Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vassilopoulos, G.
Right arrow Articles by Russell, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vassilopoulos, G.
Right arrow Articles by Russell, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 August 2001, Vol. 98, No. 3, pp. 604-609

GENE THERAPY

Gene transfer into murine hematopoietic stem cells with helper-free foamy virus vectors

George Vassilopoulos, Grant Trobridge, Neil C. Josephson, and David W. Russell

From the Division of Hematology, University of Washington, Seattle, WA.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Gene transfer into hematopoietic stem cells (HSCs) is an ideal treatment strategy for many genetic and hematologic diseases. However, progress has been limited by the low HSC transduction rates obtained with retroviral vectors based on murine leukemia viruses. This study examined the potential of vectors derived from the nonpathogenic human foamy virus (HFV) to transduce human CD34+ cells and murine HSCs. More than 80% of human hematopoietic progenitors present in CD34+ cell preparations derived from cord blood were transduced by a single overnight exposure to HFV vector stocks. Mice that received transduced bone marrow cells expressed the vector-encoded transgene long term in all major hematopoietic cell lineages and in over 50% of cells in some animals. Secondary bone marrow transplants and integration site analysis confirmed that gene transfer occurred at the stem cell level. Transgene silencing was not observed. Thus vectors based on foamy viruses represent a promising approach for HSC gene therapy. (Blood. 2001;98:604-609)

© 2001 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Although vectors based on oncoviruses such as murine leukemia viruses (MLVs) can transduce murine hematopoietic stem cells (HSCs) efficiently when packaged with the ecotropic envelope protein,1-3 this pseudotype only infects rodent cells. In primate experiments, the poor performance of MLV vectors is thought to be due to low cellular receptor levels for the nonecotropic pseudotypes used4 or the quiescent state of HSCs, because mitosis is required for nuclear entry of MLV genomes.5 Several alternative retroviral vector systems are being evaluated in hematopoietic cells, including vectors pseudotyped with different envelope proteins or based on lentiviruses.6-8 Issues of receptor expression levels, cell cycle requirements, and possible safety risks still need to be resolved before these vectors are successfully used for HSC gene therapy. In an attempt to overcome the limitations of existing vector systems, we and others have developed vectors based on the spumavirus family of retroviruses (foamy viruses).9-12

Foamy viruses are nonpathogenic retroviruses with a wide tissue tropism that are commonly found in mammalian species.13,14 Serologic and polymerase chain reaction (PCR)-based surveys have failed to identify naturally occurring foamy virus infections in human populations, and the original "human" foamy virus (HFV) isolate is now thought to be a chimpanzee virus variant.15-17 The genomic organization of HFV is more complex than that of oncoviruses; in addition to gag, pol, and env genes, 3 open reading frames are located between env and the 3'LTR (bel 1-3) that are expressed from an internal viral promoter (Figure 1). The Bel-1 gene product (also known as Tas) is a transcriptional transactivator of the HFV LTR required for completion of the viral life cycle.18-20 The functions of the bel-2 and bel-3 encoded factors are unknown and dispensable for virus production in vitro.21,22 Among retroviruses, a unique property of foamy viruses is that reverse transcription occurs during virion formation rather than after cellular entry, so infectious particles contain DNA genomes.23,24 We recently developed an HFV vector production system that is independent of the Bel-1 transactivator and generates high titer stocks free of replication-competent HFV25 (Figure 1). Here we show that these improved HFV vector stocks efficiently transduce human CD34+ hematopoietic cells and murine HSCs.


View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Bel-independent HFV vector system. The structure of the wild-type (wt) HFV genome and relevant portions of packaging plasmid pCGPES and vector plasmids pCGPMAPDelta Bel and pCGPMscvF are shown. Arrows below each map represent transcription start sites. The bel1 gene in wt HFV is transcribed initially from the internal promoter, after which the Bel1 protein transactivates both the wt HFV LTR and internal promoters.18-20 In the Bel-independent plasmid constructs, cytomegalovirus (CMV) promoter sequences replace the 5' HFV LTR U3 region, to generate a constitutive CMV/HFV fusion promoter.25 The packaging plasmid pCPGES expresses gag, pol, and env followed by an SV40 polyadenylation site (SV pA). The vector plasmids express AP or GFP reporter genes from internal MLV LTR or murine stem cell virus (MSCV) promoters, respectively. After reverse transcription, both LTRs in the vector provirus are derived from Bel-1-dependent HFV sequences so the gag and pol genes contained in vector genomes are not expressed in transduced cells. Recent studies show that only the most 5' portion of gag and 3' portion of pol are required in cis for vector production42,43 (our unpublished results, July 1998), so future vectors may contain significantly fewer viral sequences. The locations of relevant restriction sites, PCR primers, and the probe fragment used for Southern blot analysis are shown above the pCGPMAPDelta Bel map.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cell culture

BHK-2126 and 293T27 cells were grown in Dulbecco modified Eagle medium (DMEM; Gibco BRL, Bethesda, MD) supplemented with 10% fetal calf serum (FCS; Hyclone, Logan, UT) and antibiotics (penicillin and streptomycin). Human CD34+ cells were isolated from umbilical cord blood by using a CD34+ cell isolation kit as per the manufacturer's instructions (Miltenyi Biotec, Auburn, CA). Transduction was by a single 10-hour exposure to HFV vector stocks in CH296-coated dishes (5 µg/cm2; Takara Biomedicals, Otsu, Japan) in DMEM supplemented with 20% FCS, 100 ng/mL Flt-3 ligand, and 100 ng/mL stem cell factor (SCF), after which the cells were either plated in soft agar colony assays for alkaline phosphate (AP) expression as described,12 plated in methylcellulose colony assays (Methocult H 4230; Stem Cell Technologies, Vancouver, BC, Canada) for expression of green fluorescent protein (GFP), or maintained in liquid culture (DMEM with 20% FCS, 100 ng/mL Flt-3 ligand, 100 ng/mL SCF, 20 ng/mL interleukin [IL]-3, and 20 ng/mL IL-6) for flow cytometry analysis. Colonies were cultured in DMEM with 20% FCS, 50 ng/mL SCF, 10 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF), 10 ng/mL IL-3, and 2 U/mL erythropoietin. All cytokines were human.

Murine bone marrow (BM) cells were isolated by flushing femurs with Hanks balanced salt solution and lysis of red blood cells (RBCs) by a 5-minute exposure to a hypotonic solution (155 mM NH4Cl, 7.3 mM NaHCO3, 126 µM EDTA). The remaining nucleated cells were then cultured in DMEM supplemented with 20% FCS, 20 ng/mL human IL-6, 50 ng/mL murine IL-3, and 50 ng/mL murine SCF for 48 hours before and after a single exposure to HFV vector stocks in CH296-coated dishes. Following transduction, the cells were harvested with a rubber policeman and washed with phosphate-buffered saline (PBS) before injection into irradiated recipients and plating in AP or GFP colony assays. Pretransplant colony-forming unit (CFU) transduction rates ranged from 20% to more than 90%. BM cells isolated from transplanted animals were plated directly in colony assays after lysis of RBCs. Colonies were cultured in the same medium as used during transduction.

Vector production

Plasmids pCGPES and pCGPMAPDelta Bel have been described.25 pCGPMscvF contains a murine stem cell virus (MSCV) promoter (SfcI-SmaI fragment of pMSCVneo28 and enhanced GFP gene from pEGFP (Clontech, Palo Alto, CA) in place of the MLV LTR and AP gene in pCGPMAPDelta Bel. CGPMAPDelta Bel and CGPMscvF HFV vector stocks were produced by calcium phosphate cotransfection of 293T cells with packaging plasmid pCGPES and vector plasmid pCGPMAPDelta Bel or pCGPMscvF, respectively, followed by collection of vector-containing media 72 hours later as described.25 The stocks were filtered through a 0.45-µm Durapore filter (Millipore, Bedford, MA), concentrated by centrifugation at 50 000g for 2 hours, resuspended in culture medium and used fresh for transduction. Stock titers (transducing units/mL) used for multiplicity of infection (MOI) calculations were determined on BHK-21 (CGPMAPDelta Bel vector) or 293T cells (CGPMscvF vector).

Mice

All transplants were performed with congenic mouse strains C57BL/6 (expressing the Ly5.2 antigen) and B6Ly5.2 (expressing the Ly5.1 antigen) purchased from the National Cancer Institute (Bethesda, MD). Twelve- to 16-week-old donor mice were treated with 120 mg/kg 5-fluorouracil (5-FU) by intraperitoneal injection 2 days before BM mononuclear cells were harvested. Eight- to 12-week-old recipient mice received 1100 rads from a dual cesium 137 gamma source (GammaCell 40, AEC, Kanata, ON, Canada) before infusion of 1 to 2 × 106 transduced BM cells by tail vein injection. Mice received acidified water with antibiotics (Baytril and amoxicillin) for 2 weeks after transplantation. Several mice receiving transplants had to be killed because of pathogen contamination in the animal care facility.

Peripheral blood analysis

Alkaline phosphate staining of peripheral blood smears obtained by retro-orbital puncture was performed by air-drying overnight, fixing with 0.5% gluteraldehyde in PBS for 10 minutes, washing 3 times for 10 minutes in PBS, heat inactivating for 1 hour at 68°C, and staining in X-Phos solution (100 µg/mL 5-bromo-4-chloro-3-indolyl phosphate, 1 mg/mL nitro blue tetrazolium) or Vector Red AP Substrate (Vector Laboratories, Burlingame, CA). Some smears were counterstained with Harris hematoxylin (Sigma Chemical, St Louis, MO) for 1 minute to highlight nuclear morphology. The percentage of AP+ white blood cells (WBCs) and RBCs was determined by Nomarski microscopy. Flow cytometric analysis of peripheral blood cells was performed on a FACScan (Becton Dickinson, San Jose, CA) set to identify platelets, WBCs, and RBCs according to their forward (FSC) and side scatter (SSC) characteristics as per the manufacturer's instructions, and either GFP fluorescence or AP expression with antiplacental AP antibody 8B6 from DAKO (Carpinteria, CA) conjugated with fluorescein isothiocyanate (FITC) by using the Fluoroscein-EX Protein Labeling Kit (Molecular Probes, Eugene, OR). For dual-label flow cytometry the following phycoerythrin (PE)-conjugated antibodies were used: B220 for B cells, anti-CD3 for T cells, Gr-1 for neutrophils, and Ter119 for RBCs (Pharmingen, San Diego, CA). Engraftment was monitored by flow cytometry for Ly5.1 and Ly5.2 antigens.

DNA studies

High molecular weight DNA was isolated from spleen and BM specimens with the DNA isolation kit D-5000 (Gentra, Minneapolis, MN), and analyzed by Southern blots.29 Locations of the probe fragment, relevant restriction enzyme sites, and PCR primers are shown in Figure 1. Vector copy numbers were quantitated by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) after correction for sample loading by reprobing the same blot with a mouse genomic beta -glucuronidase probe (from Mark Sands, Washington University, St Louis, MO). For PCR analysis, hematopoietic colonies were picked from soft agar cultures, immersed in 100 µL of a 50 µg/mL solution of proteinase K, incubated for 2 hours at 56°C, then for 30 minutes at 94°C. Twenty microliters of the sample was used for PCR analysis with forward primer AATGCTGGCATGGGAATAGT and reverse primer TAACTTCCTTGGGTGGCAAG. PCR conditions were: initial denaturation at 94°C for 3 minutes, followed by 35 cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute. The samples were run in a 2% agarose gel and visualized after ethidium bromide staining under UV light. DNA integrity in each sample was confirmed by amplifying murine beta -actin sequences30 under the same PCR conditions.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Transduction of hematopoietic progenitor cells by HFV vectors

Helper-free HFV vectors expressing human placental AP or GFP were made by cotransfection of 293T cells with packaging and vector plasmids driven by a cytomegalovirus (CMV)-HFV fusion promoter (Figure 1). Using this vector system we produced viral stocks with titers ranging from 0.3 to 1.0 × 106 transducing units/mL that were further concentrated to approximately 107/mL by ultracentrifugation.

In prior experiments, transduction of primary hematopoietic cells by HFV vectors required cocultivation with vector-producing cells,12 so we first tested if different adhesion molecules would enable transduction with cell-free vector preparations. Poly-L-lysine, human fibronectin, and the recombinant fibronectin fragment CH296 were tested, but only fragment CH296 supported the transduction of murine hematopoietic progenitors (data not shown), as was previously observed with MLV vectors.31,32 To test if primitive human hematopoietic cells could be transduced, CD34+ cord blood cells were exposed for 10 hours to a single dose of cell-free HFV vector stocks on CH296-coated plates, then plated for progenitor colony assays or maintained for 5 days in liquid culture. As shown in Figure 2, human CD34+ cells were efficiently transduced by both AP and GFP HFV vectors under these conditions, and transduction rates of over 80% were routinely obtained in colony assays.


View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Transduction of human CD34+ cells. Examples of hematopoietic colonies derived from CD34+ progenitors transduced by CGPMAPDelta Bel and stained with X-Phos to produce dark-colored AP+ cells (A) as compared to untransduced controls (B), or transduced by CGPMscvF and examined by fluorescence microscopy for GFP expression (C-D). Original magnification 25 × in panels A-D. (E) Transduction rates of CD34+ cells by GFP vector CGPMscvF as measured by flow cytometry of liquid cultures 5 days after infection, or by progenitor colony assays. The average results of 4 experiments at MOIs ranging from 5 to 23 are shown (with SDs). Total as well as burst-forming units-erythrocytes (BFU-E), colony-forming units-granulocyte/macrophage (CFU-GM), and colony-forming units-granulocyte, erythrocyte, macrophage, megakaryocyte (CFU-GEMM) colonies were enumerated.

Transgene expression in the peripheral blood cells of transplanted animals

Murine BM transplantation assays were performed to determine if circulating peripheral blood cells would express vector-encoded transgenes and to document transduction at the HSC level. In these experiments, we used conditions originally established for MLV-based vectors,2,33 including pretreatment of BM donors with 5-FU, 2 days of ex vivo culture both before and after exposure to a single dose of HFV vector, followed by transplantation into lethally irradiated congenic recipients expressing distinct CD45 alleles. AP expression from vector CGPMAPDelta Bel was monitored in the peripheral blood of transplanted animals by histochemical staining of blood smears, which allowed us to identify AP+ neutrophils, lymphocytes, RBCs, and platelets (Figure 3A-D). GFP expression from vector CGPMscvF was analyzed in WBCs, RBCs, and platelets by flow cytometry (Figure 3E). Transgene-expressing cells were observed in all blood cell lineages at 4 to 7 weeks after transplantation (Table 1) and the combined mean transduction rates (± SD) from these experiments were 36% ± 22% for RBCs, 24% ± 17% for WBCs, and 26% ± 11% for platelets.


View larger version (77K):
[in this window]
[in a new window]
 
Figure 3. Analysis of transgene expression in peripheral blood cells. (A-D) Photomicrographs of circulating peripheral blood cells from transplant recipients expressing CGPMAPDelta Bel-encoded AP. Staining with Vector Red and hematoxylin shows an AP+ neutrophil (A) and an AP+ lymphocyte (B) with pink-stained cytoplasm. Staining with X-Phos shows darkly stained AP+ RBCs (C) and an AP+ WBC (large arrow) and AP+ platelet (small arrow) present in a smear examined by Nomarski microscopy (D). Original magnification 400 × in panels A-D. (E) Examples of flow cytometry data from the peripheral blood of a transplant recipient expressing CGPMscvF-encoded GFP (green lines) and an untransduced control animal (black lines), with the percentage of GFP+ cells indicated.


                              
View this table:
[in this window]
[in a new window]
 
Table 1. Transduced peripheral blood cells 4 to 7 weeks after transplantation

Transduction of long-term repopulating cells

Transplant recipients were followed for up to 6 months to monitor transduction of long-term repopulating cells. Mice transplanted with CGPMAPDelta Bel-transduced BM cells that survived and maintained a minimum of 50% donor cell engraftment levels were analyzed. As shown in Table 2, 4 of 7 of these animals had a significant number of AP+ peripheral blood RBCs and WBCs; the mean transduction rates were 24% for RBCs and 25% for WBCs. Similar AP expression levels were observed in myeloid colonies grown from BM progenitor cells harvested at this time and cultured in soft agar (mean 32%). We also tested colonies for the presence of the vector provirus by using PCR (Figure 4A). The percentages of PCR+ and AP+ colonies were similar in each animal, indicating that the lack of significant long-term expression in 3 of 7 animals was due to reconstitution from nontransduced HSCs as opposed to transgene silencing.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Long-term analysis of transplanted mice



View larger version (76K):
[in this window]
[in a new window]
 
Figure 4. DNA analysis of vector proviruses. (A) BM colonies grown in soft agar were individually picked and subjected to PCR with primers that amplify a 403-bp fragment of foamy virus vector DNA. Representative results from 27 colonies obtained at 6 months after transplantation are shown, 22 of which contained the vector genome. Negative controls included water and DNA from an untransduced BM colony. (B) Genomic DNA samples from BM and spleen (SP) of long-term and secondary transplant recipients (indicated by number) were digested with EcoN I and probed for vector sequences (Figure 1 has locations). Standards were untransduced mouse spleen DNA mixed with DNA from diploid fibroblasts containing a single integrated HFV vector provirus (9.8-kb EcoN I fragment) to generate the indicated copy numbers. The upper blot was probed with HFV sequences. To correct for sample loading, the same blot was reprobed with mouse genomic beta -glucuronidase sequences to detect a 3.8-kb fragment (GUS probe). The calculated copy numbers based on this PhosphorImager analysis are shown below each lane (provirus copies per diploid genome). (C) Integration site analysis using Nsi I to assay for unique-sized junction fragments. Positive and negative control samples were 100% and 0% standards of panel B, respectively. The positions of size standards are indicated in each panel.

We performed secondary transplants with BM cells harvested from long-term primary recipients no. 915 and no. 682, both of which expressed AP. Although the reconstituting potential of the BM grafts was reduced following serial transplantation, AP+ peripheral blood cells were detected in all 3 secondary recipients by histochemical staining at 4 weeks after transplantation (Table 3). In addition, flow cytometry with anti-AP and lineage-specific antibodies demonstrated AP+ neutrophils, lymphocytes, RBCs, and platelets in the peripheral blood cells of secondary transplant recipients from donor no. 682 at 8 weeks after transplantation (Figure 5). BM progenitors harvested from secondary recipient no. 23 at 8 weeks after transplantation were plated in colony assays and shown to express AP (20 of 50 colonies) and contain the vector genome as determined by PCR (5 of 18 colonies). The long-term transgene expression observed in primary transplant recipients, combined with the marking data from multiple cell types in secondary recipients, demonstrates that transduced HSCs persisted for several months in primary recipients and maintained their ability to reconstitute hematopoiesis in secondary recipients.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Analysis of secondary transplants at 4 weeks after bone marrow transplantation



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. AP expression in peripheral blood cells of recipients of secondary transplants. Eight weeks after transplantation of BM cells from primary recipient no. 682, peripheral blood cells from secondary recipients were stained with an FITC-conjugated anti-AP antibody and the indicated PE-conjugated lineage-specific antibodies. Examples of flow cytometry data are shown for different lineages, with the percentage of each cell type that expressed vector-encoded AP indicated. Platelets were identified according to their FSC and SSC characteristics instead of by using a specific antibody. Controls were blood samples from untransplanted mice.

DNA analysis of transplant recipients

Southern blots were used to determine the copy number of vector proviruses in genomic DNA samples from long-term and secondary transplant recipients. BM and spleen DNA samples were digested with EcoNI, which cuts CGPMAPDelta Bel provirus genomes twice to generate an 8.2-kb restriction fragment (Figure 1) that was detected in each mouse found to express AP by histochemical analysis, including all 3 recipients of secondary transplants (Figure 4B). Except for one sample, the vector fragment was the predicted size of an intact provirus. The BM of mouse no. 523 had 2 provirus fragments, one of which was larger than expected, possibly due to transfer of an abnormal vector genome or a recombination event after transduction. Vector copy numbers ranged from 0.08 to 2.01 proviruses per diploid genome in transgene-expressing mice. In 2 of 3 mice with low AP expression levels (no. 524 and no. 209) no vector genomes could be detected in BM DNA samples (Table 2). Mouse no. 526 expressed AP at low levels despite a BM copy number of 0.92. In this mouse, it is not clear which BM cells contained vector proviruses and whether they expressed AP, because less than 10% of the myeloid progenitors that grew in BM colony assays contained vector sequences based on PCR (Table 2).

Vector integration sites were analyzed by digestion of DNA samples from long-term and secondary transplant recipients with NsiI, (Figure 4C), which cuts once in the vector genome and once in flanking chromosomal DNA to produce a distinct fragment for each provirus integration site (Figure 1). One to 5 vector-hybridizing bands were seen in the samples from AP-expressing mice, consistent with monoclonal or oligoclonal hematopoietic reconstitution by transduced cells. In most cases, common junction fragments were present in the spleen and BM samples from the same mouse suggesting that a common transduced precursor repopulated both organs (mice no. 526, no. 682, and no. 915). In the secondary transplant experiments, a single junction fragment present in the primary recipient's BM (mice no. 682 and no. 915) was the only fragment detected in secondary recipients (mice no. 23, no. 24, and no. 37, respectively). Thus a single transduced cell reconstituted hematopoiesis in both primary and secondary recipients, consistent with transduction of pluripotent HSCs.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In summary, we have shown that vectors developed from human foamy virus can efficiently transduce human CD34+ hematopoietic progenitors and murine HSCs, and that recipients of transduced BM cells express the vector-encoded transgene in all hematopoietic cell lineages analyzed. Transduction at the HSC level was demonstrated by long-term transgene expression in transplant recipients, secondary transplantation experiments, and integration site analysis. Except for one cell clone with an aberrant provirus, all transduced cells contained an intact, integrated, foamy virus vector genome that appeared to be transcriptionally active.

Our results suggest that HSCs may also be susceptible to infection with wild-type foamy viruses. Although foamy viruses have been isolated from blood cells,34-36 it is not clear what role the hematopoietic system plays in natural infections. Infected HSCs could act as a reservoir of provirus-containing cells capable of massive expansion during the production of mature blood cells.

Murine BM transplantation has served as an important animal model for HSC transduction experiments. The results obtained with HFV vectors are comparable to the best results from prior studies with ecotropic MLV vectors, where over 50% of hematopoietic cells were transduced in some transplant recipients.1-3 Possible explanations for the high transduction rates we observed include improved transduction of nondividing cells or expression of cellular HFV receptor molecules on HSCs. HFV vectors may have transduced quiescent HSCs, because they transduce stationary phase cell cultures more efficiently than MLV vectors,10 HFV genomes enter the nuclei of G1/S phase-arrested cells,37 and transduction by cDNA-containing HFV particles is not dependent on adequate nucleotide pools.23,24 Future studies on whether pretreatment of BM donors with 5-FU and ex vivo cytokine stimulation are required may help resolve these issues. Although the cellular receptor(s) for HFV is not known, it must be ubiquitously expressed because HFV vectors can transduce cells from all vertebrate species tested.10,38

A common problem associated with MLV vectors has been the silencing of transgene expression over time.39,40 We did not observe significant silencing in our experiments, based on a comparison of vector marking and transgene expression levels in the hematopoietic progenitors of long-term and secondary transplant recipients, despite our use of an internal MLV LTR promoter previously found to silence in hematopoietic cells.3,40,41 Persistent expression of HFV vectors could be due to unidentified cis-acting functions present in the vector backbone that prevent silencing, or specific attributes of the MLV LTR promoter we used, such as the presence of a single internal copy, or the removal of the transfer RNA primer binding site. Further studies will be required to determine if specific attributes of the HFV vectors used can prevent transgene silencing.

High HSC transduction rates have not been achieved in primate transplantation studies with nonecotropic MLV pseudotypes, so it is not clear how well murine experiments with HFV vectors will predict results in humans. However, the amphotropic MLV vectors commonly used in primates transduce murine HSCs at significantly lower rates than their ecotropic counterparts,4 suggesting that the mouse model may be valid when the same vector system is used. Because HFV vectors transduce murine and human hematopoietic progenitors at similar rates, they may also transduce primate HSCs efficiently. Thus, vectors based on the nonpathogenic foamy viruses may be a safe and effective alternative to MLV or lentivirus vectors for use in human gene therapy.


    Acknowledgments

We thank Roli Hirata for expert technical assistance.


    Footnotes

Submitted January 23, 2001; accepted March 26, 2001.

Supported by U.S. National Institutes of Health grants (to D.W.R., G.V., and N.J.) and the Medical Research Council of Canada (to G.T.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: David W. Russell, Division of Hematology, University of Washington, Box 357720, Seattle, WA 98195; e-mail: drussell{at}u.washington.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Riviere I, Brose K, Mulligan RC. Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells. Proc Natl Acad Sci U S A. 1995;92:6733-6737[Abstract/Free Full Text].

2. Persons DA, Allay JA, Allay ER, et al. Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo. Blood. 1997;90:1777-1786[Abstract/Free Full Text].

3. Halene S, Wang L, Cooper RM, Bockstoce DC, Robbins PB, Kohn DB. Improved expression in hematopoietic and lymphoid cells in mice after transplantation of bone marrow transduced with a modified retroviral vector. Blood. 1999;94:3349-3357[Abstract/Free Full Text].

4. Orlic D, Girard LJ, Jordan CT, Anderson SM, Cline AP, Bodine DM. The level of mRNA encoding the amphotropic retrovirus receptor in mouse and human hematopoietic stem cells is low and correlates with the efficiency of retrovirus transduction. Proc Natl Acad Sci U S A. 1996;93:11097-11102[Abstract/Free Full Text].

5. Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993;12:2099-2108[Medline] [Order article via Infotrieve].

6. Miyoshi H, Smith KA, Mosier DE, Verma IM, Torbett BE. Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors. Science. 1999;283:682-686[Abstract/Free Full Text].

7. May C, Rivella S, Callegari J, et al. Therapeutic haemoglobin synthesis in beta -thalassaemic mice expressing lentivirus-encoded human beta -globin. Nature. 2000;406:82-86[CrossRef][Medline] [Order article via Infotrieve].

8. Kiem HP, Heyward S, Winkler A, et al. Gene transfer into marrow repopulating cells: comparison between amphotropic and gibbon ape leukemia virus pseudotyped retroviral vectors in a competitive repopulation assay in baboons. Blood. 1997;90:4638-4645[Abstract/Free Full Text].

9. Bieniasz PD, Erlwein O, Aguzzi A, Rethwilm A, McClure MO. Gene transfer using replication-defective human foamy virus vectors. Virology. 1997;235:65-72[CrossRef][Medline] [Order article via Infotrieve].

10. Russell DW, Miller AD. Foamy virus vectors. J Virol. 1996;70:217-222[Abstract].

11. Schmidt M, Rethwilm A. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology. 1995;210:167-178[CrossRef][Medline] [Order article via Infotrieve].

12. Hirata RK, Miller AD, Andrews RG, Russell DW. Transduction of hematopoietic cells by foamy virus vectors. Blood. 1996;88:3654-3661[Abstract/Free Full Text].

13. Flugel RM. Spumaviruses: a group of complex retroviruses. J Acquir Immune Defic Syndr. 1991;4:739-750.

14. Hooks JJ, Gibbs CJ Jr. The foamy viruses. Bacteriol Rev. 1975;39:169-185[Free Full Text].

15. Ali M, Taylor GP, Pitman RJ, et al. No evidence of antibody to human foamy virus in widespread human populations. AIDS Res Hum Retroviruses. 1996;12:1473-1483[Medline] [Order article via Infotrieve].

16. Brown P, Nemo G, Gajdusek DC. Human foamy virus: further characterization, seroepidemiology, and relationship to chimpanzee foamy viruses. J Infect Dis. 1978;137:421-427[Medline] [Order article via Infotrieve].

17. Schweizer M, Turek R, Hahn H, et al. Markers of foamy virus infections in monkeys, apes, and accidentally infected humans: appropriate testing fails to confirm suspected foamy virus prevalence in humans. AIDS Res Hum Retroviruses. 1995;11:161-170[Medline] [Order article via Infotrieve].

18. Venkatesh LK, Theodorakis PA, Chinnadurai G. Distinct cis-acting regions in U3 regulate trans-activation of the human spumaretrovirus long terminal repeat by the viral bel1 gene product. Nucleic Acids Res. 1991;19:3661-3666[Abstract/Free Full Text].

19. Rethwilm A, Erlwein O, Baunach G, Maurer B, ter Meulen V. The transcriptional transactivator of human foamy virus maps to the bel 1 genomic region. Proc Natl Acad Sci U S A. 1991;88:941-945[Abstract/Free Full Text].

20. Keller A, Partin KM, Lochelt M, Bannert H, Flugel RM, Cullen BR. Characterization of the transcriptional trans activator of human foamy retrovirus. J Virol. 1991;65:2589-2594[Abstract/Free Full Text].

21. Baunach G, Maurer B, Hahn H, Kranz M, Rethwilm A. Functional analysis of human foamy virus accessory reading frames. J Virol. 1993;67:5411-5418[Abstract/Free Full Text].

22. Yu SF, Linial ML. Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay. J Virol. 1993;67:6618-6624[Abstract/Free Full Text].

23. Yu SF, Baldwin DN, Gwynn SR, Yendapalli S, Linial ML. Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science. 1996;271:1579-1582[Abstract].

24. Moebes A, Enssle J, Bieniasz PD, et al. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J Virol. 1997;71:7305-7311[Abstract].

25. Trobridge GD, Russell DW. Helper-free foamy virus vectors. Hum Gene Ther. 1998;9:2517-2525[CrossRef][Medline] [Order article via Infotrieve].

26. Macpherson I, Stoker M. Polyoma transformation of hamster cell clones---an investigation of genetic factors affecting cell competence. Virology. 1962;16:147-151[CrossRef][Medline] [Order article via Infotrieve].

27. DuBridge RB, Tang P, Hsia HC, Leong PM, Miller JH, Calos MP. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol. 1987;7:379-387[Abstract/Free Full Text].

28. Hawley RG, Lieu FH, Fong AZ, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136-138[Medline] [Order article via Infotrieve].

29. Sambrook J,Fritsch EF,Maniatis T, eds. Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

30. Tanaka T, Suda T, Suda J, et al. Stimulatory effects of granulocyte colony-stimulating factor on colony-forming units-spleen (CFU-S) differentiation and pre-CFU-S proliferation in mice. Blood. 1991;77:2597-2602[Abstract/Free Full Text].

31. Hanenberg H, Xiao XL, Dilloo D, Hashino K, Kato I, Williams DA. Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic transduction of mammalian cells. Nat Med. 1996;2:876-882[CrossRef][Medline] [Order article via Infotrieve].

32. Moritz T, Patel VP, Williams DA. Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors. J Clin Invest. 1994;93:1451-1457.

33. Bodine DM, Seidel NE, Gale MS, Nienhuis AW, Orlic D. Efficient retrovirus transduction of mouse pluripotent hematopoietic stem cells mobilized into the peripheral blood by treatment with granulocyte colony-stimulating factor and stem cell factor. Blood. 1994;84:1482-1491[Abstract/Free Full Text].

34. Heberling RL, Kalter SS. Isolation of foamy viruses from baboon (Papio cynocephalus) tissues. Am J Epidemiol. 1975;102:25-29[Abstract/Free Full Text].

35. McClure MO, Bieniasz PD, Schulz TF, et al. Isolation of a new foamy retrovirus from orangutans. J Virol. 1994;68:7124-7130[Abstract/Free Full Text].

36. Rhodes Feuillette A, Saal F, Lasneret J, Dubouch P, P'Eries J. Isolation and characterization of a new simian foamy virus serotype from lymphocytes of a Papio cynocephalus baboon. J Med Primatol. 1979;8:308-320[Medline] [Order article via Infotrieve].

37. Saib A, Puvion Dutilleul F, Schmid M, P'Eries J, de Th'e H. Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step. J Virol. 1997;71:1155-1161[Abstract].

38. Hill CL, Bieniasz PD, McClure MO. Properties of human foamy virus relevant to its development as a vector for gene therapy. J Gen Virol. 1999;80:2003-2009[Abstract/Free Full Text].

39. Palmer TD, Rosman GJ, Osborne WR, Miller AD. Genetically modified skin fibroblasts persist long after transplantation but gradually inactivate introduced genes. Proc Natl Acad Sci U S A. 1991;88:1330-1334[Abstract/Free Full Text].

40. Challita PM, Kohn DB. Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo. Proc Natl Acad Sci U S A. 1994;91:2567-2571[Abstract/Free Full Text].

41. Lange C, Blankenstein T. Loss of retroviral gene expression in bone marrow reconstituted mice correlates with down-regulation of gene expression in long-term culture initiating cells. Gene Ther. 1997;4:303-308[CrossRef][Medline] [Order article via Infotrieve].

42. Heinkelein M, Schmidt M, Fischer N, et al. Characterization of a cis-acting sequence in the pol region required to transfer human foamy virus vectors. J Virol. 1998;72:6307-6314[Abstract/Free Full Text].

43. Erlwein O, Bieniasz PD, McClure MO. Sequences in pol are required for transfer of human foamy virus-based vectors. J Virol. 1998;72:5510-5516[Abstract/Free Full Text].

© 2001 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
Y. Si, A. C. Pulliam, Y. Linka, S. Ciccone, C. Leurs, J. Yuan, O. Eckermann, S. Fruehauf, S. Mooney, H. Hanenberg, et al.
Overnight transduction with foamyviral vectors restores the long-term repopulating activity of Fancc-/- stem cells
Blood, December 1, 2008; 112(12): 4458 - 4465.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-P. Kiem, J. Allen, G. Trobridge, E. Olson, K. Keyser, L. Peterson, and D. W. Russell
Foamy virus-mediated gene transfer to canine repopulating cells
Blood, January 1, 2007; 109(1): 65 - 70.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. D. Trobridge, D. G. Miller, M. A. Jacobs, J. M. Allen, H.-P. Kiem, R. Kaul, and D. W. Russell
Foamy virus vector integration sites in normal human cells
PNAS, January 31, 2006; 103(5): 1498 - 1503.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. S. Patton, O. Erlwein, and M. O. McClure
Cell-cycle dependence of foamy virus vectors
J. Gen. Virol., October 1, 2004; 85(10): 2925 - 2930.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Trobridge and D. W. Russell
Cell Cycle Requirements for Transduction by Foamy Virus Vectors Compared to Those of Oncovirus and Lentivirus Vectors
J. Virol., March 1, 2004; 78(5): 2327 - 2335.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Burke, S. Sumner, N. Maitland, and C. E. Lewis
Macrophages in gene therapy: cellular delivery vehicles and in vivo targets
J. Leukoc. Biol., September 1, 2002; 72(3): 417 - 428.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. C. Josephson, G. Vassilopoulos, G. D. Trobridge, G. V. Priestley, B. L. Wood, T. Papayannopoulou, and D. W. Russell
Transduction of human NOD/SCID-repopulating cells with both lymphoid and myeloid potential by foamy virus vectors
PNAS, June 11, 2002; 99(12): 8295 - 8300.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Heinkelein, M. Dressler, G. Jarmy, M. Rammling, H. Imrich, J. Thurow, D. Lindemann, and A. Rethwilm
Improved Primate Foamy Virus Vectors and Packaging Constructs
J. Virol., March 19, 2002; 76(8): 3774 - 3783.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vassilopoulos, G.
Right arrow Articles by Russell, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vassilopoulos, G.
Right arrow Articles by Russell, D. W.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020