20:209-217[Medline] [Order article via Infotrieve]. 7. Clausen H, Hakomori S. ABH and related histo-blood group antigens: immunochemical differences in carrier isotypes and their distribution. Vox Sang. 1989;56:1-20[Medline] [Order article via Infotrieve]. 8. Rouger P, Juszczak G, Doinel C, Salmon C. Relationship between I and H antigens, I: a study of the plasma and saliva of a normal population. Transfusion. 1980;20:536-539[CrossRef][Medline] [Order article via Infotrieve]. 9. Marsh WL, Nichols ME, Allen FH. Inhibition of anti-I sera by human milk. Vox Sang. 1970;18:149-154[Medline] [Order article via Infotrieve]. 10. Daniels G. Human Blood Groups. Oxford, England: Blackwell Science; 1995. 11. Hakomori S, Kannagi R. Glycosphingolipids as tumor-associated and differentiation markers. J Natl Cancer Inst. 1983;71:231-251. 12. Feizi T. Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature (London). 1985;314:53-56[CrossRef][Medline] [Order article via Infotrieve]. 13. Neimann H, Watanabe K, Hakomori S, Childs RA, Feizi T. Blood group i and I activities of `lacto-N-nor-hexaosylceramide' and its analogues: the structural requirements for i-specificity. Biochem Biophys Res Commun. 1978;81:1286-1293[CrossRef][Medline] [Order article via Infotrieve].
14.
Watanabe K, Hakomori S, Childs RA, Feizi T.
Characterization of a blood group I-active ganglioside.
J Biol Chem.
1979;254:3221-3228 15. Koscielak J, Zdebska E, Wilczynska Z, Miller-Podraza H, Dzierzkowa-Borodej W. Immunochemistry of Ii-activity glycosphingolipids. Eur J Biochem. 1979;96:331-337[Medline] [Order article via Infotrieve].
16.
Fukuda M, Fukuda M, Hakomori S.
Developmental change and genetic defect in the carbohydrate structure of band 3 glycoprotein of human erythrocyte membrane.
J Biol Chem.
1979;254:3700-3703
17.
Piller F, Cartron J-P.
Biosynthesis of blood group I antigens.
J Biol Chem.
1984;259:13385-13390
18.
Bierhuizen MFA, Mattei M-G, Fukuda M.
Expression of the developmental I antigen by a cloned human cDNA encoding a member of a
19.
Yeh J-C, Ong E, Fukuda M.
Molecular cloning and expression of a novel
20.
Schwientek T, Nomoto M, Levery SB, et al.
Control of O-glycan branch formation.
J Biol Chem.
1999;274:4504-4512
21.
Mollicone R, Reguine I, Kelly RJ, et al.
Molecular basis for Lewis
22.
Kelly RJ, Reguine S, Giorgi D, Lennon GG, Lowe JB.
Sequence and expression of a candidate for the human Secretor blood group
23.
Steffensen R, Carlier K, Wiels J, et al.
Cloning and expression of the histo-blood group Pk UDP-galactose: Gal 24. Yamaguchi H, Okubo Y, Tanaka M. A note on possible close linkage between the Ii blood locus and a congenital cataract locus. Proc Japan Acad. 1972;48:625-628. 25. Ogata H, Okubo Y, Akabane T. Phenotype i associated with congenital cataract in Japanese. Transfusion. 1979;19:166-168[CrossRef][Medline] [Order article via Infotrieve]. 26. Okubo Y, Yamaguchi H. I-negative phenotype and cataract. In: Program and abstracts of the XIX Congress of the International Society of Blood Transfusion; 1986; Sydney, Australia. Abstract 147. 27. Lin-Chu M, Broadberry RE, Okubo Y, Tanaka M. The i phenotype and congenital cataracts among Chinese in Taiwan [letter]. Transfusion. 1991;31:676-677[Medline] [Order article via Infotrieve]. 28. Marsh WL, DePalma H. Association between the Ii blood group and congenital cataract. Transfusion. 1982;22:337-338[CrossRef][Medline] [Order article via Infotrieve]. 29. Macdonald EB, Douglas R, Harden PA. A Caucasian family with the i phenotype and congenital cataracts. Vox Sang. 1983;44:322-325[Medline] [Order article via Infotrieve]. 30. Page PL, Langevin S, Petersen RA, Kruskall MS. Reduced association between the Ii blood group and congenital cataracts in white patients. Am J Clin Pathol. 1987;87:101-102[Medline] [Order article via Infotrieve].
31.
Chen GY, Kurosawa N, Muramatsu T.
A novel variant form of murine 32. Issitt PD, Anstee DJ. Applied Blood Group Serology. Durham, NC: Montgomery Scientific Publications; 1998.
33.
Bierhuizen MFA, Maemura K, Kudo S, Fukuda M.
Genomic organization of core 2 and I branching 34. Leppänen A, Salminen H, Zhu Y, et al. In vitro biosynthesis of a decasaccharide prototype of multiply branched polylactosaminoglycan backbones. Biochemistry. 1997;36:7026-7036[CrossRef][Medline] [Order article via Infotrieve].
35.
Leppänen A, Zhu Y, Maaheimo H, Helin J, Lehtonen E, Renkonen O.
Biosynthesis of branched polylactosaminoglycans.
J Biol Chem.
1998;273:17399-17405
36.
Mattila P, Salminen H, Hirvas L, et al.
The centrally acting 37. Dzierzkowa-Borodej W, Seyfried H, Nichols M, Reid M, Marsh WL. The recognition of water-soluble I blood group substance. Vox Sang. 1970;18:222-234[Medline] [Order article via Infotrieve]. 38. Marsh WL, Jensen L, Decary F, Colledge K. Water-soluble I blood group substance in the secretions of i adults. Transfusion. 1972;12:222-226[Medline] [Order article via Infotrieve]. 39. Watkins WM. Molecular basis of antigenic specificity: the ABO, H and Lewis blood group system. In: Montreuil J,Schachter H,Vliegenthart JFG, eds. Glycoproteins. Amsterdam: Elsevier Science; 1995:313-390.
© 2001 by The American Society of Hematology.
|
![]() |
Y.-C. Twu, C.-P. Chen, C.-Y. Hsieh, C.-H. Tzeng, C.-F. Sun, S.-H. Wang, M.-S. Chang, and L.-C. Yu I branching formation in erythroid differentiation is regulated by transcription factor C/EBP{alpha} Blood, December 15, 2007; 110(13): 4526 - 4534. [Abstract] [Full Text] [PDF] |