| |
|
|
|
|
|
|
|||
|
RED CELLS
From the Bristol Institute for Transfusion Sciences;
Celltech, Slough; and the University of Bristol, United Kingdom; and
the University Hospital Blood Centre, Lund, Sweden.
The LW blood group glycoprotein, ICAM-4, is a member of the
intercellular adhesion molecule (ICAM) family expressed in erythroid cells. To begin to address the function of this molecule, ligands for
ICAM-4 on hemopoietic and nonhemopoietic cell lines were identified. Peptide inhibition studies suggest that adhesion of cell lines to an
ICAM-4-Fc construct is mediated by an LDV-inhibitable integrin on
hemopoietic cells and an RGD-inhibitable integrin on nonhemopoietic cells. Antibody inhibition studies identified the hemopoietic integrin
as Knowledge of cell-cell and cell-extracellular
matrix interactions in bone marrow is essential for an understanding of
the formation of blood cells and their migration into the peripheral circulation. Such interactions are also relevant to the biology of
diseases like sickle cell disease and malaria where adhesive interactions involving red cells and damaged endothelium are crucial features of the pathology.1-3 These adhesive interactions
frequently involve molecules belonging to the immunoglobulin
superfamily (IgSF) of proteins and the family of proteins known as
integrins. Integrins are heterodimers composed of 2 noncovalently
associated transmembrane subunits denoted " The LW blood group glycoprotein, or ICAM-4, is a member of the
IgSF subfamily known as intercellular adhesion molecules (ICAMs). It
has 2 predicted IgSF I-set domains,5-7 and within the
subfamily it is most similar to ICAM-2. ICAM-4 has been found expressed only on erythroid cells and weakly in placenta.8,9 ICAM-1, -2, and -3 function in inflammation and immune
responses,10 but no function for ICAM-4 has been defined.
The ICAMs are ligands for
X-ray crystal structures of 2-domain fragments of ICAM-1, ICAM-2,
VCAM-1, and MAdCAM-1 provide insights into the structural basis of
IgSF-integrin interactions.25 ICAM-1 and -2 are both ligands for the I domain-containing We have modeled ICAM-4 based on the published crystal structure of
ICAM-2 to identify the positioning of the ICAM-4 nonconsensus LR52TPL motif and to test whether an
LD73V motif located at the end of the predicted E strand is
solvent-exposed. Using soluble, recombinant ICAM-4 constructs and by
mutating several key residues to restore consensus ICAM-2 sequences, we
have explored the integrin-binding properties of the molecule in
cell-based adhesion assays. We have also targeted the LD73V
motif in domain 1 by site-directed mutagenesis to test for involvement in integrin binding. Our results show that ICAM-4 has an unusual integrin-binding profile in that it binds
ICAM-4 homology model
Mammalian cell lines studied
Antibodies and peptides Function-blocking monoclonal antibodies to integrin subunits were anti- 1 (clone13, Becton Dickinson, Oxford, United
Kingdom); anti- 2 (MHM23, Dako, Bucks, United Kingdom;
YFC118.3, Serotec, Oxford, United Kingdom; 1B4, Alexis, Bingham, United
Kingdom; P4H9-A11, Chemicon International, Harrow, United Kingdom);
anti- 3 (PM6/13, Harlan Sera-Lab, Loughborough, United
Kingdom; RUU-PL 7F12, Becton Dickinson); anti- 4 (ASC-3,
Chemicon); anti- L (38, Dr N Hogg, London, United
Kingdom; MHM24, Dako); anti- 1 (FB12, Chemicon);
anti- 2 (JA218, Prof M. Humphries, University of
Manchester); anti- 3 (C3[VLA3], Immunotech, High
Wycombe, United Kingdom); anti- 4 (HP2/1, Serotec; L25.3,
Becton Dickinson; Max68P, Dr T. Shock, Celltech, Slough, United
Kingdom); anti- 5 (SNAKA55, Prof M. Humphries);
anti- 6 (NKI-GoH3, Serotec); anti- V
(69.9.5, Immunotech; CLB-706, Chemicon);
anti- V 3 (23C6, Serotec; LM609, Harlan
Sera-Lab); and anti- V 5 (P1F6, Becton
Dickinson). Activating antibodies to integrin subunits were
anti- 1 (TS2/16, American Type Culture Collection,
Manassas, VA); anti- 2 (KIM127, KIM185 as
described33,34); and anti- 4 (44H6,
Serotec). Antibodies against the first domain of ICAM-4 (BS46, BS56)
were from Dr H. Sonneborn, Biotest, Dreieich, Germany. Linear peptides
GRGDSPK and EILDVPST were synthesized in-house.
Preparation of fusion proteins ICAM-4-Fc fusion proteins (ICAM4Fc) used in the study comprised the 2 extracellular domains of ICAM-4 and the hinge region and Fc domains of human IgG1 as described.35 ICAM-4 complementary DNA (cDNA) encoding leader sequence and the 2 extracellular IgSF domains (ICAM-4 amino acid residues 30 to 196) was
amplified by polymerase chain reaction (PCR) using sense primer
(TTCCCAAGCTTTGCCATGGGGTCTCTGTTCCCT), antisense primer
(ACGGATCCACTTACCTGTGGGGCTCCAAGCGAGCATCAGTGT), and full-length ICAM-4
cDNA template. This DNA was subcloned into pBluescript and used for
subsequent steps. Mutant ICAM-4 cDNAs encoding consensus ICAM-2
residues at amino acid residues 50, 52, and 91, IC4S50G
(removes consensus N48 glycosylation site),
IC4R52E, and IC4T91Q were made using inverse
PCR.36 Sense primer
5'-ACCCCGCTGCGGCAAGGCAAGACGCTCAGA was used for mutants
IC4S50G and IC4R52E. Antisense primer for
IC4R52E was 5'-TTCGAGGCTGGAATTCTGCGGCTGGGGACA and for
IC4S50G was 5'-GCGGAGGCCGGAATTCTGCGGCTGGGGACA. Sense primer
for IC4T91Q was 5'-ACGCTGGGCCACCTCCAGGATCACCGCCTA and
antisense primer was 5'-TGTTTTCCTGCGCAGGTCACGAGGCAGTGC. Native and
mutant ICAM-4 cDNAs were subcloned into pIg vector as
described.35 A mutant encoding IC4D73R was
generated by overlap extension PCR36 using native ICAM-4 cDNA in pIg as template with complementary, mutational ICAM-4 primers
5'-GCTGCTCCGCGTGAGGGCCTGG and 5'-CCAGGCCCTCACGCGGAGCAGC together with
sense and antisense pIg vector primers 5'-AGAACCCACTGCTTACTGGCT and
5'-TGAGCCTGCTTCCAGCAGACA. All clones were verified by sequence analysis. The cDNA clones encoding the extracellular domains of ICAM-1,
-2, and -3 and neural cell adhesion molecule (NCAM) in pIg were gifts
from Dr D. Simmons, SmithKline Beecham, Harlow, United Kingdom. CAMFc
proteins were expressed in COS-7 cells as described35 and
extracted from culture supernatant on protein A-Sepharose. Fc fusion
proteins containing the first 2 domains of VCAM-1 (VCAMFc) or MAdCAM-1
(MAdCAMFc) were as described.37 ICAM4Fc and mutant ICAM4Fc
proteins migrated with Mr about 100 000 kd on
sodium dodecyl sulfate-polyacrylamide gel electrophoresis under
reducing conditions. IC4S50G migrated with somewhat lower
Mr, suggesting an absence of N-glycan at residue
N48. Western blotting (nonreducing conditions) using
antihuman IgG and anti-ICAM-4 antibodies BS46 and BS56 was also
performed (not shown). Protein concentrations were determined by the
"Nano-orange" technique (Molecular Probes, Leiden, The Netherlands).
Flow cytometry Cells were analyzed for antigen expression as described.38 Mean fluorescence intensity was used as a measure of antibody binding.Cell adhesion assay Immulon-4 96-well plates (Dynex Technologies, Billingshurst, United Kingdom) were coated with 1 µg/well goat-antihuman-Fc (Sigma, Poole, United Kingdom) for 18 hours at 4°C, blocked with phosphate-buffered saline (pH 7.4), 0.4% bovine serum albumin (Fraction V, Sigma) for 2 hours at 22°C, and coated with chimeric proteins in phosphate-buffered saline (1 µg/well unless stated otherwise) for 2 hours at 37°C. Hemopoietic cells were washed once in assay buffer (IMEM, 2 mM EGTA, 5% human group AB serum [National Blood Service, Bristol, United Kingdom]). Nonhemopoietic cells were lifted in phosphate-buffered saline containing 2 mM ethylenediaminetetraacetic acid (EDTA), 0.1% bovine serum albumin and washed once in IMEM containing 0.1% (wt/vol) bovine serum albumin. Cells (107/mL in assay buffer) were labeled with 10 µg/mL 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (Sigma) for 15 minutes at 37°C and washed thrice in assay buffer. Cells were activated with 80 µM phorbol myristate acetate (PMA, Sigma) in assay buffer for 15 minutes at 37°C and washed twice in assay buffer containing cations. Cells were incubated for 15 minutes at 0°C with 10 µg/mL antibodies (KIM and anti-ICAM-4 antibodies at 25 µg/mL), 500 µM peptides, or 25 µg/mL ICAM4Fc in assay buffer containing 2 mM Mn2+ or 10 mM Mg2+. Cells were added to CAMFc-coated plates (5 × 104/well in 100 µL) for 30 minutes at 37°C. Plates were read on a fluorescence microplate reader (excitation 485 nm, emission 530 nm, Bio-Tek Instruments, VT), given standardized washes in assay buffer, and read after each wash. Washing was performed by flooding the plates with assay buffer at 37°C and then vigorously decanting the buffer to waste by rapid inversion of the plate. The percentage of input cells bound was calculated. Each data point is the mean of 3 or more replicates, and assays were performed on at least 3 independent occasions.
ICAM-4 homology model A homology model of ICAM-4 was constructed (Figure 2A) based on the crystal structure of ICAM-2,26 which, in the region modeled, has 29% amino acid sequence identity with ICAM-4. Because this tentative model is derived from sequence homology with ICAM-2, it closely follows the reported fold for ICAM-2 with domain 1 adopting an I-1 fold and domain 2 belonging to the I-2 subset.25 Numbering of residues within the ICAM-4 model follows the numbering reported for the N-terminal amino acid sequence derived from ICAM-4 isolated from red cells.6,7 The N-terminal region of ICAM-4 has an additional 15 residues not present in the ICAM-2 crystal structure, but these have not been included in the model, although it is possible that they form an additional strand adjacent to the existing A/A' edge strand. The model of ICAM-4 therefore starts at residue 16 (VPF), which is equivalent to residue 1 (KVF) in the structure of ICAM-2.26 After energy minimization, the root mean square deviation of 185 equivalent C positions between the
ICAM-4 model and the ICAM-2 crystal structure is 0.065 nm (0.65 Å).
Like ICAM-2, ICAM-4 also has an additional disulphide bond in domain 1 between the B/C loop and the end of the F strand, a feature commonly
associated with IgSF domains that act as integrin ligands.25 There are 2 regions in domain 1 of the model
for ICAM-4 where the conformation differs significantly from that of
ICAM-2. These are the D/E loop, which forms a prominent protrusion from
the top of the molecule, and the E/F loop, which is in close proximity
to domain 2, where ICAM-4 has an insertion of one additional residue.
In the model, residue R52, which is equivalent to the proposed integrin-binding E37 in the LETSL motif of ICAM-2, adopts a similar location and conformation to the glutamic acid side
chain in ICAM-2. Significant differences are also observed in domain 2 at the C-terminal end of the A strand and in the C'/E and F/G loops
both at the top of domain 2, where contacts are made with domain 1. These latter changes suggest the contacts between the
domains and hence relative orientations of the domains are likely to
differ between ICAM-2 and ICAM-4. Our model makes no attempt to predict
these movements between whole domains, which are beyond the limitations
of current modeling techniques. A similar model for ICAM-4 has also
recently been described.39 Although it is not possible to
directly compare these models because the coordinates are not
available, the energy minimization of our model appears to have
generated marginally more loop movements in regions of poor sequence
homology. For 122 equivalent C positions, the model of Hermand et al
differs from the ICAM-2 crystal structure coordinates by 0.05 nm (0.85 Å), whereas the difference for our model is 0.10 nm (1.0 Å).
Nonetheless, the placement of key residues is essentially the same in
both model structures.
The exposure and conformation of residues forming the adhesion surface for domain 1 of ICAM-4 are largely similar to those reported for ICAM-2, although ICAM-4 has a paucity of acidic residues in the expected binding surfaces. Indeed, a distinctive feature of domain 1 in the ICAM-4 model is the concentration of basic residues in these regions, in particular on the CFG domain face. The acidic residue within the LD73V motif at the end of the E strand is exposed at the domain surface in the modeled structure (Figure 2B). The location and interactions of other residues mutated in this study were also examined to ensure, as far as possible, that the substituted side chains would not be deleterious for the protein conformation. S50, R52, and T91 are all surface residues in the model; none appear to be involved in critical hydrogen or other bonds at the domain surface (Figure 2B); and, from the model, no significant rearrangements of the protein surface would be expected to accompany their mutation to the ICAM-2 concensus residues G, E, and Q, respectively. Hemopoietic and nonhemopoietic cells show integrin-mediated adhesion to ICAM-4 A panel of 12 hemopoietic and 10 nonhemopoietic cell lines was tested for adhesion to soluble recombinant ICAM4Fc. To define optimal activating conditions, cells were tested in the presence of cations and after stimulation with phorbol ester. Six hemopoietic (HEL, THP1, KG1a, Raji, Jurkat, and Molt-4) and all nonhemopoietic cell lines bound to ICAM4Fc at levels that were characteristic of each cell line (Figure 3A, Tables 1 and 2). Adhesion of these cells was abrogated in the presence of EDTA, suggesting that binding was integrin-mediated (Figure 3B). Binding of hemopoietic HEL cells was markedly inhibited by LDV-containing peptide, whereas binding of nonhemopoietic FLY cells was partially inhibited by LDV peptide but was abrogated in the presence of RGD-containing peptide (Figure 3B). Two anti-ICAM-4 antibodies, BS46 and BS56, did not inhibit HEL or FLY cell adhesion to ICAM-4 (data not shown). A measure of the relative avidity of adhesion to ICAM-4 was obtained by examining binding of several hemopoietic and nonhemopoietic cell lines to titrated ICAM4Fc. For most hemopoietic lines that bound to ICAM-4, a plateau of binding was reached at 10 µg/mL (Figure 3C), while the plateau of binding for the nonhemopoietic cell lines ranged between 2.5 µg/mL (DX3) and 15 µg/mL (HT29) (Figure 3D).
The main ICAM-4-binding integrin of hemopoietic cell lines is
not L 2 and whether adhesion to any of the
mutant ICAM4Fc fusion proteins containing consensus ICAM-2
residues (IC4S50G, IC4R52E, and
IC4T91Q) was different compared with native ICAM4Fc. Each
mutant was titrated and tested, in comparison with native ICAM4Fc, for
adhesion of HEL cells. Similar results were obtained with wild-type and all mutant ICAM4Fc proteins, demonstrating that each mutant was functionally active (Figure 4A).
Hemopoietic cell lines were tested for adhesion to ICAM4Fc or mutant
ICAM-4-Fc proteins in comparison with ICAM-1-Fc, -2-Fc, and -3-Fc
or NCAMFc under optimal activating conditions for each cell
line (Table 1). Every cell line that adhered to ICAM4Fc also bound to
all mutant ICAM4Fc proteins, and no cell line that failed to adhere to
native ICAM4Fc bound mutant ICA4Fc proteins. The level of
L 2 integrin expression did not correlate
with adhesion to ICAM4Fc. HEL and Molt-4 cells expressed low levels of
L 2; adhered poorly to ICAM-1-Fc, -2-Fc, or -3-Fc; but adhered well to ICAM4Fc. Conversely, IM9 and EBV-LCL expressed high levels of L 2; adhered to
ICAM-1-Fc, -2-Fc, or -3-Fc; but did not adhere to ICAM4Fc or to
mutant ICAM4Fc proteins (Table 1).
Under conditions where adhesion to ICAM-1-Fc, -2-Fc, or -3-Fc was
markedly inhibited, function-blocking antibodies to integrin subunits
ICAM-4 is a ligand for 1 family (Table 1). In adhesion assays, a 1 blocking antibody (clone 13) abrogated
binding while an activating antibody (TS2/16) stimulated binding
( 1b, 1a, Figure
5A). Other subunit antibodies had no
effect. Blocking 4 antibodies (HP2/1, Max68P, and L25.3)
totally inhibited binding while an activating antibody (44H6) partially
inhibited binding ( 4a,
4b, Figure 5A). Other antibodies against subunits of 1-family integrins had no effect.
The integrin ICAM-4 is a ligand for 4 integrin subunit (FLY,
ECV304, HUVEC, and HT29), whereas the integrins
V 1, 2 1,
3 1, and V 5
were consistently expressed (Table 2). Function-blocking integrin
antibodies were tested for inhibition of adhesion of these
4-negative cell lines to ICAM4Fc (Figure 5D and not
shown). Of the subunit antibodies tested, only 1
antibody had an effect, causing partial inhibition of binding.
Antibodies to subunits of the 1 family were tested,
and only V antibodies had an effect, causing partial
inhibition of binding (irrespective of the antibody or concentration
used). The V complex antibodies were tested, and an
V 5 antibody partially inhibited adhesion.
Complete inhibition of binding was not observed with any combination of
inhibiting antibodies tested. The integrin profiles of the
4-negative cell lines, together with antibody inhibition
data, suggest that ICAM-4 is a ligand for both
V 1 and V 5
integrins (the profiles of FLY, HT29, and 293 cells are informative;
Table 2). Expression levels of V integrins did not
correlate with percentage of cells adhering or with the ICAM-4 coating
concentration at which this was maximal (Figure 3D, Table 2). The
restriction of the 4 1/ICAM-4 interaction
to a subset of hemopoietic cell lines contrasts with the observation
that all nonhemopoietic lines expressing
4 1 adhered to ICAM4Fc (DX3, HFFF,
SK-HEP-1, 293; Table 2). This adhesion was partially inhibited by
1, V, V 5,
and 4 antibodies, but no combination of antibodies
completely inhibited binding (data not shown). Expression levels of
4 and V integrins did not correlate with
percentage of cells adhering or the ICAM-4 coating concentration at
which this was maximal (Figure 3D, Table 2). Untransfected monkey
(COS-7) or hamster (CHO) cells also showed integrin-mediated adhesion
to ICAM-4 (Figure 3A, Table 2). Titration studies with 3 4 1-negative lines (FLY, HT29, ECV304;
Figure 3D) indicated that the avidity of ICAM-4/ V
integrin-mediated adhesion was of a similar order to
ICAM-4/ 4 1-mediated adhesion and was
equal to or greater than
MAdCAM-1/ 4 1-mediated adhesion, which
suggests biological relevance.
ICAM-4 site-directed mutation studies Mutation of residues on the CFG face of ICAM-4 (IC4R52E, IC4T91Q, and IC4S50G), homologous to those found to be important for L 2 binding in ICAM-1, -2, and -3, did not
reduce or increase 4 1-mediated adhesion
of hemopoietic cell lines (Figure 4A, Table 1) or
V-mediated binding of nonhemopoietic, FLY cells (not
shown). The ICAM-4 model predicts a solvent-accessible, consensus LDV
site on domain 1, located on the E strand, toward the bottom of the
domain (Figure 2B). 4 1-mediated adhesion
of HEL cells and V integrin-mediated adhesion of FLY
cells were unaffected by mutation of this motif (IC4D73R)
(Figure 6).
Our results indicate that ICAM-4 is unique in the ICAM family
because it binds through novel motifs to
Adhesion of hemopoietic cells to ICAM4Fc was markedly affected in the
presence of activating or inhibiting antibodies against Notably, HEL cells that bound with the highest avidity to ICAM-4 under
minimal activating conditions are of erythroid origin. Given that
ICAM-4 expression appears to be restricted to erythroid cells and
placenta,8 it is tempting to speculate that the molecule has a particular function in erythropoiesis. ICAM-4 is first expressed early in erythropoiesis, at the colony-forming unit-erythroid stage.9,44 In mammalian bone marrow, erythropoiesis occurs in discrete anatomic units known as erythroblastic
islands.45,46 The integrity of these structures is
maintained at least in part by the interaction of
Our finding that the adhesion of various cell lines to ICAM4Fc does not
correlate with the level of |