Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spring, F. A.
Right arrow Articles by Anstee, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spring, F. A.
Right arrow Articles by Anstee, D. J.
Related Collections
Right arrow Red Cells
Right arrow Cell Adhesion and Motility
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 July 2001, Vol. 98, No. 2, pp. 458-466

RED CELLS

Intercellular adhesion molecule-4 binds alpha 4beta 1 and alpha V-family integrins through novel integrin-binding mechanisms

Frances A. Spring, Stephen F. Parsons, Susan Ortlepp, Martin L. Olsson, Richard Sessions, R. Leo Brady, and David J. Anstee

From the Bristol Institute for Transfusion Sciences; Celltech, Slough; and the University of Bristol, United Kingdom; and the University Hospital Blood Centre, Lund, Sweden.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The LW blood group glycoprotein, ICAM-4, is a member of the intercellular adhesion molecule (ICAM) family expressed in erythroid cells. To begin to address the function of this molecule, ligands for ICAM-4 on hemopoietic and nonhemopoietic cell lines were identified. Peptide inhibition studies suggest that adhesion of cell lines to an ICAM-4-Fc construct is mediated by an LDV-inhibitable integrin on hemopoietic cells and an RGD-inhibitable integrin on nonhemopoietic cells. Antibody inhibition studies identified the hemopoietic integrin as alpha 4beta 1. Antibody inhibition studies on alpha 4beta 1-negative, nonhemopoietic cell lines suggested that adhesion of these cells is mediated by alpha V integrins (notably alpha Vbeta 1 and alpha Vbeta 5). The structure of ICAM-4 modeled on the crystal structure of ICAM-2 was used to identify surface-exposed amino acid residues for site-directed mutagenesis. Neither an unusual LETS nor an LDV motif in the first domain of ICAM-4 was critical for integrin binding. ICAM-4 is the first ICAM family member shown to be a ligand for integrins other than those of the beta 2 family, and the data suggest that ICAM-4 has a novel integrin-binding site(s). These findings suggest a role for ICAM-4 in normal erythropoiesis and may also be relevant to the adhesive interactions of sickle cells. (Blood. 2001;98:458-466)

© 2001 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Knowledge of cell-cell and cell-extracellular matrix interactions in bone marrow is essential for an understanding of the formation of blood cells and their migration into the peripheral circulation. Such interactions are also relevant to the biology of diseases like sickle cell disease and malaria where adhesive interactions involving red cells and damaged endothelium are crucial features of the pathology.1-3 These adhesive interactions frequently involve molecules belonging to the immunoglobulin superfamily (IgSF) of proteins and the family of proteins known as integrins. Integrins are heterodimers composed of 2 noncovalently associated transmembrane subunits denoted "alpha " and "beta ." Eight different beta  subunits combine in a restricted manner with 18 alpha  subunits to form some 22 different integrins. Beta subunits complex with several different alpha  subunits, while most alpha  subunits (with the exception of alpha V, alpha 4, and alpha 6) combine with only one beta  subunit.4

The LW blood group glycoprotein, or ICAM-4, is a member of the IgSF subfamily known as intercellular adhesion molecules (ICAMs). It has 2 predicted IgSF I-set domains,5-7 and within the subfamily it is most similar to ICAM-2. ICAM-4 has been found expressed only on erythroid cells and weakly in placenta.8,9 ICAM-1, -2, and -3 function in inflammation and immune responses,10 but no function for ICAM-4 has been defined.

The ICAMs are ligands for beta 2 integrins, and all family members, including ICAM-4, are reported to bind alpha Lbeta 2.10-13 ICAM-1 and ICAM-4 are also ligands for alpha Mbeta 2,10,11 while the preferred ligand for ICAM-3 is alpha Dbeta 2.14 Unlike ICAM-1, -2, -3, -5, which have the alpha Lbeta 2-binding motif (L/I)ET(P/S)L (Figure 1), ICAM-4 has the nonconsensus sequence LR52TPL within the C strand of domain 1 and also has an adjacent potential N-glycosylation site (N48; Figure 1). Another residue (Q) in the G strand is also important for alpha Lbeta 2 binding in ICAM-1, -2, and -3.15-18 ICAM-4 has T91 in this equivalent position (Figure 1), as does ICAM-5. Several other IgSF molecules, including vascular cell adhesion molecule (VCAM)-1, mucosal addressin cell adhesion molecule (MAdCAM)-1, CD31, and L1 are also integrin ligands.10,19-22 VCAM-1 and MAdCAM-1 are related to the ICAM family but are bound by alpha 4 integrins. An aspartic acid residue in the CD loop within the motif QIDSP or GLDTS, respectively, is critical for integrin binding in these molecules.19,23 These motifs are all variants of the LDV sequence, which exhibits considerable sequence variation in different ligands.24


View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. The C and G strands of ICAM family N-terminal domains. Residues critical for alpha Lbeta 2 binding are boxed; numbering is for ICAM-4.

X-ray crystal structures of 2-domain fragments of ICAM-1, ICAM-2, VCAM-1, and MAdCAM-1 provide insights into the structural basis of IgSF-integrin interactions.25 ICAM-1 and -2 are both ligands for the I domain-containing alpha Lbeta 2 integrin. In these ICAMs, a critical glutamic acid residue is located on the relatively flat surface of the CFG face of the molecule.26-28 In contrast, VCAM-1 and MAdCAM-1 are ligands for non-I domain alpha 4 integrins and have a critical aspartic acid residue on a protruding CD loop.29,30

We have modeled ICAM-4 based on the published crystal structure of ICAM-2 to identify the positioning of the ICAM-4 nonconsensus LR52TPL motif and to test whether an LD73V motif located at the end of the predicted E strand is solvent-exposed. Using soluble, recombinant ICAM-4 constructs and by mutating several key residues to restore consensus ICAM-2 sequences, we have explored the integrin-binding properties of the molecule in cell-based adhesion assays. We have also targeted the LD73V motif in domain 1 by site-directed mutagenesis to test for involvement in integrin binding. Our results show that ICAM-4 has an unusual integrin-binding profile in that it binds alpha 4beta 1 and alpha V-containing integrins and suggest that the reported binding of alpha Lbeta 2 is of lesser significance. The results also show that ICAM-4 must have novel ligand-binding motif(s).


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

ICAM-4 homology model

A homology model for ICAM-4 was constructed by mutation of the ICAM-2 structure26 followed by energy minimization. Using an alignment of the ICAM-2 and ICAM-4 sequences, the coordinates of ICAM-2 were mutated to match the corresponding sequence for ICAM-4. Where insertion or deletion of residues was necessary, these were constructed using the loop-building facility in InsightII (MSI, San Diego, CA) maintaining maximal homology to ICAM-2 and reasonable peptide geometry. After soaking with an 0.8-nm (8-Å) layer of water, the model structure was energy-minimized while tethering the backbone atoms to their initial positions. The tethering force was reduced during this procedure from 4200 kJ/nm (100 kcal/Å) to a final value of 21 kJ/nm (0.5 kcal/Å). The energy-minimized structures (average derivative < 0.84 kJ/nm [0.02 kcal/Å]) were analyzed using Procheck59 and found to be of similar or better quality compared with the original crystal structure. Structural manipulations were carried out using InsightII97 and energy minimizations using the cvff forcefield implemented in Discover (version 2.97, MSI, San Diego, CA).

Mammalian cell lines studied

Cells lines were mostly from European Culture Collection, Wiltshire, United Kingdom. The beta 1 integrin-negative subclone of JY (Prof M. Humphries, University of Manchester, United Kingdom), fibrosarcoma (FLYRD18 [FLY], Dr C. Porter, Hammersmith Hospital, London, United Kingdom), and endothelial (ECV304 and SK-HEP1, Dr P. Evans, Southampton General Hospital, United Kingdom) lines were gifts. Human umbilical vein endothelial cells (HUVECs) were as described.31 K562 cells transfected with alpha Lbeta 2 (KL/4) or alpha 4 (KA4C6, which expresses a constitutively active form of alpha 4beta 1) were as described.32 All cells were maintained in Iscoves modified Eagle medium (IMEM), 10% fetal bovine serum.

Antibodies and peptides

Function-blocking monoclonal antibodies to integrin subunits were anti-beta 1 (clone13, Becton Dickinson, Oxford, United Kingdom); anti-beta 2 (MHM23, Dako, Bucks, United Kingdom; YFC118.3, Serotec, Oxford, United Kingdom; 1B4, Alexis, Bingham, United Kingdom; P4H9-A11, Chemicon International, Harrow, United Kingdom); anti-beta 3 (PM6/13, Harlan Sera-Lab, Loughborough, United Kingdom; RUU-PL 7F12, Becton Dickinson); anti-beta 4 (ASC-3, Chemicon); anti-alpha L (38, Dr N Hogg, London, United Kingdom; MHM24, Dako); anti-alpha 1 (FB12, Chemicon); anti-alpha 2 (JA218, Prof M. Humphries, University of Manchester); anti-alpha 3 (C3[VLA3], Immunotech, High Wycombe, United Kingdom); anti-alpha 4 (HP2/1, Serotec; L25.3, Becton Dickinson; Max68P, Dr T. Shock, Celltech, Slough, United Kingdom); anti-alpha 5 (SNAKA55, Prof M. Humphries); anti-alpha 6 (NKI-GoH3, Serotec); anti-alpha V (69.9.5, Immunotech; CLB-706, Chemicon); anti-alpha Vbeta 3 (23C6, Serotec; LM609, Harlan Sera-Lab); and anti-alpha Vbeta 5 (P1F6, Becton Dickinson). Activating antibodies to integrin subunits were anti-beta 1 (TS2/16, American Type Culture Collection, Manassas, VA); anti-beta 2 (KIM127, KIM185 as described33,34); and anti-alpha 4 (44H6, Serotec). Antibodies against the first domain of ICAM-4 (BS46, BS56) were from Dr H. Sonneborn, Biotest, Dreieich, Germany. Linear peptides GRGDSPK and EILDVPST were synthesized in-house.

Preparation of fusion proteins

ICAM-4-Fc fusion proteins (ICAM4Fc) used in the study comprised the 2 extracellular domains of ICAM-4 and the hinge region and Fc domains of human IgG1 as described.35 ICAM-4 complementary DNA (cDNA) encoding leader sequence and the 2 extracellular IgSF domains (ICAM-4 amino acid residues -30 to 196) was amplified by polymerase chain reaction (PCR) using sense primer (TTCCCAAGCTTTGCCATGGGGTCTCTGTTCCCT), antisense primer (ACGGATCCACTTACCTGTGGGGCTCCAAGCGAGCATCAGTGT), and full-length ICAM-4 cDNA template. This DNA was subcloned into pBluescript and used for subsequent steps. Mutant ICAM-4 cDNAs encoding consensus ICAM-2 residues at amino acid residues 50, 52, and 91, IC4S50G (removes consensus N48 glycosylation site), IC4R52E, and IC4T91Q were made using inverse PCR.36 Sense primer 5'-ACCCCGCTGCGGCAAGGCAAGACGCTCAGA was used for mutants IC4S50G and IC4R52E. Antisense primer for IC4R52E was 5'-TTCGAGGCTGGAATTCTGCGGCTGGGGACA and for IC4S50G was 5'-GCGGAGGCCGGAATTCTGCGGCTGGGGACA. Sense primer for IC4T91Q was 5'-ACGCTGGGCCACCTCCAGGATCACCGCCTA and antisense primer was 5'-TGTTTTCCTGCGCAGGTCACGAGGCAGTGC. Native and mutant ICAM-4 cDNAs were subcloned into pIg vector as described.35 A mutant encoding IC4D73R was generated by overlap extension PCR36 using native ICAM-4 cDNA in pIg as template with complementary, mutational ICAM-4 primers 5'-GCTGCTCCGCGTGAGGGCCTGG and 5'-CCAGGCCCTCACGCGGAGCAGC together with sense and antisense pIg vector primers 5'-AGAACCCACTGCTTACTGGCT and 5'-TGAGCCTGCTTCCAGCAGACA. All clones were verified by sequence analysis. The cDNA clones encoding the extracellular domains of ICAM-1, -2, and -3 and neural cell adhesion molecule (NCAM) in pIg were gifts from Dr D. Simmons, SmithKline Beecham, Harlow, United Kingdom. CAMFc proteins were expressed in COS-7 cells as described35 and extracted from culture supernatant on protein A-Sepharose. Fc fusion proteins containing the first 2 domains of VCAM-1 (VCAMFc) or MAdCAM-1 (MAdCAMFc) were as described.37 ICAM4Fc and mutant ICAM4Fc proteins migrated with Mr about 100 000 kd on sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions. IC4S50G migrated with somewhat lower Mr, suggesting an absence of N-glycan at residue N48. Western blotting (nonreducing conditions) using antihuman IgG and anti-ICAM-4 antibodies BS46 and BS56 was also performed (not shown). Protein concentrations were determined by the "Nano-orange" technique (Molecular Probes, Leiden, The Netherlands).

Flow cytometry

Cells were analyzed for antigen expression as described.38 Mean fluorescence intensity was used as a measure of antibody binding.

Cell adhesion assay

Immulon-4 96-well plates (Dynex Technologies, Billingshurst, United Kingdom) were coated with 1 µg/well goat-antihuman-Fc (Sigma, Poole, United Kingdom) for 18 hours at 4°C, blocked with phosphate-buffered saline (pH 7.4), 0.4% bovine serum albumin (Fraction V, Sigma) for 2 hours at 22°C, and coated with chimeric proteins in phosphate-buffered saline (1 µg/well unless stated otherwise) for 2 hours at 37°C. Hemopoietic cells were washed once in assay buffer (IMEM, 2 mM EGTA, 5% human group AB serum [National Blood Service, Bristol, United Kingdom]). Nonhemopoietic cells were lifted in phosphate-buffered saline containing 2 mM ethylenediaminetetraacetic acid (EDTA), 0.1% bovine serum albumin and washed once in IMEM containing 0.1% (wt/vol) bovine serum albumin. Cells (107/mL in assay buffer) were labeled with 10 µg/mL 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (Sigma) for 15 minutes at 37°C and washed thrice in assay buffer. Cells were activated with 80 µM phorbol myristate acetate (PMA, Sigma) in assay buffer for 15 minutes at 37°C and washed twice in assay buffer containing cations. Cells were incubated for 15 minutes at 0°C with 10 µg/mL antibodies (KIM and anti-ICAM-4 antibodies at 25 µg/mL), 500 µM peptides, or 25 µg/mL ICAM4Fc in assay buffer containing 2 mM Mn2+ or 10 mM Mg2+. Cells were added to CAMFc-coated plates (5 × 104/well in 100 µL) for 30 minutes at 37°C. Plates were read on a fluorescence microplate reader (excitation 485 nm, emission 530 nm, Bio-Tek Instruments, VT), given standardized washes in assay buffer, and read after each wash. Washing was performed by flooding the plates with assay buffer at 37°C and then vigorously decanting the buffer to waste by rapid inversion of the plate. The percentage of input cells bound was calculated. Each data point is the mean of 3 or more replicates, and assays were performed on at least 3 independent occasions.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

ICAM-4 homology model

A homology model of ICAM-4 was constructed (Figure 2A) based on the crystal structure of ICAM-2,26 which, in the region modeled, has 29% amino acid sequence identity with ICAM-4. Because this tentative model is derived from sequence homology with ICAM-2, it closely follows the reported fold for ICAM-2 with domain 1 adopting an I-1 fold and domain 2 belonging to the I-2 subset.25 Numbering of residues within the ICAM-4 model follows the numbering reported for the N-terminal amino acid sequence derived from ICAM-4 isolated from red cells.6,7 The N-terminal region of ICAM-4 has an additional 15 residues not present in the ICAM-2 crystal structure, but these have not been included in the model, although it is possible that they form an additional strand adjacent to the existing A/A' edge strand. The model of ICAM-4 therefore starts at residue 16 (VPF), which is equivalent to residue 1 (KVF) in the structure of ICAM-2.26 After energy minimization, the root mean square deviation of 185 equivalent Calpha positions between the ICAM-4 model and the ICAM-2 crystal structure is 0.065 nm (0.65 Å). Like ICAM-2, ICAM-4 also has an additional disulphide bond in domain 1 between the B/C loop and the end of the F strand, a feature commonly associated with IgSF domains that act as integrin ligands.25 There are 2 regions in domain 1 of the model for ICAM-4 where the conformation differs significantly from that of ICAM-2. These are the D/E loop, which forms a prominent protrusion from the top of the molecule, and the E/F loop, which is in close proximity to domain 2, where ICAM-4 has an insertion of one additional residue. In the model, residue R52, which is equivalent to the proposed integrin-binding E37 in the LETSL motif of ICAM-2, adopts a similar location and conformation to the glutamic acid side chain in ICAM-2. Significant differences are also observed in domain 2 at the C-terminal end of the A strand and in the C'/E and F/G loops both at the top of domain 2, where contacts are made with domain 1. These latter changes suggest the contacts between the domains---and hence relative orientations of the domains---are likely to differ between ICAM-2 and ICAM-4. Our model makes no attempt to predict these movements between whole domains, which are beyond the limitations of current modeling techniques. A similar model for ICAM-4 has also recently been described.39 Although it is not possible to directly compare these models because the coordinates are not available, the energy minimization of our model appears to have generated marginally more loop movements in regions of poor sequence homology. For 122 equivalent Calpha positions, the model of Hermand et al differs from the ICAM-2 crystal structure coordinates by 0.05 nm (0.85 Å), whereas the difference for our model is 0.10 nm (1.0 Å). Nonetheless, the placement of key residues is essentially the same in both model structures.


View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. Model of ICAM-4. Domain 1 is at the top of the figure. (A) Model of ICAM-4 (Calpha trace in bold) is overlaid on the equivalent trace for the crystal structure of ICAM-2 (thin lines). (B) Ribbon diagram of the modeled ICAM-4 structure, with beta  strands labeled A-G and the residues mutated in this study highlighted.

The exposure and conformation of residues forming the adhesion surface for domain 1 of ICAM-4 are largely similar to those reported for ICAM-2, although ICAM-4 has a paucity of acidic residues in the expected binding surfaces. Indeed, a distinctive feature of domain 1 in the ICAM-4 model is the concentration of basic residues in these regions, in particular on the CFG domain face. The acidic residue within the LD73V motif at the end of the E strand is exposed at the domain surface in the modeled structure (Figure 2B). The location and interactions of other residues mutated in this study were also examined to ensure, as far as possible, that the substituted side chains would not be deleterious for the protein conformation. S50, R52, and T91 are all surface residues in the model; none appear to be involved in critical hydrogen or other bonds at the domain surface (Figure 2B); and, from the model, no significant rearrangements of the protein surface would be expected to accompany their mutation to the ICAM-2 concensus residues G, E, and Q, respectively.

Hemopoietic and nonhemopoietic cells show integrin-mediated adhesion to ICAM-4

A panel of 12 hemopoietic and 10 nonhemopoietic cell lines was tested for adhesion to soluble recombinant ICAM4Fc. To define optimal activating conditions, cells were tested in the presence of cations and after stimulation with phorbol ester. Six hemopoietic (HEL, THP1, KG1a, Raji, Jurkat, and Molt-4) and all nonhemopoietic cell lines bound to ICAM4Fc at levels that were characteristic of each cell line (Figure 3A, Tables 1 and 2). Adhesion of these cells was abrogated in the presence of EDTA, suggesting that binding was integrin-mediated (Figure 3B). Binding of hemopoietic HEL cells was markedly inhibited by LDV-containing peptide, whereas binding of nonhemopoietic FLY cells was partially inhibited by LDV peptide but was abrogated in the presence of RGD-containing peptide (Figure 3B). Two anti-ICAM-4 antibodies, BS46 and BS56, did not inhibit HEL or FLY cell adhesion to ICAM-4 (data not shown). A measure of the relative avidity of adhesion to ICAM-4 was obtained by examining binding of several hemopoietic and nonhemopoietic cell lines to titrated ICAM4Fc. For most hemopoietic lines that bound to ICAM-4, a plateau of binding was reached at 10 µg/mL (Figure 3C), while the plateau of binding for the nonhemopoietic cell lines ranged between 2.5 µg/mL (DX3) and 15 µg/mL (HT29) (Figure 3D).


View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Hemopoietic and nonhemopoietic cell lines adhere to ICAM4Fc. Adhesion assays were as described in "Materials and methods." Results are input cells bound ± SD (n = 6). (A) Binding of hemopoietic cell lines (HEL, KG1a, THP1, IM9) and nonhemopoietic cell lines (FLY, HUVEC, 293, COS) to ICAM4Fc (black-square) or to NCAMFc (control, ). Activating conditions were cations (HEL, HUVEC) and PMA+ cations (IM9, KG1a, THP1, FLY, 293, COS). (B) Binding of cation-activated HEL cells () or PMA+ cation-activated FLY cells (black-square) to ICAM4Fc in the presence of 2 mM EDTA, LDV peptide, or RGD peptide (500 µM). (C) Relative avidity of adhesion of hemopoietic cell lines to ICAM4Fc. Results are adjusted by subtraction of the baseline binding to NCAMFc (for maximal levels, see Table 1). Activation conditions were cations (HEL,black-diamond ; Raji) and PMA+ cations (Jurkat, black-square; THP1, black-triangle; Molt-4, diamond ; EBV-LCL, triangle ; U937, ). (D) Relative avidity of adhesion of nonhemopoietic cell lines to ICAM4Fc. Results are adjusted by subtraction of the baseline binding to NCAMFc (for maximal levels, see Table 2) Activation conditions were cations (HT29, diamond ) and PMA+ cations (DX3, black-diamond ; FLY, black-square; SK-HEP1, black-triangle; HFFF, ).


                              
View this table:
[in this window]
[in a new window]
 
Table 1. Adhesion of hemopoietic cells to Fc fusion proteins


                              
View this table:
[in this window]
[in a new window]
 
Table 2. A comparison of the adhesion of nonhemopoietic cell lines to intercellular adhesion molecule-4Fc with their integrin profiles determined by flow cytometry

The main ICAM-4-binding integrin of hemopoietic cell lines is not alpha Lbeta 2

We tested whether the LDV-inhibitable hemopoietic integrin was alpha Lbeta 2 and whether adhesion to any of the mutant ICAM4Fc fusion proteins containing consensus ICAM-2 residues (IC4S50G, IC4R52E, and IC4T91Q) was different compared with native ICAM4Fc. Each mutant was titrated and tested, in comparison with native ICAM4Fc, for adhesion of HEL cells. Similar results were obtained with wild-type and all mutant ICAM4Fc proteins, demonstrating that each mutant was functionally active (Figure 4A). Hemopoietic cell lines were tested for adhesion to ICAM4Fc or mutant ICAM-4-Fc proteins in comparison with ICAM-1-Fc, -2-Fc, and -3-Fc or NCAMFc under optimal activating conditions for each cell line (Table 1). Every cell line that adhered to ICAM4Fc also bound to all mutant ICAM4Fc proteins, and no cell line that failed to adhere to native ICAM4Fc bound mutant ICA4Fc proteins. The level of alpha Lbeta 2 integrin expression did not correlate with adhesion to ICAM4Fc. HEL and Molt-4 cells expressed low levels of alpha Lbeta 2; adhered poorly to ICAM-1-Fc, -2-Fc, or -3-Fc; but adhered well to ICAM4Fc. Conversely, IM9 and EBV-LCL expressed high levels of alpha Lbeta 2; adhered to ICAM-1-Fc, -2-Fc, or -3-Fc; but did not adhere to ICAM4Fc or to mutant ICAM4Fc proteins (Table 1).


View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Adhesion of hemopoietic cells to ICAM4Fc is not alpha Lbeta 2-mediated. Adhesion assays were as described in "Materials and methods." Results are input cells bound ± SD (n = 6). (A) Adhesion of cation-activated HEL cells to ICAM-4 and mutant ICAM-4-Fc proteins (coated at 0.5 µg/well). (B) Binding of PMA+ cation-activated THP1 cells to ICAM-1-Fc, -2-Fc, and -3-Fc, ICAM4Fc, and mutant ICAM-4-Fc proteins (coated at 0.5 µg/well) in the presence of inhibiting anti-alpha L (mab 38, hatched), anti-beta 2 (1B4, black) antibodies or a control antibody (white). (C) Adhesion of PMA+ cation-activated IM9 cells to ICAMs-Fc, -2-Fc, and -3-Fc, ICAM4Fc, and mutant ICAM4Fc proteins (coated at 1 µg/well). Cells were treated with either control antibody (white) or activating beta 2 antibodies, KIM127 (hatched) or KIM185 (black).

Under conditions where adhesion to ICAM-1-Fc, -2-Fc, or -3-Fc was markedly inhibited, function-blocking antibodies to integrin subunits alpha L and beta 2 did not abrogate binding of hemopoietic cell lines to ICAM4Fc or to mutant ICAM4Fc proteins (Figure 4B; several alpha L and beta 2 antibodies were tested and representative results are shown). A small reduction of THP1 cell adhesion to ICAM4Fc in the presence of alpha L or beta 2 antibodies was observed, suggesting there may be some alpha Lbeta 2-mediated adhesion of THP1 cells. An alternative interpretation is that this apparent blocking was nonspecific because a similar reduction in background THP1 cell adhesion to NCAMFc control protein was also observed (Figure 4B). Treatment with beta 2-activating antibodies (KIM127 and KIM185) increased the percentage of IM9 and EBV-LCL cells adhering to ICAM-1-Fc, -2-Fc, or -3-Fc proteins but not to ICAM4Fc or to mutant ICAM4Fc proteins (Figure 4C and not shown). An alpha Lbeta 2-transfected cell line (KL/4) also adhered to ICAM-1-Fc, -2-Fc, or -3-Fc but failed to adhere to ICAM4Fc or mutant ICAM4Fc proteins under maximally activating conditions (not shown).

ICAM-4 is a ligand for alpha 4beta 1 of hemopoietic cells

All hemopoietic cell lines that adhered to ICAM4Fc were found to express integrins of the beta 1 family (Table 1). In adhesion assays, a beta 1 blocking antibody (clone 13) abrogated binding while an activating antibody (TS2/16) stimulated binding (beta 1b, beta 1a, Figure 5A). Other beta  subunit antibodies had no effect. Blocking alpha 4 antibodies (HP2/1, Max68P, and L25.3) totally inhibited binding while an activating antibody (44H6) partially inhibited binding (alpha 4a, alpha 4b, Figure 5A). Other antibodies against alpha  subunits of beta 1-family integrins had no effect.


View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Adhesion of hemopoietic cells to ICAM4Fc is alpha 4beta 1-mediated, and adhesion to nonhemopoietic cells is alpha V integrin-mediated. Adhesion assays were as described in "Materials and methods." (A) Adhesion of cation-activated, hemopoietic, HEL cells to ICAM4Fc in the presence of blocking (b) or activating (a) antibodies to integrin alpha  or beta  subunits as described in "Materials and methods." Results are cells bound ± SD (n = 6), in comparison with control antibody (C, 100%). Antibodies used were beta 1b, clone 13; beta 1a, TS2/16; beta 2b, MHM23; beta 3b, RUU-PL; alpha 1, FB12; alpha 2, JA218; alpha 3, C3(VLA3); alpha 4b, HP2/1; alpha 4a, 44H6; alpha 5b, SNAKA55; alpha 6 b, NKI-GoH3; and alpha V b, 69.9.5. ICAM4Fc was coated at 0.5 µg/well. (B) Comparison of the relative avidity of adhesion of cation-activated HEL cells to VCAMFc (diamonds), MAdCAMFc (triangles), ICAM4Fc (squares), and NCAMFc (crosses) by titration of CAMFc protein as described in "Materials and methods." Results are input cells bound ± SD (n = 6). (C) Adhesion of cation-activated beta 1-negative JY cells and HEL cells to VCAMFc, MAdCAMFc, ICAM4FcFc, and NCAMFc. Fc fusion proteins were coated at 0.05 µg/well (VCAMFc, MAdCAMFc) and 1 µg/well (ICAM4Fc, NCAMFc). Results are the percentage of input cells bound ± SD (n = 6). (D) Adhesion of PMA+ cation-activated, nonhemopoietic, FLY cells to ICAM4Fc in the presence of blocking antibodies to integrin alpha  or beta  subunits or integrin complexes as described in "Materials and methods." Results are cells bound ± SD (n = 6), in comparison with control antibody (C, 100%). Blocking antibodies were as above except beta 4, ASC-3; alpha Vbeta 3, LM609; and alpha Vbeta 5, P1F6. ICAM4Fc was coated at 0.25 µg/well.

The integrin alpha 4beta 1 has 2 other well-characterized IgSF ligands, VCAM-1 and MAdCAM-1, both of which are related to the ICAM family. A measure of the relative avidity of alpha 4beta 1-expressing cells for the 3 ligands ICAM-4, VCAM-1, and MAdCAM-1 was obtained by defining the minimum concentration of ligand that promoted adhesion of HEL cells in titrations. Values of 10 µg/mL for ICAM4Fc, 0.05 µg/mL for VCAMFc, and 15 µg/mL for MAdCAMFc were obtained (Figure 5B). These findings are consistent with those of Newham et al,40 who also reported that the relative avidity of alpha 4beta 1-mediated adhesion to VCAM-1 was more than 10 times the avidity for MAdCAM-1. The avidity of alpha 4beta 1/ICAM-4-mediated adhesion was therefore either greater or of a similar order to alpha 4beta 1/MAdCAM-1-mediated adhesion. A beta 1-negative, beta 7-positive subclone of the JY cell line that expresses alpha 4beta 7 adhered to VCAMFc or MAdCAMFc but did not adhere to ICAM4Fc (Figure 5C). The data suggest that ICAM-4 may not be a ligand for alpha 4beta 7 in this B-cell line.

ICAM-4 is a ligand for alpha V integrins of nonhemopoietic cells

Every nonhemopoietic cell line tested, whether of human or animal origin, bound to ICAM4Fc (Figure 3A,D; Table 2). Several cell lines did not express the alpha 4 integrin subunit (FLY, ECV304, HUVEC, and HT29), whereas the integrins alpha Vbeta 1, alpha 2beta 1, alpha 3beta 1, and alpha Vbeta 5 were consistently expressed (Table 2). Function-blocking integrin antibodies were tested for inhibition of adhesion of these alpha 4-negative cell lines to ICAM4Fc (Figure 5D and not shown). Of the beta  subunit antibodies tested, only beta 1 antibody had an effect, causing partial inhibition of binding. Antibodies to alpha  subunits of the beta 1 family were tested, and only alpha V antibodies had an effect, causing partial inhibition of binding (irrespective of the antibody or concentration used). The alpha V complex antibodies were tested, and an alpha Vbeta 5 antibody partially inhibited adhesion. Complete inhibition of binding was not observed with any combination of inhibiting antibodies tested. The integrin profiles of the alpha 4-negative cell lines, together with antibody inhibition data, suggest that ICAM-4 is a ligand for both alpha Vbeta 1 and alpha Vbeta 5 integrins (the profiles of FLY, HT29, and 293 cells are informative; Table 2). Expression levels of alpha V integrins did not correlate with percentage of cells adhering or with the ICAM-4 coating concentration at which this was maximal (Figure 3D, Table 2). The restriction of the alpha 4beta 1/ICAM-4 interaction to a subset of hemopoietic cell lines contrasts with the observation that all nonhemopoietic lines expressing alpha 4beta 1 adhered to ICAM4Fc (DX3, HFFF, SK-HEP-1, 293; Table 2). This adhesion was partially inhibited by beta 1, alpha V, alpha Vbeta 5, and alpha 4 antibodies, but no combination of antibodies completely inhibited binding (data not shown). Expression levels of alpha 4 and alpha V integrins did not correlate with percentage of cells adhering or the ICAM-4 coating concentration at which this was maximal (Figure 3D, Table 2). Untransfected monkey (COS-7) or hamster (CHO) cells also showed integrin-mediated adhesion to ICAM-4 (Figure 3A, Table 2). Titration studies with 3 alpha 4beta 1-negative lines (FLY, HT29, ECV304; Figure 3D) indicated that the avidity of ICAM-4/alpha V integrin-mediated adhesion was of a similar order to ICAM-4/alpha 4beta 1-mediated adhesion and was equal to or greater than MAdCAM-1/alpha 4beta 1-mediated adhesion, which suggests biological relevance.

ICAM-4 site-directed mutation studies

Mutation of residues on the CFG face of ICAM-4 (IC4R52E, IC4T91Q, and IC4S50G), homologous to those found to be important for alpha Lbeta 2 binding in ICAM-1, -2, and -3, did not reduce or increase alpha 4beta 1-mediated adhesion of hemopoietic cell lines (Figure 4A, Table 1) or alpha V-mediated binding of nonhemopoietic, FLY cells (not shown). The ICAM-4 model predicts a solvent-accessible, consensus LDV site on domain 1, located on the E strand, toward the bottom of the domain (Figure 2B). alpha 4beta 1-mediated adhesion of HEL cells and alpha V integrin-mediated adhesion of FLY cells were unaffected by mutation of this motif (IC4D73R) (Figure 6).


View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Comparison of the relative avidity of adhesion of HEL cells and FLY cells to native ICAM4Fc and IC4D73RFc. Binding of cation-activated HEL cells or PMA+ cation-activated FLY cells was compared by titration of ICAM4Fc, IC4D73RFc, and NCAMFc as described in "Materials and methods." Adhesion to ICAM4Fc, IC4D73RFc, or NCAMFc of HEL cells is indicated by triangles, crosses, or lines, respectively. Adhesion to ICAM4Fc, IC4D73RFc, or NCAMFc of FLY cells is indicated by diamonds, squares, or stars, respectively.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Our results indicate that ICAM-4 is unique in the ICAM family because it binds through novel motifs to alpha 4beta 1 and alpha V integrins. We have demonstrated adhesion of hemopoietic (LDV peptide-inhibitable) and nonhemopoietic (RGD peptide-inhibitable) cells to soluble, recombinant ICAM-4. LDV- and RGD-containing peptides have been used extensively as inhibitors of integrin-mediated interactions because these motifs, or their variants, are found in many integrin ligands.24,41 Given the short incubation times in our experiments and our observation that EDTA also inhibited adhesion, we concluded that adhesion was integrin-mediated and hypothesized that there are 2 different integrin ligands for ICAM-4: an LDV-inhibitable hemopoietic integrin and a nonhemopoietic cell integrin that has a preference for RGD- over LDV-containing sequences.

Adhesion of hemopoietic cells to ICAM4Fc was markedly affected in the presence of activating or inhibiting antibodies against alpha 4 or beta 1, which strongly suggests that ICAM-4 is bound by the hemopoietic integrin alpha 4beta 1. The observation that an activating anti-alpha 4 caused partial inhibition of HEL cell adhesion might indicate that the binding site for ICAM-4 on alpha 4beta 1 is qualitatively different from that occupied by VCAM-1 or MAdCAM-1. There is evidence for overlapping but distinct binding sites for ICAM-1 and ICAM-3 on alpha Lbeta 2, which might represent an analogous situation.42 The ICAM-4/alpha 4beta 1 interaction was seen only with certain alpha 4beta 1-expressing hemopoietic lines (but was seen with all alpha 4beta 1-positive nonhemopoietic lines; see above) and did not correlate with alpha 4beta 1 expression levels. An activating beta 1 antibody did not induce ICAM-4 binding in the nonbinding cell lines, suggesting that in hemopoietic cells interaction with ICAM-4 is dependent on additional factors. Masumoto and Hemler43 suggest that the activation state of alpha 4beta 1 is regulated in each cell type by unknown cell-specific constraints and that not all cell types can achieve the highest states of activation and bind the full repertoire of ligands. Our data are consistent with the notion that not all alpha 4beta 1-positive hemopoietic cell lines can achieve the activation state required for binding to ICAM-4. The restriction of the alpha 4beta 1/ICAM-4 interaction to a subset of hemopoietic cell lines contrasts with the observation that all nonhemopoietic lines expressing alpha 4beta 1 adhered to ICAM4Fc. An alpha 4beta 1-expressing, K562, alpha 4-transfectant (KA4C6, PMA-activated-positive cations) adhered to VCAMFc but not to MAdCAMFc or ICAM4Fc (not shown). This result might reflect the cell-specific activation state of alpha 4beta 1 in this transfectant. We were unable to test transfectants of COS or CHO origin because untransfected cells adhered to ICAM4Fc (Figure 3A, Table 2).

Notably, HEL cells that bound with the highest avidity to ICAM-4 under minimal activating conditions are of erythroid origin. Given that ICAM-4 expression appears to be restricted to erythroid cells and placenta,8 it is tempting to speculate that the molecule has a particular function in erythropoiesis. ICAM-4 is first expressed early in erythropoiesis, at the colony-forming unit-erythroid stage.9,44 In mammalian bone marrow, erythropoiesis occurs in discrete anatomic units known as erythroblastic islands.45,46 The integrity of these structures is maintained at least in part by the interaction of alpha 4beta 1 expressed on erythroblasts, with VCAM-1 expressed on a central macrophage.47 In vivo treatment of mice with VLA-4 antibodies specifically induces anemia.48 Our results show that the apparent avidity of alpha 4beta 1-mediated adhesion of an erythroblast cell line to ICAM-4 is 200-fold lower than that estimated for alpha 4beta 1-mediated adhesion to VCAM-1. We have postulated elsewhere that the interaction of ICAM-4 with its ligand alpha 4beta 1 on adjacent erythroblasts may help to stabilize erythroblastic islands.49 It is likely that there are multiple interactions between adjacent cells in these structures, and further studies will be necessary to assess the physiologic relevance of those involving ICAM-4.

Our finding that the adhesion of various cell lines to ICAM4Fc does not correlate with the level of alpha Lbeta 2 expression; that adhesion is not abrogated by function-blocking, alpha Lbeta 2 antibodies; that adhesion is not enhanced by activating alpha Lbeta 2 antibodies; and that an alpha Lbeta 2 transfectant does not adhere all suggests that adhesion to ICAM-4 or ICAM-4 mutants is not mediated by alpha Lbeta 2 in the hemopoietic cell lines examined. In contrast to these findings, others have reported that ICAM-4 is a ligand for both alpha Lbeta 2 and alpha Mbeta 2 on peripheral blood lymphocytes and transfected cell lines.11,39 In these other studies, alpha Lbeta 2-mediated adhesion was observed only in the presence of 2 mM CaCl2, and the maximum adhesion observed was only about 12% bound cells. In adhesion assays using ICAM4Fc and alpha 4beta 1-expressing hemopoietic cell lines, we found that adhesion was inhibited in the presence of 2 mM CaCl2 and was maximal in the presence of Mg2+ or Mn2+ ions and EGTA (see "Materials and methods"). It is also reported that Ca2+ ions are negative regulators of alpha Lbeta 2-mediated adhesion to ICAM-1.50 We suggest that the adhesive interactions of ICAM-4 with beta 2 integrins are of lower avidity than those between ICAM-4 and alpha 4beta 1- or alpha V-family integrins described here and reflect the rather promiscuous nature of ICAM-4-ligand interactions. Clearly, further studies are needed to establish whether any of these interactions observed in vitro are physiologically significant.

Antibody inhibition studies suggested that the adhesion of nonhemopoietic cells is mediated by alpha V integrin(s) (probably alpha Vbeta 1 and alpha Vbeta 5), though complete inhibition of binding was not observed with any combination of inhibiting antibodies tested. A possible explanation for this observation is that the ICAM-4 binding site on alpha V integrins may be qualitatively different from that occupied by its other ligands, as suggested for alpha 4beta 1, above. It is also possible that ICAM-4 is bound by other alpha V integrins, alpha Vbeta 6 and alpha Vbeta 8, that might be expressed by these cell lines but may not be inhibited by these alpha V antibodies. We did not find alpha Vbeta 3-mediated adhesion of nonhemopoietic cells to ICAM-4. Adhesion to ICAM-4 of the alpha V-positive, hemopoietic cell line HEL (which expresses only alpha Vbeta 3, data not shown) was not blocked by inhibiting alpha V antibodies. These findings were not unexpected because the assays were performed in the presence of EGTA, which is reported to inhibit alpha Vbeta 3-mediated binding to CD31.21 Monkey and hamster cells also showed integrin-mediated adhesion to ICAM-4. CHO cells express alpha V integrins, and CHO transfectants expressing hamster alpha V/human beta 5 hybrid integrins are active in functional assays with human-derived ligands.51,52 It is therefore likely that adhesion of both COS-7 and CHO cells is also alpha V integrin-mediated. Indeed, our data are consistent with the hypothesis that ICAM-4 is a truly promiscuous alpha V integrin ligand and is bound by all alpha V-family integrins.

These results raise the possibility that interactions between ICAM-4 on erythroblasts and alpha V integrins on the central macrophage of erythroblastic island structures in bone marrow might also contribute to the integrity of the island structures. It is also possible that ICAM-4 has a wider role in erythrocyte recognition by alpha V integrin-expressing cells of the reticuloendothelial system and may thereby serve as an "erythrocyte addressin." In sickle cell disease, episodes of acute pain are linked to vascular occlusion caused by the abnormal adhesion of sickle red cells to vascular endothelial cells.1,2,53,54 There are some data suggesting that ICAM-4 expression is abnormally elevated on the erythrocytes of patients with sickle cell disease and that antibodies to ICAM-4 partially inhibit adhesion of sickle red blood cells to tumor necrosis factor-alpha -activated endothelial cells.49 These observations raise the possibility that ICAM-4/alpha V integrin interactions may contribute to the abnormal adhesion of sickle red cells to activated endothelium during sickle cell disease crisis.

Our results strongly suggest that ICAM-4 is a ligand for alpha 4beta 1 and alpha V integrins, although we cannot rule out the possibility of crosstalk between these integrins and other integrins or unidentified molecules not targeted by antibody inhibition studies and that these molecules, rather than alpha 4beta 1 or alpha V integrins, are ligands for ICAM-4. In hemopoietic cell lines, alpha 4beta 1 antibodies, an LDV peptide, or EDTA completely blocked adhesion, strongly suggesting that ICAM-4 was bound by alpha 4beta 1 and the absence of crosstalk. In nonhemopoietic cell lines, both the RGD peptide and EDTA completely blocked adhesion, but no combination of inhibiting antibodies completely blocked binding. In these cells it is possible that crosstalk between alpha V integrins and other molecules underlies this observation. In this context alpha Vbeta 3 is reported to regulate both alpha 4beta 1-mediated lymphocyte migration and alpha 5beta 1-mediated adhesion and endocytosis of phagocytic cells.55,56

ICAM-4 is clearly an unusual molecule because it can be a ligand for alpha 4beta 1, which has a preference for LDV-based sequences, and also for alpha V integrins that usually bind ligands containing the RGD sequence.24,41 The alpha V integrins generally bind extracellular matrix molecules, and alpha Vbeta 3 has the largest repertoire of ligands.24 alpha Vbeta 3 is the only alpha V integrin previously shown to have IgSF ligands and binds CD31 and L1.21,22 The integrin-binding site for L1 has been identified as an RGD sequence in domain 6,22 while that of CD31 has been shown to reside largely on domain 1.21 This domain has no RGD motif, suggesting that alpha Vbeta 3 can use other sequences.57 This is clearly also the case for the alpha V integrin-binding site of ICAM-4 which, like CD31, has no RGD sequences. Most integrin-binding sites on IgSF molecules contain an acidic residue, and they are commonly located on the N-terminal domain.21,25,58 Unlike other ICAMs, ICAM-4 domain 1 does not have the consensus alpha Lbeta 2-binding motif in the C strand. Unlike VCAM-1 and MAdCAM-1, ICAM-4 also lacks a consensus alpha 4beta 1-binding motif in the C-D loop of this domain. IgSF molecules are highly versatile and can use almost any surface for ligand recognition.25 It is therefore possible that integrin-binding motif(s) may be located in domain 2 of ICAM-4, where there are 7 acidic residues. With the exception of D173 the model shows that all of these residues are exposed at the surface and are potentially available for interaction. Further mutational analysis of domain 2 is clearly necessary to define the integrin-binding site of this novel ICAM.


    Acknowledgments

We thank Dr D. Simmons and Dr M. K. Robinson for helpful discussions, P. Martin for DNA sequence analysis, and Dr W. Mawby for peptide synthesis.


    Footnotes

Submitted October 16, 2000; accepted March 21, 2001.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Presented in part as abstracts at the 40th annual meeting of the American Society of Hematology, Miami, FL, December 1998 (Blood 1998;92:589a) and at the annual meeting of the British Blood Transfusion Society, Edinburgh, United Kingdom, September 1999 (Transfus Med 1999;9:[suppl 1]9).

Reprints: Frances A. Spring, Bristol Institute for Transfusion Sciences, Southmead Rd, Bristol, BS10 5ND, United Kingdom; e-mail: fran.spring{at}nbs.nhs.uk.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Hebbel RP, Mohandas N. Sickle cell adherence. In: Embury SH,Hebbel RP,Mohandas N,Steinberg MH, eds. Sickle Cell Disease: Basic Principles and Clinical Practice. New York, NY: Raven Press; 1994:217-230.

2. Embury SH, Hebbel RP, Steinberg MH, Mohandas N. Pathogenesis of vasoocclusion. In: Embury SH,Hebbel RP,Mohandas N,Steinberg MH, eds. Sickle Cell Disease: Basic Principles and Clinical Practice. New York, NY: Raven Press; 1994:311-326.

3. Baruch DI. Adhesive receptors on malaria-parasitized red cells. In: Tanner MJA,Anstee DJ, eds. Red Cell Membrane Disorders. London United Kingdom: Bailiere Tindall; 1999:747-761.

4. Hynes RO. Integrins: versatility, modulation and signalling in cell adhesion. Cell. 1992;69:11-25[CrossRef][Medline] [Order article via Infotrieve].

5. Anstee DJ, Mallinson G. The biochemistry of blood group antigens---some recent advances. Vox Sang. 1994;67(suppl 3):1-6.

6. Bailly P, Hermand P, Callebaut I, et al. The LW blood group glycoprotein is homologous to intercellular adhesion molecules. Proc Natl Acad Sci U S A. 1994;91:5306-5310[Abstract/Free Full Text].

7. Mallinson G. Characterisation of the erythrocyte membrane components which carry the antigens of the LW, Duffy and Cromer blood group systems [dissertation]. Bristol United Kingdom: University of the West of England; 1996.

8. Anstee DJ, Holmes CH, Judson PA, Tanner MJ. Use of monoclonal antibodies to determine the distribution of red cell surface proteins on human cells and tissues. In: Agre PC,Cartron J, eds. Protein Blood Group Antigens of the Human Red Cell: Structure, Function and Clinical Significance. Baltimore, MD: Johns Hopkins University Press; 1992:170-181.

9. Southcott MJG, Tanner MJA, Anstee DJ. The expression of human blood group antigens during erythropoiesis in a cell culture system. Blood. 1999;93:4425-4435[Abstract/Free Full Text].

10. Simmons DL. The role of ICAM expression in immunity and disease. Cancer Surv. 1995;24:141-155[Medline] [Order article via Infotrieve].

11. Bailly P, Tontti E, Hermand P, Cartron J-P, Gahmberg CG. The red cell LW blood group protein is an intercellular adhesion molecule which binds to CD11/CD18 leukocyte integrins. Eur J Immunol. 1995;25:3316-3320[Medline] [Order article via Infotrieve].

12. Mizuno T, Yoshihara Y, Inazawa J, Kagamiyama H, Mori K. cDNA cloning and chromosomal localization of the human telencephalin and its distinctive interaction with lymphocyte function-associated antigen-1. J Biol Chem. 1997;272:1156-1163[Abstract/Free Full Text].

13. Tian L, Yoshihara Y, Mizuno T, Mori K, Gahmberg CG. The neuronal glycoprotein telencephalin is a cellular ligand for the CD11a/CD18 leukocyte integrin. J Immunol. 1997;158:928-936[Abstract].

14. Van der Vieren M, Le Trong H, Wood CL, et al. A novel leukointegrin, alpha dbeta 2, binds preferentially to ICAM-3. Immunity. 1995;3:683-690[CrossRef][Medline] [Order article via Infotrieve].

15. Staunton DE, Dustin ML, Erickson HP, Springer TA. The arrangement of the immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhinovirus [published errata appear in Cell. 1990;61:1157 and Cell. 1991;66:following 1311]. Cell. 1990;61:243-254[CrossRef][Medline] [Order article via Infotrieve].

16. Casasnovas JM, Pieroni C, Springer TA. Lymphocyte function-associated antigen-1 binding residues in intercellular adhesion molecule-1 (ICAM-2) and the integrin binding surface in the ICAM family. Proc Natl Acad Sci U S A. 1999;96:3017-3022[Abstract/Free Full Text].

17. Sadhu C, Lipsky B, Erickson HP, et al. LFA-1 binding site in ICAM3 contains a conserved motif and non-contiguous amino acids. Cell Adhes Commun. 1994;2:429-440[Medline] [Order article via Infotrieve].

18. Holness CL, Bates PA, Little AJ, et al. Analysis of the binding site on intercellular adhesion molecule 3 for the leukocyte integrin lymphocyte function-associated antigen 1. J Biol Chem. 1995;270:877-884[Abstract/Free Full Text].

19. Clements JM, Newham P, Shepherd M, et al. Identification of a key integrin-binding sequence in VCAM-1 homologous to the LDV active site in fibronectin. J Cell Sci. 1994;107:2127-2135[Abstract].

20. Briskin MJ, Rott L, Butcher EC. Structural requirements for mucosal vascular addressin binding to its lymphocyte receptor alpha 4beta 7: common themes among integrin-Ig family interactions. J Immunol. 1996;156:719-726[Abstract].

21. Buckley CD, Doyonnas R, Newton JP, et al. Identification of alpha vbeta 3 as a heterotypic ligand for CD31/PECAM-1. J Cell Sci. 1996;109:437-445[Abstract].

22. Ebeling O, Duczmal A, Aigner S, et al. L1 adhesion molecule on human lymphocytes and monocytes: expression and involvement in binding to alpha vbeta 3 integrin. Eur J Immunol. 1996;26:2508-2516[Medline] [Order article via Infotrieve].

23. Viney JL, Jones S, Chiu HH, et al. Mucosal addressin cell adhesion molecule-1: a structural and functional analysis demarcates the integrin binding motif. J Immunol. 1996;157:2488-2497[Abstract].

24. Garratt AN, Humphries MJ. Recent insights into ligand binding, activation and signalling by integrin adhesion receptors. Acta Anat. 1995;154:34-45[Medline] [Order article via Infotrieve].

25. Wang J, Springer TA. Structural specializations of immunoglobulin superfamily members for adhesion to integrins and viruses. Immunol Rev. 1998;163:197-215[CrossRef][Medline] [Order article via Infotrieve].

26. Casasnovas JM, Springer TA, Liu J, Harrison SC, Wang J. Crystal structure of ICAM-2 reveals a distinctive integrin recognition surface. Nature. 1997;387:312-315[CrossRef][Medline] [Order article via Infotrieve].

27. Casasnovas JM, Stehle T, Liu J, Wang J, Springer TA. A dimeric crystal structure for the N-terminal two domains of intercellular adhesion molecule-1. Proc Natl Acad Sci U S A. 1998;95:4134-4139[Abstract/Free Full Text].

28. Bella J, Kolatkar PR, Marlor CW, Greve JM, Rossmann MG. The structure of the two amino-terminal domains of human ICAM-1 suggests how it functions as a rhinovirus receptor and as an LFA-1 integrin ligand. Proc Natl Acad Sci U S A. 1998;95:4140-4145[Abstract/Free Full Text].

29. Jones EY, Harlos K, Bottomley MJ, et al. Crystal structure of an integrin-binding fragment of vascular cell adhesion molecule-1 at 1.8 A resolution. Nature. 1995;373:539-544[CrossRef][Medline] [Order article via Infotrieve].

30. Tan K, Casasnovas JM, Liu J, Briskin MJ, Springer TA, Wang J. The structure of immunoglobulin superfamily domains 1 and 2 of MAdCAM-1 reveals novel features important for integrin recognition. Structure. 1998;6:793-801[Medline] [Order article via Infotrieve].

31. Vordermeier S, Singh S, Biggerstaff J, et al. Red blood cells from patients with sickle cell disease exhibit an increased adherence to cultured endothelium pretreated with tumour necrosis factor (TNF). Br J Haematol. 1992;81:591-597[Medline] [Order article via Infotrieve].

32. Ortlepp S, Stephens PE, Hogg N, Figdor CG, Robinson MK. Antibodies that activate beta 2 integrins can generate different ligand binding states. Eur J Immunol. 1995;25:637-643[Medline] [Order article via Infotrieve].

33. Robinson MK, Andrew D, Rosen H, et al. Antibody against the Leu-CAM beta -chain (CD18) promotes both LFA-1- and CR3-dependent adhesion events. J Immunol. 1992;148:1080-1085[Abstract].

34. Andrew D, Shock T, Ball E, Ortlepp S, Bell J, Robinson M. KIM185, a monoclonal antibody to CD18 which induces a change in the conformation of CD18 and promotes both LFA-1- and CR3-dependent adhesion. Eur J Immunol. 1993;23:2217-2222[Medline] [Order article via Infotrieve].

35. Simmons DL. Cloning cell surface molecules by transient expression in mammalian cells. In: Hartley DA, ed. Cellular Interactions in Development. New York, NY: IRL Press; 1993:93-127.

36. Clackson T, Gussow D, Jones PT. General applications of PCR to gene cloning and manipulation. In: McPherson MJ,Quirke P,Taylor GR, eds. PCR, A Practical Approach. New York, NY: IRL Press; 1991:187-214.

37. Stephens PE, Ortlepp S, Perkins VC, Robinson MK, Kirby H. Expression of a soluble functional form of the integrin alpha 4beta 1 in mammalian cells. Cell Adhes Commun. 2000;8:1-14.

38. Smythe JS, Avent ND, Judson PA, Parsons SF, Martin PG, Anstee DJ. Expression of RHD and RHCE gene products using retroviral transduction of K562 cells establishes the molecular basis of Rh blood group antigens. Blood. 1996;87:2968-2973[Abstract/Free Full Text].

39. Hermand P, Huet M, Callebaut I, et al. Binding sites of leukocyte beta 2 integrins (LFA-1, Mac-1) on the human ICAM4/LW blood group protein. J Biol Chem. 2000;275:26002-26010[Abstract/Free Full Text].

40. Newham P, Craig SE, Seddon GN, et al. Alpha4 integrin binding interfaces on VCAM-1 and MAdCAM-1: integrin binding footprints identify accessory binding sites that play a role in integrin specificity. J Biol Chem. 1997;272:19429-19440[Abstract/Free Full Text].

41. Ruoslahti E. RGD and other recognition sequences for integrins. Annu Rev Cell Dev Biol. 1996;12:697-715[CrossRef][Medline] [Order article via Infotrieve].

42. Landis RC, McDowall A, Holness CL, Littler AJ, Simmons DL, Hogg N. Involvement of the "I" domain of LFA-1 in selective binding to ligands ICAM-1 and ICAM-3. J Cell Biol. 1994;126:529-537[Abstract/Free Full Text].

43. Masumoto A, Hemler ME. Multiple activation states of VLA-4: mechanistic differences between adhesion to CS1/fibronectin and to vascular cell adhesion molecule-1. J Biol Chem. 1993;268:228-234[Abstract/Free Full Text].

44. Bony V, Gane P, Bailly P, Cartron J. Time-course expression of polypeptides carrying blood group antigens during human erythroid differentiation. Br J Haematol. 1999;107:263-274[CrossRef][Medline] [Order article via Infotrieve].

45. Undritz E. Die regionalen monocyten der blutkorperschnester. Folia Haematologica. 1950;70:32-42.

46. Bessis M. L'ilot erythroblastique, unite functionnelle de la moelle osseuse. Rev d'Hematologie. 1958;13:8-11.

47. Sadahira Y, Yoshino T, Monobe Y. Very late antigen 4-vascular cell adhesion molecule 1 interaction is involved in the formation of erythroblastic islands. J Exp Med. 1995;181:411-415[Abstract/Free Full Text].

48. Hamamura K, Matsuda H, Takeuchi Y, Habu S, Yagita H, Okumura K. A critical role of VLA-4 in erythropoiesis in vivo. Blood. 1996;87:2513-2517[Abstract/Free Full Text].

49. Parsons SF, Spring FA, Chasis JA, Anstee DJ. Erythroid cell adhesion molecules Lutheran and LW in health and disease. Baillieres Best Pract Res Clin Haematol. 1999;12:729-745[Medline] [Order article via Infotrieve].

50. Dransfield I, Cabanas C, Craig A, Hogg N. Divalent cation regulation of the function of the leukocyte integrin LFA-1. J Cell Biol. 1992;116:219-226[Abstract/Free Full Text].

51. Weinacker A, Chen A, Agrez M, et al. Role of the integrin alpha vbeta 6 in cell attachment to fibronectin. J Biol Chem. 1994;269:6940-6948[Abstract/Free Full Text].

52. Pasqualini R, Bodorova J, Ye S, Hemler ME. A study of the structure, function and distribution of beta 5 integrins using novel anti-beta 5 monoclonal antibodies. J Cell Sci. 1993;105:101-111[Abstract].

53. Hoover R, Rubin R, Wise G, Warren R. Adhesion of normal and sickle erythrocytes to endothelial monolayer cultures. Blood. 1979;54:872-876[Abstract/Free Full Text].

54. Hebbel RP, Yamada O, Modow CF, Jacob HS, White JG, Eaton JW. Abnormal adherence of sickle erythrocytes to cultured vascular endothelium. J Clin Invest. 1980;65:154-163.

55. Imhof BA, Weerasinghe D, Brown EJ, et al. Cross talk between alpha Vbeta 3 and alpha 4beta 1 integrins regulates lymphocyte migration on vascular cell adhesion molecule 1. Eur J Immunol. 1997;27:3242-3252[Medline] [Order article via Infotrieve].

56. Blystone SD, Graham IL, Lindberg FP, Brown EJ. Integrin alpha vbeta 3 differentially regulates adhesive and phagocytic functions of the fibronectin receptor alpha 5beta 1. J Cell Biol. 1994;127:1129-1137[Abstract/Free Full Text].

57. Watt SM, Gschmeissner SE, Bates PA. PECAM-1: its expression and function as a cell adhesion molecule on hemopoietic and endothelial cells. Leuk Lymphoma. 1995;17:229-244[Medline] [Order article via Infotrieve].

58. Holness CL, Simmons DL. Structural motifs for recognition and adhesion in members of the immunoglobulin superfamily. J Cell Sci. 1994;107:2065-2070[Medline] [Order article via Infotrieve].

59. Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. J App Cryst. 1993;26:283-291[CrossRef].

© 2001 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
R. Zennadi, A. Chien, K. Xu, M. Batchvarova, and M. J. Telen
Sickle red cells induce adhesion of lymphocytes and monocytes to endothelium
Blood, October 15, 2008; 112(8): 3474 - 3483.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-P. Wautier, W. El Nemer, P. Gane, J.-D. Rain, J.-P. Cartron, Y. Colin, C. Le Van Kim, and J.-L. Wautier
Increased adhesion to endothelial cells of erythrocytes from patients with polycythemia vera is mediated by laminin {alpha}5 chain and Lu/BCAM
Blood, August 1, 2007; 110(3): 894 - 901.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Ihanus, L. M. Uotila, A. Toivanen, M. Varis, and C. G. Gahmberg
Red-cell ICAM-4 is a ligand for the monocyte/macrophage integrin CD11c/CD18: characterization of the binding sites on ICAM-4
Blood, January 15, 2007; 109(2): 802 - 810.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. K. Kaul, X.-d. Liu, X. Zhang, T. Mankelow, S. Parsons, F. Spring, X. An, N. Mohandas, D. Anstee, and J. A. Chasis
Peptides based on {alpha}V-binding domains of erythrocyte ICAM-4 inhibit sickle red cell-endothelial interactions and vaso-occlusion in the microcirculation
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C922 - C930.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Lee, A. Lo, S. A. Short, T. J. Mankelow, F. Spring, S. F. Parsons, K. Yazdanbakhsh, N. Mohandas, D. J. Anstee, and J. A. Chasis
Targeted gene deletion demonstrates that the cell adhesion molecule ICAM-4 is critical for erythroblastic island formation
Blood, September 15, 2006; 108(6): 2064 - 2071.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. S. Bennett
Vasoocclusion in sickle cell anemia: are platelets really involved?
Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1415 - 1416.
[Full Text] [PDF]


Home page
J. Immunol.Home page
J. Glasner, H. Blum, V. Wehner, H. U. Stilz, J. D. Humphries, G. P. Curley, A. P. Mould, M. J. Humphries, R. Hallmann, M. Rollinghoff, et al.
A Small Molecule {alpha}4{beta}1 Antagonist Prevents Development of Murine Lyme Arthritis without Affecting Protective Immunity
J. Immunol., October 1, 2005; 175(7): 4724 - 4734.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Zennadi, P. C. Hines, L. M. De Castro, J.-P. Cartron, L. V. Parise, and M. J. Telen
Epinephrine acts through erythroid signaling pathways to activate sickle cell adhesion to endothelium via LW-{alpha}v{beta}3 interactions
Blood, December 1, 2004; 104(12): 3774 - 3781.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. G. Gahmberg
Cell adhesion: a partner for many
Blood, February 15, 2004; 103(4): 1183 - 1183.
[Full Text] [PDF]


Home page
BloodHome page
T. J. Mankelow, F. A. Spring, S. F. Parsons, R. L. Brady, N. Mohandas, J. A. Chasis, and D. J. Anstee
Identification of critical amino-acid residues on the erythroid intercellular adhesion molecule-4 (ICAM-4) mediating adhesion to {alpha}V integrins
Blood, February 15, 2004; 103(4): 1503 - 1508.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. J. Bruce, R. Beckmann, M. L. Ribeiro, L. L. Peters, J. A. Chasis, J. Delaunay, N. Mohandas, D. J. Anstee, and M. J.A. Tanner
A band 3-based macrocomplex of integral and peripheral proteins in the RBC membrane
Blood, May 15, 2003; 101(10): 4180 - 4188.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Lee, F. A. Spring, S. F. Parsons, T. J. Mankelow, L. L. Peters, M. J. Koury, N. Mohandas, D. J. Anstee, and J. A. Chasis
Novel secreted isoform of adhesion molecule ICAM-4: potential regulator of membrane-associated ICAM-4 interactions
Blood, March 1, 2003; 101(5): 1790 - 1797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Spessotto, M. Cervi, M. T. Mucignat, G. Mungiguerra, I. Sartoretto, R. Doliana, and A. Colombatti
beta 1 Integrin-dependent Cell Adhesion to EMILIN-1 Is Mediated by the gC1q Domain
J. Biol. Chem., February 14, 2003; 278(8): 6160 - 6167.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Hermand, P. Gane, M. Huet, V. Jallu, C. Kaplan, H. H. Sonneborn, J.-P. Cartron, and P. Bailly
Red Cell ICAM-4 Is a Novel Ligand for Platelet-activated alpha IIbbeta 3 Integrin
J. Biol. Chem., February 7, 2003; 278(7): 4892 - 4898.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Blaber, E. Stylianou, A. Clayton, and R. Steadman
Selective Regulation of ICAM-1 and RANTES Gene Expression after ICAM-1 Ligation on Human Renal Fibroblasts
J. Am. Soc. Nephrol., January 1, 2003; 14(1): 116 - 127.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. L. Wingerd, N. L. Goodman, J. W. Tresser, M. M. Smail, S. T. Leu, S. J. Rohan, J. L. Pring, D. Y. Jackson, and D. O. Clegg
alpha 4 Integrins and Vascular Cell Adhesion Molecule-1 Play a Role in Sympathetic Innervation of the Heart
J. Neurosci., December 15, 2002; 22(24): 10772 - 10780.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. M. Matsui, A. Varki, and S. H. Embury
Heparin inhibits the flow adhesion of sickle red blood cells to P-selectin
Blood, November 15, 2002; 100(10): 3790 - 3796.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. S. Goel and S. L. Diamond
Adhesion of normal erythrocytes at depressed venous shear rates to activated neutrophils, activated platelets, and fibrin polymerized from plasma
Blood, November 15, 2002; 100(10): 3797 - 3803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. C. Bridges, P. H. Tani, K. R. Hanson, C. M. Roberts, M. B. Judkins, and R. D. Bowditch
The Lymphocyte Metalloprotease MDC-L (ADAM 28) Is a Ligand for the Integrin alpha 4beta 1
J. Biol. Chem., January 25, 2002; 277(5): 3784 - 3792.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spring, F. A.
Right arrow Articles by Anstee, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spring, F. A.
Right arrow Articles by Anstee, D. J.
Related Collections
Right arrow Red Cells
Right arrow Cell Adhesion and Motility
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020