|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Departments of Pathology and Medicine, Beth
Israel Deaconess Medical Center, Harvard Medical School, Boston, MA;
the New England Research Institutes, Watertown, MA; the Blood Centers
of the Pacific, Irwin Center and the University of California, San
Francisco; and the Division of Infectious Diseases and Center for AIDS
Research, Case Western Reserve University School of Medicine and
University Hospitals of Cleveland, OH.
The appearance and expansion of donor white blood cells in a
recipient after transfusion has many potential biologic ramifications. Although patients with HIV infection are ostensibly at high risk for
microchimerism, transfusion-associated graft-versus-host disease (TA-GVHD) is rare. The purpose of this study was to search for sustained microchimerism in such patients. Blood samples were collected
from 93 HIV-infected women (a subset from the Viral Activation
Transfusion Study, an NHLBI multicenter randomized trial comparing
leukoreduced versus unmodified red blood cell [RBC] transfusions)
before and after transfusions from male donors. Donor lymphocytes were
detected in posttransfusion specimens using a quantitative
Y-chromosome-specific polymerase chain reaction (PCR) assay, and
donor-specific human leukocyte antigen (HLA) alleles were identified
with allele-specific PCR primers and probes. Five of 47 subjects
randomized to receive nonleukoreduced RBCs had detectable male
lymphocytes 1 to 2 weeks after transfusion, but no subject had
detectable male cells more than 4 weeks after a transfusion. In 4 subjects studied, donor-specific HLA haplotypes were detected in
posttransfusion specimens, consistent with one or more donors' cells.
None of 46 subjects randomized to receive leukoreduced RBCs had
detectable male lymphocytes in the month after transfusion. Development
of sustained microchimerism after transfusion in HIV-infected patients
is rare; HIV-infected patients do not appear to be at risk for
TA-GVHD.
(Blood. 2001;98:272-279) The appearance and persistence of foreign
(allogeneic) white blood cells (WBCs) in a recipient through
transplantation, transfusion, or pregnancy has the potential for
far-reaching biologic ramifications.1 Transfused WBCs have
been associated with febrile transfusion reactions, alloimmunization
and subsequent platelet refractoriness,2 transmission of
cytomegalovirus (CMV) and other infections,3 up-regulation
or reactivation of latent host viruses,4 and immune
suppression of the recipient.5,6
For many years it has been observed that red blood cell components from
allogeneic donors contain WBCs capable of survival and
expansion.7,8 In immunologically intact persons, the life
of such cells is usually short (6 or fewer days),9,10 and
no clinical consequences result. However, prolonged survival of donor
cells, sometimes for years, has occurred after intrauterine transfusion,11,12 and recent studies have demonstrated the asymptomatic persistence of minor populations of donor cells in a
proportion of patients after massive transfusion for
trauma.13
In immunologically impaired recipients, however, such as children with
severe combined immunodeficiency, the consequences of transfusing
viable WBCs in blood components can include graft-versus-host disease
(GVHD).14,15 This transfusion-associated complication results in expansion of donor WBCs that orchestrate destruction of
recipient tissues, including the skin, gastrointestinal tract, and
hematopoietic cells. Although rare, transfusion-associated GVHD is
almost always lethal because of bleeding and infections associated with
profound bone marrow aplasia, and no satisfactory treatment has been
discovered. Prevention is critical and requires that, to prevent
lymphocyte proliferation, patients at risk be restricted to the
transfusion of cellular components that have been
gamma-irradiated.16 Because of a small degree of injury inflicted on red blood cells (RBCs) during irradiation17
and the expense and administrative complexities associated with the procedure, only a small portion of blood components is usually treated
in this fashion. Diagnoses and conditions that put patients at
increased risk for transfusion-associated GVHD include severe congenital immunodeficiencies, in utero and neonatal transfusions, Hodgkin and other lymphomas, bone marrow transplantation, and use of
drugs with strong immunosuppressant effects, such as
2-deoxycoformycin.18,19
Patients infected with HIV are also immunologically impaired and
ostensibly at high risk for long-term persistence and expansion of
donor WBCs. However, only one instance of transfusion-associated GVHD has been reported, in a child.20 To better understand
this paradox, we designed and carried out a study to assess the
survival and quantitation of transfused WBCs given to HIV-infected recipients.
Study design
Eligible subjects for VATS were 14 years of age or older, had never
received blood products before (except for immune globulin), and were
about to be transfused with red blood cells because of symptomatic,
nonsurgically induced anemia. Patients with the diagnosis of thrombotic
thrombocytopenia purpura and those who received intravenous
immune globulin in the past 6 months were excluded. Other eligibility
requirements included evidence of previous exposure to, or current
infection with, cytomegalovirus, as determined by the presence of
antibodies to this virus or a history of CMV end-organ disease. This
was to ensure that no enrolled subject was at risk for de novo
transfusion-transmitted CMV, as might occur to CMV-naive patients in
the unmodified (white-cell replete) study arm.22 Enrolled
subjects were randomized by telephone assignment to receive either
leukoreduced (less than 5 × 106 residual WBCs per unit)
or unmodified RBCs. Leukoreduction of RBCs was achieved through
filtration, within 72 hours of blood collection; no specific
manufacturer's filter was required. All RBC components were expected
to be transfused within 14 days of collection whenever possible. Gamma
irradiation was not used in this substudy. If platelet transfusions
were required, these were leukoreduced regardless of the study arm assignment.
Patients underwent transfusions as ordered by their personal
physicians. A transfusion episode included 1 U (or more) RBCs given
over 1 day (or multiple days); each transfusion episode ended once no
RBCs were transfused for at least 7 days. Two successive transfusion
episodes (T1 and T2) were studied; weekly blood samples were obtained
for up to 4 weeks after transfusion and then every 3 months after
enrollment until the end of the study (spring 1999).
Subjects included in the donor survival analysis subset reported here
were female VATS participants whose study transfusions included at
least one component collected from a male donor and whose pre- and
posttransfusion blood samples were available for testing.
Cell and DNA preparation and processing
Laboratory testing The adequacy of leukoreduction was assessed in each RBC component using quantitative PCR of a generic human leukocyte antigen (HLA) DQ-alpha sequence in a leukocyte pellet prepared and frozen at the time of transfusion.23 HIV RNA was quantitated from frozen plasma using a reverse transcription PCR assay with a lower
limit of quantification of 200 copies per milliliter (Roche Amplicor assay; Roche Diagnostics; Branchburg, NJ). CD4 cell counts were measured by flow cytometry (FACScan; Becton Dickinson, San Jose, CA)
using whole blood samples cryopreserved in dimethyl
sulfoxide.23
Donor lymphocyte survival studies To detect male donor lymphocytes in a female recipient's blood, we used a 125-µL sample of posttransfusion recipient blood for the amplification of a 148-bp region of the sex-determining region of the human Y chromosome (SRY)24 using the allele-specific primer pair SA (5' CGCATTCATCGTGTGGTCTCGCG 3') and SD (5' CTGTGCCTCCTGGAAGAATGGCC 3'), as previously described.13 Specific amplified product was detected by oligomer liquid hybridization using a 32P-labeled probe, SB (5' GAGGCGCAAGATGGCTCTAGAG 3'). Hybridized samples were subjected to 6% polyacrylamide gel electrophoresis (PAGE) at 12.5 V/cm and overnight autoradiography. Testing of all specimens associated with a specific recipient and transfusion episode (through the week 4 posttransfusion samples) was performed as a batch. DNA lysates were tested in duplicate, both neat and at a 1:10 dilution, in a single PCR-hybridization-PAGE autoradiography run. Duplicate standard curves composed of known concentrations (10-fold serial dilutions) of male donor cells in pretransfusion female recipient cells were analyzed in parallel with clinical samples and used to interpolate donor leukocyte concentrations in the latter samples. Autoradiographs were analyzed using the Millipore BioImage Electrophoresis Analyzer application software (Millipore, Ann Arbor, MI) with Whole Band Analyzer application software (Millipore), as detailed elsewhere.13 Results were reported as WBC/mL. To avoid false-positive results, we considered male donor cells to be present in a specimen if all replicate results were greater than 0 and at least one of the results showed 25 or more donor cells per milliliter (3 times the theoretical detection limit of the assay).Quantitative allele-specific PCR for HLA typing of donor cells In recipients with measurable numbers of male cells after transfusion by Y-chromosome PCR analysis, we pursued identification of a specific donor through the amplification of HLA-DNA. For each transfusion episode, we used primers and probes designed to selectively amplify and detect single-copy HLA class II gene alleles that were unique to any possible male donor target cell populations and that were not present in the recipient. Concentrations of Mg2+, amplification protocols, and reaction buffers were adapted to each specific primer pair to optimize the assay conditions. Sequences of primers and probes and amplification conditions have been previously reported.13
Five hundred thirty-one subjects were enrolled in the VATS trial;
265 were randomized to receive leukoreduced components, and 266 were
randomized to receive unmodified blood. Women comprised 21% of
enrolled subjects (112 subjects), including 56 in the leukoreduced transfusion arm and 56 in the unmodified arm. Two enrolled women (one
in each arm) did not receive transfusions. Of the remaining 110 (Figure
1), 80 (73%) received at least one RBC
component from a male donor during the first transfusion episode (T1)
and provided at least one posttransfusion specimen available for study.
Of these 80 subjects, 42 were randomized to receive leukoreduced cells
and 38 to receive nonleukoreduced cells. Thirty-four of these women (17 in each arm) underwent a second transfusion of red blood cells and
provided posttransfusion samples. Thirteen other women who had received
only female cells during a first transfusion (including 4 in the
leukoreduced arm and 9 in the nonleukoreduced arm) received male cells
in a second transfusion and had posttransfusion samples drawn. Thus, a
total of 63 transfusion episodes administered to 46 women in the
leukoreduced arm had evaluable posttransfusion samples, as did 64 transfusion episodes to 47 women in the nonleukoreduced arm. These 93 subjects comprise the donor survival study population. Characteristics
of these women are shown in Table 1.
Leukoreduced RBCs had a median of 1.08 × 105 residual WBCs per component, and more than 99% of these components (1854 of 1869) had fewer than 5 × 106 WBCs per unit. The median age of a RBC component at the time of transfusion was 9 days (10th percentile, 3 days; 90th percentile, 14 days). Four percent of RBC components (157 of 3812 U in the full VATS study set) were older than 14 days at the time of transfusion. Detection of male donor cells using Y-chromosome amplification is
outlined in Table 2, and representative
amplification gels are shown in Figure 2.
Five transfusion episodes (of 64 total episodes) in 5 subjects
receiving nonleukoreduced RBCs were associated with evidence of
posttransfusion male donor cell survival. Four of these subjects
(NLR-1, NLR-2, NLR-3, and NLR-5) had detectable cells at day 7, all
after T2 transfusions. In 2 of these subjects (NLR-1 and NLR-2), the
cells could no longer be detected 1 week later. NLR-3 had male cells
detected on days 4 and 7 (the day 4 specimen was drawn as a quarterly
specimen after T1); day 14, day 21, and day 28 samples were
unavailable. NLR-5 had male cells on days 7 and 21 (day 14 results
showed inconsistent reactivity and were not considered positive); cells
were undetectable by day 28. For a T1 transfusion, NLR-4 received 2 U
blood older than stipulated by the study protocol (24 days old). On day
14, male donor cells were readily detected, but by day 21 the sample
was no longer considered positive. No male donor cells were detected in
the nonleukoreduced arm during follow-up quarterly studies.
In the leukoreduced arm, male donor cells were detected in 1 of 63 transfusion episodes involving leukoreduced RBCs. In this case (LR-1), no cells were detected during any of the 4 weekly samples after T1 transfusion but were found for the first and only time 3 months later. The residual white counts in the 4 filtered units given to LR-1 were all lower than 2.5 × 105 cells per component. Male donor cells were not detected in any other recipient in this arm at any time point. Pretransfusion characteristics of the 6 women with detectable male
donor cells after transfusion are shown in Table
3; they were similar to those in the
patient population as a whole (Table 1). With the exception of NLR-4,
the median age of the transfused male donor components given to these
women (6 days; 10th percentile, 3 days; 90th percentile, 14 days) was
slightly younger than the median age of male donor components given to
the other women (8 days; 10th percentile, 4 days; 90th percentile, 14 days).
The detection of specific donor HLA genotypes is described in Tables 4
through
7.
Posttransfusion samples were available for these experiments from 4 subjects (NLR-1, NLR-2, NLR-4, and NLR-5) at time points coinciding
with dates when male cells were detected. No relevant samples were
available from NLR-3 and LR-1 because all aliquots of frozen
whole blood from the implicated time points had been used in
other VATS-related research.
We were able to detect DR3 and DQB201 in a sample of blood from NLR-1 collected 7 days after the T2 transfusion (20 days after the T1 transfusion), when male DNA had been identified by Y-chromosome analysis. The presence of DR3 was consistent only with the genotype of male donor 1A, associated with the T1 transfusion. However, it is possible that we could have been detecting DNA from the other male donor (1C) or from female donor 1B because all 3 donors were DQB201-positive. We used 5 sets of donor HLA-specific primer pairs and probes to test blood from recipient NLR-2 one week after her T2 transfusion. DR7, DQB501, and DQB7 were found, consistent with cells from T2 donors 2C and 2D. Donor 2B (from the T1 transfusion) was also DR7 positive, but we did not find DQB8, another of his alleles, and we did not find DR13, a distinguishing allele of donor 2A. Thus, at least 2 male donors could have contributed to the posttransfusion DNA detected in this subject. We studied recipient NLR-4 on day 14 after the T1 transfusion, using 3 sets of primer pairs and probes that would have distinguished donor 4A from the recipient (DR2, DR15, and DQB602). Only DR15 was detected. Finally we studied recipient NLR-5 at 2 time points after the T2
transfusion (day 7 and day 21). On day 7, at least 3 donors appeared to
have contributed to the DNA detected
In the VATS subpopulation of 93 women who received RBC components from one or more male donors, only 5 had detectable male cells in the first month after transfusion. All were in the nonleukoreduced RBC study arm, and this outcome might have been predicted from the comparatively higher WBC content of the unmodified components. Results of DNA studies suggested that more than one donor might have been involved in the microchimerism, though the limitations of this assay make firm donor identification difficult. Four of the 5 recipients demonstrated male chimerism only with the T2 transfusion; whether this was by chance or was related to a cumulative effect of allogeneic transfusions on the likelihood of microchimerism cannot be determined from such small numbers. However, with 47 participants receiving nonleukoreduced RBCs, these 5 who had posttransfusion donor cell survival represented only 11% of subjects; seen another way, this represented 8% of the 64 evaluable transfusion episodes involving nonleukoreduced male donor RBCs. Of key importance, sustained donor leukocyte microchimerism did not develop in any of these recipients. These data provide confirmatory laboratory evidence in support of clinical impressions that HIV-infected patients are not at risk for GVHD. Which factors might have protected most female transfusion recipients from detectable microchimerism or, conversely, placed 5 others at risk are unclear. In particular, the mean age of the components at transfusion was not meaningfully shorter in the 5 recipients with detectable donor cells than in other recipients in this substudy. On the contrary, the highest detectable number of male cells was found in the recipient of 2 old units (24 days old, NLR-4). Recipient factors such as age, race, HIV risk factor, previous HAART use, baseline viral load, and baseline CD4 cell count were also not uniquely slanted in this small population than in the rest of the sub-study group. In all 4 tested participants, one or more male donors shared some class II genes with the relevant recipient. It is possible that in some of these subjects, the degree of partial HLA matching between donor and recipient facilitated tolerance and allogeneic cell survival.25-27 However, the extent to which this occurred more frequently in these recipients than in other women in the study was not ascertained. Of the 46 evaluable subjects assigned to the leukoreduced arm (and 63 evaluable transfusion episodes), male cells were detected in only one
recipient after transfusion. The data were unusual in that no male
cells were identified in her blood at any of the 4 weekly time points
in the first month after transfusion. The sole positive sample was
drawn 3 months after the transfusion, suggesting that alternative
explanations for the presence of male donor cells must be considered in
evaluating the results of our study. During pregnancy, 2-way
trafficking of cells across the placenta The use of male blood recipients could have circumvented the problem of long-term survival of male fetal cells in our female recipients and would have substantially increased our study population size (presumably without affecting the results; we are unaware of published data to suggest that transfusion-associated microchimerism has different features in males than in females). We used Y-chromosome DNA amplification for screening for microchimerism because of its ready applicability to female recipients receiving blood from one or more male donors of otherwise unknown genotype. Historically, the detection of microchimerism capitalized on such sex chromosome differences, primarily through cytogenetic identification of the Y chromosome8,11 or through PCR amplification of Y-chromosome DNA fragments.9,10 More recently, it has become possible to study other polymorphic genetic markers, such as HLA alleles,27,34 or non-HLA, highly polymorphic, or otherwise informative markers such as are found on human globin genes.14,28 However, if multiple donors or donors of unknown genotype are involved, a highly polymorphic system and many different probes must be used to consistently detect microchimerism. Even when a donor's genotype is known, careful choice of probes is required to ensure informative amplifications. In a recent side-by-side comparison of a selection of these approaches, Y-chromosome DNA amplification triumphed as the most sensitive and consistent assay for microchimerism.35 Regardless of the assay used, the detection of rare populations of cells in blood remains challenging. Assays range in sensitivity from 0.1% male DNA in a female DNA background using single primer pairs for the Y chromosome to 0.0001% with nested primers.35 Different primers may lead to different amplification efficiencies, and inadvertent mispriming of associated material, such as pseudogenes in the recipient, has led to false-positive results because of misinterpretation of the bands as of donor origin.36 We controlled for this possibility by running coded pre- and posttransfusion samples from each case together. In addition, the testing laboratory was blinded to the clinical assignment of patients to either the leukoreduced or the unmodified arm of the study. To minimize potential PCR carryover and to maximize specificity, we used nonnested assays with radiolabeled probes specific to the amplified product of the minor population under study. We could also have missed the peak of donor lymphocyte proliferation in our transfusion recipients. In previous studies, the peak increase in concentration of donor lymphocytes has occurred from 3 to 7 days,7,8,10 and our choice of 7 days as the first posttransfusion assay point might have caused earlier transient proliferations to be missed. However, we expected and were looking for prolonged microchimerism that might have clinical relevance; hence, the absence of donor survival beyond 7 days was useful data. Our subjects all had advanced acquired immunodeficiency syndrome. Given the inherent immunodeficiency of the illness and the severity of their conditions, they comprised a population theoretically likely to be at risk for GVHD. Despite this, measurable numbers of WBCs survived in only a small proportion, and then for only short periods, without amplification of cell numbers. These data are entirely in keeping with clinical observations that transfusion-associated GVHD does not develop in HIV-infected patients, almost without exception.37 In an isolated report in the literature, a child born with HIV received 6 nonirradiated RBC transfusions at age 30 months. Mild and transient GVHD associated with the appearance of additional HLA alleles in blood samples (presumably by serologic methods) linked to at least 4 different donors developed and persisted through 3 months after transfusion, when the symptoms disappeared.20 This single case report stands in stark contrast to statistics on blood usage in HIV infection. HIV infection has been diagnosed in more than 1 000 000 patients in the United States; moderate or severe anemia (hemoglobin level less than 9.4 g/dL) developed in an estimated 20% of them through 1996, and many became transfusion-dependent.38 The rarity of TA-GVHD may stem from infection with HIV, which could protect the infected patient from GVHD either by infecting and destroying transfused CD4+ cells or by rendering those cells less able to proliferate in the immunosuppressive environment that is a consequence of HIV-1 replication.39 Of interest is the contrast between these results and those obtained in a small population of apparently immunocompetent women who, after transfusion of multiple units of fresh blood (4 to 18 U, all 15 days old or younger) after trauma, had sustained, asymptomatic, multilineage microchimerism for many months.13 Hemorrhage, trauma, and surgery might separately or synergistically have created a degree of immunosuppression that fostered donor cell survival in these patients. In addition, the exposure to larger numbers of donors should have increased the odds that a partially HLA-matched donor was chosen to whom the recipient was tolerant. The unexpected survival of, and host perturbation by, transplanted or transfused WBCs can have important repercussions for a recipient. GVHD resulting from the expansion of donor WBCs after solid organ or bone marrow transplantation can cause death or serious morbidity. By contrast, microchimerism, the steady-state survival of smaller numbers of donor cells, may be of critical value after organ transplantation in that these cells may facilitate donor tolerance and graft acceptance.40,41 Transfusion-associated GVHD in the already immunocompromised patient with HIV infection should presumably be a devastating adverse complication. However, our data suggest that donor WBCs are not able to proliferate in the HIV-infected patient. As a result, gamma irradiation or other methods (such as photochemical treatment)42 that prevent transfusion-associated graft-versus-host disease through the inhibition of T-cell proliferation appear unnecessary in this population.
We thank the patients who participated in this study for their efforts, and we thank the transfusion service personnel and nurses at each medical center, without whose assistance the study could not have been accomplished. Please see the Appendix for further information about the Viral Activation Transfusion Study Group.
Submitted January 12, 2001; accepted March 14, 2001.
Supported by contracts N01-HB-57126, N01-HB-57127, and N01-HB-57115 from the National Heart Lung and Blood Institute (National Institutes of Health).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Margot S. Kruskall, Division of Laboratory and Transfusion Medicine, Beth Israel Deaconess Medical Center, Yamins 309, 330 Brookline Ave, Boston, MA 02215.
1.
Bordin JO, Heddle NM, Blajchman MA.
Biologic effects of leukocytes present in transfused cellular blood products.
Blood.
1994;84:1703-1721
2.
Trial to Reduce Alloimmunization to Platelets (TRAP) Trial Study Group.
Leukocyte-reduction and UV-B irradiation of platelets to prevent alloimmunization and refractoriness to platelet transfusions.
N Engl J Med.
1997;337:1861-1869 3. Przepiorka D, LeParc GF, Werch J, Lichtiger B. Prevention of transfusion-associated cytomegalovirus infection: practice parameter. Am J Clin Pathol. 1996;106:163-169[Medline] [Order article via Infotrieve].
4.
Busch MP, Lee T-H, Heitman J.
Allogeneic leukocytes but not therapeutic blood elements induce reactivation and dissemination of latent human immunodeficiency virus type 1 infection: implications for transfusion support of infected patients.
Blood.
1992;80:2128-2135 5. Opelz G, Terasaki PI. Improvement of kidney graft survival with increased numbers of blood transfusions. N Engl J Med. 1978;299:799-803[Abstract]. 6. Peters WR, Fry RD, Fleshman JW, Kodner IJ. Multiple blood transfusions reduce the recurrence rate of Crohn's disease. Dis Colon Rectum. 1989;32:749-753[Medline] [Order article via Infotrieve]. 7. Schechter GP, Soehnlen F, McFarland W. Lymphocyte response to blood transfusion in man. N Engl J Med. 1972;287:1169-1173.
8.
Schechter GP, Whang-Peng J, McFarland W.
Circulation of donor lymphocytes after blood transfusion in man.
Blood.
1977;49:651-656
9.
Adams PT, Davenport RD, Reardon DA, Roth MS.
Detection of circulating donor white blood cells in patients receiving multiple transfusions.
Blood.
1992;80:551-555
10.
Lee T-H, Donegan E, Slichter S, Busch MP.
Transient increase in circulating donor leukocytes after allogeneic transfusions in immunocompetent recipients compatible with donor cell proliferation.
Blood.
1995;85:1207-1214 11. Hutchinson DL, Turner JH, Schlesinger ER. Persistence of donor cells in neonates after fetal and exchange transfusion. Am J Obstet Gynecol. 1971;109:281-284[Medline] [Order article via Infotrieve].
12.
Viëtor HE, Hallensleben E, van Bree SPMJ, et al.
Survival of donor cells 25 years after intrauterine transfusion.
Blood.
2000;95:2709-2714
13.
Lee T-H, Paglieroni T, Ohto H, Holland PV, Busch MP.
Survival of donor leukocyte subpopulations in immunocompetent transfusion recipients: frequent long-term microchimerism in severe trauma patients.
Blood.
1999;93:3127-3139 14. Blazar BR, Filipovich AH. Identification of transfused blood cells in children with severe combined immunodeficiency syndrome by analysis of multiple cell lineages using restriction fragment length polymorphisms. Bone Marrow Transplant. 1990;5:327-333[Medline] [Order article via Infotrieve]. 15. Petz LD, Calhoun L, Yam P, et al. Transfusion-associated graft-versus-host disease in immunocompetent patients: report of a fatal case associated with transfusion of blood from a second-degree relative, and a survey of predisposing factors. Transfusion. 1993;33:742-750[CrossRef][Medline] [Order article via Infotrieve]. 16. Moroff G, Leitman SF, Luban NL. Principles of blood irradiation, dose validation, and quality control. Transfusion. 1997;37:1084-1092[CrossRef][Medline] [Order article via Infotrieve]. 17. Davey RJ, McCoy NC, Yu M, Sullivan JA, Spiegel DM, Leitman SF. The effect of prestorage irradiation on posttransfusion red cell survival. Transfusion. 1992;32:525-528[CrossRef][Medline] [Order article via Infotrieve]. 18. Anderson KC, Weinstein HJ. Transfusion-associated graft-versus-host disease. N Engl J Med. 1990;323:315-321[Medline] [Order article via Infotrieve]. 19. Ohto H, Anderson KC. Survey of transfusion-associated graft-versus-host disease in immunocompetent recipients. Transfus Med Rev. 1996;10:31-43[CrossRef][Medline] [Order article via Infotrieve]. 20. Klein C, Fraitag S, Foulon E, Raffoux C, Bodemer C, Blanche S. Moderate and transient transfusion-associated cutaneous graft-versus-host disease in a child infected by human immunodeficiency virus. Am J Med. 1996;101:445-446[CrossRef][Medline] [Order article via Infotrieve]. 21. Busch MP, Collier A, Gernsheimer T, et al. The Viral Activation Transfusion Study (VATS): rationale, objectives, and design overview. Transfusion. 1996;36:854-859[CrossRef][Medline] [Order article via Infotrieve].
22.
Bowden RA, Slichter SJ, Sayers M, et al.
A comparison of filtered leukocyte-reduced and cytomegalovirus (CMV) seronegative blood products for the prevention of transfusion-associated CMV infection after marrow transplant.
Blood.
1995;86:3598-3603 23. Lee T-H, Sakahara NS, Fiebig EW, et al. Quantitation of white cell subpopulations by polymerase chain reaction using frozen whole-blood samples. Transfusion. 1998;38:262-270[CrossRef][Medline] [Order article via Infotrieve]. 24. Sinclair AH, Berta P, Palmer MS, et al. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990;346:240-244[CrossRef][Medline] [Order article via Infotrieve]. 25. Lagaaij EL, Hennemann IP, Ruigrok M, et al. Effect of one-HLA-DR-antigen-matched and completely HLA-DR-mismatched blood transfusions on survival of heart and kidney allografts. N Engl J Med. 1989;321:701-705[Abstract]. 26. Nelson JL, Furst DE, Maloney S, et al. Microchimerism and HLA-compatible relationships of pregnancy in scleroderma. Lancet. 1998;351:559-562[CrossRef][Medline] [Order article via Infotrieve]. 27. Vervoordeldonk SF, Doumaid K, Remmerswaal EBM, et al. Long-term detection of microchimaerism in peripheral blood after pretransplantation blood transfusion. Br J Haematol. 1998;102:1004-1009[CrossRef][Medline] [Order article via Infotrieve].
28.
Lo YMD, Lo ESF, Watson N, et al.
Two-way cell traffic between mother and fetus: biologic and clinical implications.
Blood.
1996;88:4390-4395 29. Aractingi S, Berkane N, Bertheau P, et al. Fetal DNA in skin of polymorphic eruptions of pregnancy. Lancet. 1998;352:1898-1901[CrossRef][Medline] [Order article via Infotrieve].
30.
Lo DYM, Hjelm NM, Fidler C, et al.
Perinatal diagnosis of fetal RhD status by molecular analysis of maternal plasma.
N Engl J Med.
1998;339:1734-1738 31. Maloney S, Smith A, Furst DE, et al. Microchimerism of maternal origin persists into adult life. J Clin Invest. 1999;104:41-47[Medline] [Order article via Infotrieve].
32.
Artlett CA, Smith JB, Jiminez SA.
Identification of fetal DNA and cells in skin lesions from women with systemic sclerosis.
N Engl J Med.
1998;338:1186-1191
33.
Bianchi DW, Zickwolf GK, Weil GJ, Sylvester S, DeMaria MA.
Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum.
Proc Natl Acad Sci U S A.
1996;93:705-708 34. Artlett CA, Cox LA, Jimenez SA. Detection of cellular microchimerism of male and female origin in system sclerosis patients by polymerase chain reaction analysis of HLA-Cw antigens. Arthritis Rheum. 2000;43:1062-1067[CrossRef][Medline] [Order article via Infotrieve]. 35. Sahota A, Yang M, McDaniel HB, et al. Evaluation of seven PCR-based assays for the analysis of microchimerism. Clin Biochem. 1998;31:641-645[CrossRef][Medline] [Order article via Infotrieve].
36.
Carter AS, Bunce M, Cerundolo L, Welsh KI, Morris PJ, Fuggle SV.
Detection of microchimerism after allogeneic blood transfusion using nested polymerase chain reaction amplification with sequence-specific primers (PCR-SSP): a cautionary tale.
Blood.
1998;92:683-689
37.
Anderson KC, Goodnough LT, Sayers M, et al.
Variation in blood component irradiation practice: implications for prevention of transfusion-associated graft-versus-host disease.
Blood.
1991;77:2096-2102 38. Moore RD, Keruly JC, Chaisson RE. Anemia and survival in HIV infection. J Acquir Immune Defic Syndr Hum Retrovirol. 1998;19:29-33[Medline] [Order article via Infotrieve]. 39. Ammann AJ. Hypothesis: absence of graft-versus-host disease in AIDS is a consequence of HIV-1 infection of CD4+ T cells. J Acquir Immune Defic Syndr. 1993;6:1224-1227. 40. Starzl TE. Clinical and basic scientific implications of cell migration and microchimerism after organ transplantation. Artif Organs. 1997;21:1154-1155[Medline] [Order article via Infotrieve]. 41. Sakurada M, Okazaki H, Sato T, et al. Peripheral blood chimerism in renal allograft recipients transfused with donor-specific blood. Transplant Proc. 1997;29:1187-1188[CrossRef][Medline] [Order article via Infotrieve].
42.
Fiebig E, Hirschkorn DF, Maino JA, Grass JA, Lin L, Busch MP.
Assessment of donor T-cell function in cellular blood components by the CD69 induction assay: effects of storage,
The Viral Activation Transfusion Study Group is the responsibility of the following persons. Clinical sites Case Western Reserve University, Cleveland, OH (N01-HB-57115): Michael Lederman, MD; Roslyn Yomtovian, MD; Michael Chance, RN; Donna Hendrix, RN. Georgetown University, Washington, DC (N01-HB-57116): Princy N. Kumar, MD; S. Gerald Sandler, MD; Karyn Hawkins, RN. Miriam Hospital/Brown University, Providence, RI (N01-HB-57117): Timothy P. Flanigan, MD; Joseph Sweeney, MD; Maria D. Mileno, MD; Melissa Di Spigno, RN; Michelle Dupuis, MT (SSB). Mt Sinai School of Medicine, New York, NY (N01-HB-57118): Henry S. Sacks, PhD, MD; Kala Mohandas, MD; Frances R. Wallach, MD; Letty Mintz, ANP. Ohio State University, Columbus (N01-HB-57119): Michael F. Para, MD; Melanie S. Kennedy, MD; Jane Russell, RN; Dave Krugh, MT. University of California, San Diego (N01-HB-57120): Thomas A. Lane, MD; W. Christopher Mathews, MD; Peggy Mollen-Rabwin, RN. University of California, San Francisco (N01-HB-57121): Edward L. Murphy, MD, MPH; Steven G. Deeks, MD; Maurene Viele, MD; Chaolun Han, MD; Joanne Moore, MT (ASCP) SBB. University of North Carolina, Chapel Hill (N01-HB-57122): Charles van der Horst, MD; Meera Kelley, MD; Mark E. Brecher, MD; Linh Ngo, FNP. University of Pittsburgh, PA (N01-HB-57123): John W. Mellors, MD; Darrell J. Triulzi, MD; Deborah K. McMahon, MD; Sharon Riddler, MD. University of Texas Medical Branch, Galveston (N01-HB-57124): David M. Asmuth, MD; Richard B. Pollard, MD; Janice Curry, PAC; Gerald Shulman, MD. University of Washington/Puget Sound Blood Center, Seattle (N01-HB-57125): Ann Collier, MD; Terry Gernsheimer, MD; Dee Townsend-McCall, RN; Jill Corson, RN.Central laboratory Blood Centers of the Pacific, San Francisco, CA (N01-HB-57126): Michael P. Busch, MD, PhD; Tzong-Hae Lee, MD, PhD; W. Lawrence Drew, MD, PhD (UCSF Mt Zion Medical Center, San Francisco); Megan Laycock.Coordinating center New England Research Institutes, Watertown, MA (N01-HB-57127): Leslie A. Kalish, ScD; Susan F. Assmann, PhD; Jane D. Carrington, RN, BS; Margot S. Kruskall, MD (Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA); Ruth Eisenbud, BA.Sponsoring agency National Heart, Lung and Blood Institute: George J. Nemo, PhD, project officer; Paul R. McCurdy, MD; Dean Follmann, PhD.Steering committee Paul V. Holland, MD (chair), Sacramento Medical Foundation Blood Centers, CA.Data Safety Monitoring Board Jeffrey McCullough, MD (chair), University of Minnesota, Minneapolis; Victor DeGruttola, ScD; Peter Frame, MD; Janice G. McFarland, MD; Ronald T. Mitsuyasu, MD; Elizabeth J. Read, MD; Dorothy E. Vawter, PhD.
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  R. M. Gill, T.-H. Lee, G. H. Utter, W. F. Reed, L. Wen, D. Chafets, and M. P. Busch The TNF (-308A) polymorphism is associated with microchimerism in transfused trauma patients Blood, April 1, 2008; 111(7): 3880 - 3883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Yu, M. S. Kruskall, J. J. Yunis, J. H.M. Knoll, L. Uhl, S. Alosco, M. Ohashi, O. Clavijo, Z. Husain, E. J. Yunis, et al. Disputed Maternity Leading to Identification of Tetragametic Chimerism N. Engl. J. Med., May 16, 2002; 346(20): 1545 - 1552. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
, number of subjects who received
blood transfusions from one or more male donors, with evaluable
posttransfusion blood samples; 
, number of subjects who received
blood from only female donors, did not have posttransfusion blood
samples for study, or did not undergo a T2 transfusion.
radiation, and photochemical treatment.
Transfusion.
2000;40:761-770