| |
|
|
|
|
|
|
|||
|
GENE THERAPY
From the Division of Hematology, University of
Washington, Seattle, WA.
Gene transfer into hematopoietic stem cells (HSCs) is an ideal
treatment strategy for many genetic and hematologic diseases. However,
progress has been limited by the low HSC transduction rates obtained
with retroviral vectors based on murine leukemia viruses. This study
examined the potential of vectors derived from the nonpathogenic human
foamy virus (HFV) to transduce human CD34+ cells and murine
HSCs. More than 80% of human hematopoietic progenitors present in
CD34+ cell preparations derived from cord blood were
transduced by a single overnight exposure to HFV vector stocks. Mice
that received transduced bone marrow cells expressed the vector-encoded
transgene long term in all major hematopoietic cell lineages and in
over 50% of cells in some animals. Secondary bone marrow transplants and integration site analysis confirmed that gene transfer occurred at
the stem cell level. Transgene silencing was not observed. Thus vectors
based on foamy viruses represent a promising approach for HSC gene therapy.
(Blood. 2001;98:604-609) Although vectors based on oncoviruses such as
murine leukemia viruses (MLVs) can transduce murine hematopoietic stem
cells (HSCs) efficiently when packaged with the ecotropic envelope
protein,1-3 this pseudotype only infects rodent cells. In
primate experiments, the poor performance of MLV vectors is thought to
be due to low cellular receptor levels for the nonecotropic pseudotypes
used4 or the quiescent state of HSCs, because mitosis is
required for nuclear entry of MLV genomes.5 Several
alternative retroviral vector systems are being evaluated in
hematopoietic cells, including vectors pseudotyped with different
envelope proteins or based on lentiviruses.6-8 Issues of
receptor expression levels, cell cycle requirements, and possible
safety risks still need to be resolved before these vectors are
successfully used for HSC gene therapy. In an attempt to overcome the
limitations of existing vector systems, we and others have developed
vectors based on the spumavirus family of retroviruses (foamy
viruses).9-12
Foamy viruses are nonpathogenic retroviruses with a wide tissue tropism
that are commonly found in mammalian species.13,14 Serologic and polymerase chain reaction (PCR)-based surveys have failed to identify naturally occurring foamy virus infections in human
populations, and the original "human" foamy virus (HFV) isolate is
now thought to be a chimpanzee virus variant.15-17 The genomic organization of HFV is more complex than that of oncoviruses; in addition to gag, pol, and env
genes, 3 open reading frames are located between env and the
3'LTR (bel 1-3) that are expressed from an internal
viral promoter (Figure 1). The
Bel-1 gene product (also known as Tas) is a transcriptional
transactivator of the HFV LTR required for completion of the viral life
cycle.18-20 The functions of the bel-2 and
bel-3 encoded factors are unknown and dispensable for virus
production in vitro.21,22 Among retroviruses, a unique
property of foamy viruses is that reverse transcription occurs during
virion formation rather than after cellular entry, so infectious
particles contain DNA genomes.23,24 We recently developed
an HFV vector production system that is independent of the Bel-1
transactivator and generates high titer stocks free of
replication-competent HFV25 (Figure 1). Here we show that these improved HFV vector stocks efficiently transduce human
CD34+ hematopoietic cells and murine HSCs.
Cell culture
Murine bone marrow (BM) cells were isolated by flushing femurs with
Hanks balanced salt solution and lysis of red blood cells (RBCs) by a
5-minute exposure to a hypotonic solution (155 mM NH4Cl,
7.3 mM NaHCO3, 126 µM EDTA). The remaining nucleated
cells were then cultured in DMEM supplemented with 20% FCS, 20 ng/mL human IL-6, 50 ng/mL murine IL-3, and 50 ng/mL murine SCF for 48 hours
before and after a single exposure to HFV vector stocks in CH296-coated
dishes. Following transduction, the cells were harvested with a rubber
policeman and washed with phosphate-buffered saline (PBS) before
injection into irradiated recipients and plating in AP or GFP colony
assays. Pretransplant colony-forming unit (CFU) transduction rates
ranged from 20% to more than 90%. BM cells isolated from transplanted
animals were plated directly in colony assays after lysis of RBCs.
Colonies were cultured in the same medium as used during transduction.
Vector production
Mice All transplants were performed with congenic mouse strains C57BL/6 (expressing the Ly5.2 antigen) and B6Ly5.2 (expressing the Ly5.1 antigen) purchased from the National Cancer Institute (Bethesda, MD). Twelve- to 16-week-old donor mice were treated with 120 mg/kg 5-fluorouracil (5-FU) by intraperitoneal injection 2 days before BM mononuclear cells were harvested. Eight- to 12-week-old recipient mice received 1100 rads from a dual cesium 137 gamma source (GammaCell 40, AEC, Kanata, ON, Canada) before infusion of 1 to 2 × 106 transduced BM cells by tail vein injection. Mice received acidified water with antibiotics (Baytril and amoxicillin) for 2 weeks after transplantation. Several mice receiving transplants had to be killed because of pathogen contamination in the animal care facility.Peripheral blood analysis Alkaline phosphate staining of peripheral blood smears obtained by retro-orbital puncture was performed by air-drying overnight, fixing with 0.5% gluteraldehyde in PBS for 10 minutes, washing 3 times for 10 minutes in PBS, heat inactivating for 1 hour at 68°C, and staining in X-Phos solution (100 µg/mL 5-bromo-4-chloro-3-indolyl phosphate, 1 mg/mL nitro blue tetrazolium) or Vector Red AP Substrate (Vector Laboratories, Burlingame, CA). Some smears were counterstained with Harris hematoxylin (Sigma Chemical, St Louis, MO) for 1 minute to highlight nuclear morphology. The percentage of AP+ white blood cells (WBCs) and RBCs was determined by Nomarski microscopy. Flow cytometric analysis of peripheral blood cells was performed on a FACScan (Becton Dickinson, San Jose, CA) set to identify platelets, WBCs, and RBCs according to their forward (FSC) and side scatter (SSC) characteristics as per the manufacturer's instructions, and either GFP fluorescence or AP expression with antiplacental AP antibody 8B6 from DAKO (Carpinteria, CA) conjugated with fluorescein isothiocyanate (FITC) by using the Fluoroscein-EX Protein Labeling Kit (Molecular Probes, Eugene, OR). For dual-label flow cytometry the following phycoerythrin (PE)-conjugated antibodies were used: B220 for B cells, anti-CD3 for T cells, Gr-1 for neutrophils, and Ter119 for RBCs (Pharmingen, San Diego, CA). Engraftment was monitored by flow cytometry for Ly5.1 and Ly5.2 antigens.DNA studies High molecular weight DNA was isolated from spleen and BM specimens with the DNA isolation kit D-5000 (Gentra, Minneapolis, MN), and analyzed by Southern blots.29 Locations of the probe fragment, relevant restriction enzyme sites, and PCR primers are shown in Figure 1. Vector copy numbers were quantitated by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) after correction for sample loading by reprobing the same blot with a mouse genomic -glucuronidase probe
(from Mark Sands, Washington University, St Louis, MO). For PCR
analysis, hematopoietic colonies were picked from soft agar cultures,
immersed in 100 µL of a 50 µg/mL solution of proteinase K,
incubated for 2 hours at 56°C, then for 30 minutes at 94°C. Twenty
microliters of the sample was used for PCR analysis with forward primer
AATGCTGGCATGGGAATAGT and reverse primer TAACTTCCTTGGGTGGCAAG. PCR
conditions were: initial denaturation at 94°C for 3 minutes, followed
by 35 cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C
for 1 minute. The samples were run in a 2% agarose gel and visualized
after ethidium bromide staining under UV light. DNA integrity in each
sample was confirmed by amplifying murine -actin
sequences30 under the same PCR conditions.
Transduction of hematopoietic progenitor cells by HFV vectors Helper-free HFV vectors expressing human placental AP or GFP were made by cotransfection of 293T cells with packaging and vector plasmids driven by a cytomegalovirus (CMV)-HFV fusion promoter (Figure 1). Using this vector system we produced viral stocks with titers ranging from 0.3 to 1.0 × 106 transducing units/mL that were further concentrated to approximately 107/mL by ultracentrifugation.In prior experiments, transduction of primary hematopoietic cells by
HFV vectors required cocultivation with vector-producing cells,12 so we first tested if different adhesion
molecules would enable transduction with cell-free vector preparations. Poly-L-lysine, human fibronectin, and the recombinant
fibronectin fragment CH296 were tested, but only fragment CH296
supported the transduction of murine hematopoietic progenitors (data
not shown), as was previously observed with MLV
vectors.31,32 To test if primitive human hematopoietic
cells could be transduced, CD34+ cord blood cells were
exposed for 10 hours to a single dose of cell-free HFV vector stocks on
CH296-coated plates, then plated for progenitor colony assays or
maintained for 5 days in liquid culture. As shown in Figure
2, human CD34+ cells were
efficiently transduced by both AP and GFP HFV vectors under these
conditions, and transduction rates of over 80% were routinely obtained
in colony assays.
Transgene expression in the peripheral blood cells of transplanted animals Murine BM transplantation assays were performed to determine if circulating peripheral blood cells would express vector-encoded transgenes and to document transduction at the HSC level. In these experiments, we used conditions originally established for MLV-based vectors,2,33 including pretreatment of BM donors with 5-FU, 2 days of ex vivo culture both before and after exposure to a single dose of HFV vector, followed by transplantation into lethally irradiated congenic recipients expressing distinct CD45 alleles. AP expression from vector CGPMAP Bel was monitored in the peripheral blood of transplanted animals by histochemical staining of blood smears, which allowed us to identify AP+ neutrophils,
lymphocytes, RBCs, and platelets (Figure
3A-D). GFP expression from vector
CGPMscvF was analyzed in WBCs, RBCs, and platelets by flow cytometry
(Figure 3E). Transgene-expressing cells were observed in all blood cell
lineages at 4 to 7 weeks after transplantation (Table
1) and the combined mean transduction rates (± SD) from these experiments were 36% ± 22% for RBCs,
24% ± 17% for WBCs, and 26% ± 11% for platelets.
Transduction of long-term repopulating cells Transplant recipients were followed for up to 6 months to monitor transduction of long-term repopulating cells. Mice transplanted with CGPMAP Bel-transduced BM cells that survived and maintained a minimum
of 50% donor cell engraftment levels were analyzed. As shown in Table
2, 4 of 7 of these animals had a
significant number of AP+ peripheral blood RBCs and WBCs;
the mean transduction rates were 24% for RBCs and 25% for WBCs.
Similar AP expression levels were observed in myeloid colonies grown
from BM progenitor cells harvested at this time and cultured in soft
agar (mean 32%). We also tested colonies for the presence of the
vector provirus by using PCR (Figure 4A).
The percentages of PCR+ and AP+ colonies were
similar in each animal, indicating that the lack of significant
long-term expression in 3 of 7 animals was due to reconstitution from
nontransduced HSCs as opposed to transgene silencing.
We performed secondary transplants with BM cells harvested from
long-term primary recipients no. 915 and no. 682, both of which
expressed AP. Although the reconstituting potential of the BM grafts
was reduced following serial transplantation, AP+
peripheral blood cells were detected in all 3 secondary recipients by
histochemical staining at 4 weeks after transplantation (Table 3). In addition, flow cytometry with
anti-AP and lineage-specific antibodies demonstrated AP+
neutrophils, lymphocytes, RBCs, and platelets in the peripheral blood
cells of secondary transplant recipients from donor no. 682 at 8 weeks
after transplantation (Figure 5). BM
progenitors harvested from secondary recipient no. 23 at 8 weeks after
transplantation were plated in colony assays and shown to express AP
(20 of 50 colonies) and contain the vector genome as determined by PCR
(5 of 18 colonies). The long-term transgene expression observed in primary transplant recipients, combined with the marking data from
multiple cell types in secondary recipients, demonstrates that
transduced HSCs persisted for several months in primary recipients and
maintained their ability to reconstitute hematopoiesis in secondary
recipients.
DNA analysis of transplant recipients Southern blots were used to determine the copy number of vector proviruses in genomic DNA samples from long-term and secondary transplant recipients. BM and spleen DNA samples were digested with EcoNI, which cuts CGPMAP Bel provirus genomes twice to
generate an 8.2-kb restriction fragment (Figure 1) that was detected in each mouse found to express AP by histochemical analysis, including all
3 recipients of secondary transplants (Figure 4B). Except for one
sample, the vector fragment was the predicted size of an intact
provirus. The BM of mouse no. 523 had 2 provirus fragments, one of
which was larger than expected, possibly due to transfer of an abnormal
vector genome or a recombination event after transduction. Vector copy
numbers ranged from 0.08 to 2.01 proviruses per diploid genome in
transgene-expressing mice. In 2 of 3 mice with low AP expression levels
(no. 524 and no. 209) no vector genomes could be detected in BM DNA
samples (Table 2). Mouse no. 526 expressed AP at low levels despite a
BM copy number of 0.92. In this mouse, it is not clear which BM cells
contained vector proviruses and whether they expressed AP, because less
than 10% of the myeloid progenitors that grew in BM colony assays
contained vector sequences based on PCR (Table 2).
Vector integration sites were analyzed by digestion of DNA samples from long-term and secondary transplant recipients with NsiI, (Figure 4C), which cuts once in the vector genome and once in flanking chromosomal DNA to produce a distinct fragment for each provirus integration site (Figure 1). One to 5 vector-hybridizing bands were seen in the samples from AP-expressing mice, consistent with monoclonal or oligoclonal hematopoietic reconstitution by transduced cells. In most cases, common junction fragments were present in the spleen and BM samples from the same mouse suggesting that a common transduced precursor repopulated both organs (mice no. 526, no. 682, and no. 915). In the secondary transplant experiments, a single junction fragment present in the primary recipient's BM (mice no. 682 and no. 915) was the only fragment detected in secondary recipients (mice no. 23, no. 24, and no. 37, respectively). Thus a single transduced cell reconstituted hematopoiesis in both primary and secondary recipients, consistent with transduction of pluripotent HSCs.
In summary, we have shown that vectors developed from human foamy virus can efficiently transduce human CD34+ hematopoietic progenitors and murine HSCs, and that recipients of transduced BM cells express the vector-encoded transgene in all hematopoietic cell lineages analyzed. Transduction at the HSC level was demonstrated by long-term transgene expression in transplant recipients, secondary transplantation experiments, and integration site analysis. Except for one cell clone with an aberrant provirus, all transduced cells contained an intact, integrated, foamy virus vector genome that appeared to be transcriptionally active. Our results suggest that HSCs may also be susceptible to infection with wild-type foamy viruses. Although foamy viruses have been isolated from blood cells,34-36 it is not clear what role the hematopoietic system plays in natural infections. Infected HSCs could act as a reservoir of provirus-containing cells capable of massive expansion during the production of mature blood cells. Murine BM transplantation has served as an important animal model for HSC transduction experiments. The results obtained with HFV vectors are comparable to the best results from prior studies with ecotropic MLV vectors, where over 50% of hematopoietic cells were transduced in some transplant recipients.1-3 Possible explanations for the high transduction rates we observed include improved transduction of nondividing cells or expression of cellular HFV receptor molecules on HSCs. HFV vectors may have transduced quiescent HSCs, because they transduce stationary phase cell cultures more efficiently than MLV vectors,10 HFV genomes enter the nuclei of G1/S phase-arrested cells,37 and transduction by cDNA-containing HFV particles is not dependent on adequate nucleotide pools.23,24 Future studies on whether pretreatment of BM donors with 5-FU and ex vivo cytokine stimulation are required may help resolve these issues. Although the cellular receptor(s) for HFV is not known, it must be ubiquitously expressed because HFV vectors can transduce cells from all vertebrate species tested.10,38 A common problem associated with MLV vectors has been the silencing of transgene expression over time.39,40 We did not observe significant silencing in our experiments, based on a comparison of vector marking and transgene expression levels in the hematopoietic progenitors of long-term and secondary transplant recipients, despite our use of an internal MLV LTR promoter previously found to silence in hematopoietic cells.3,40,41 Persistent expression of HFV vectors could be due to unidentified cis-acting functions present in the vector backbone that prevent silencing, or specific attributes of the MLV LTR promoter we used, such as the presence of a single internal copy, or the removal of the transfer RNA primer binding site. Further studies will be required to determine if specific attributes of the HFV vectors used can prevent transgene silencing. High HSC transduction rates have not been achieved in primate transplantation studies with nonecotropic MLV pseudotypes, so it is not clear how well murine experiments with HFV vectors will predict results in humans. However, the amphotropic MLV vectors commonly used in primates transduce murine HSCs at significantly lower rates than their ecotropic counterparts,4 suggesting that the mouse model may be valid when the same vector system is used. Because HFV vectors transduce murine and human hematopoietic progenitors at similar rates, they may also transduce primate HSCs efficiently. Thus, vectors based on the nonpathogenic foamy viruses may be a safe and effective alternative to MLV or lentivirus vectors for use in human gene therapy.
We thank Roli Hirata for expert technical assistance.
Submitted January 23, 2001; accepted March 26, 2001.
Supported by U.S. National Institutes of Health grants (to D.W.R., G.V., and N.J.) and the Medical Research Council of Canada (to G.T.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: David W. Russell, Division of Hematology, University of Washington, Box 357720, Seattle, WA 98195; e-mail: drussell{at}u.washington.edu.
1.
Riviere I, Brose K, Mulligan RC.
Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells.
Proc Natl Acad Sci U S A.
1995;92:6733-6737
2.
Persons DA, Allay JA, Allay ER, et al.
Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo.
Blood.
1997;90:1777-1786
3.
Halene S, Wang L, Cooper RM, Bockstoce DC, Robbins PB, Kohn DB.
Improved expression in hematopoietic and lymphoid cells in mice after transplantation of bone marrow transduced with a modified retroviral vector.
Blood.
1999;94:3349-3357
4.
Orlic D, Girard LJ, Jordan CT, Anderson SM, Cline AP, Bodine DM.
The level of mRNA encoding the amphotropic retrovirus receptor in mouse and human hematopoietic stem cells is low and correlates with the efficiency of retrovirus transduction.
Proc Natl Acad Sci U S A.
1996;93:11097-11102 5. Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993;12:2099-2108[Medline] [Order article via Infotrieve].
6.
Miyoshi H, Smith KA, Mosier DE, Verma IM, Torbett BE.
Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors.
Science.
1999;283:682-686
7.
May C, Rivella S, Callegari J, et al.
Therapeutic haemoglobin synthesis in
8.
Kiem HP, Heyward S, Winkler A, et al.
Gene transfer into marrow repopulating cells: comparison between amphotropic and gibbon ape leukemia virus pseudotyped retroviral vectors in a competitive repopulation assay in baboons.
Blood.
1997;90:4638-4645 9. Bieniasz PD, Erlwein O, Aguzzi A, Rethwilm A, McClure MO. Gene transfer using replication-defective human foamy virus vectors. Virology. 1997;235:65-72[CrossRef][Medline] [Order article via Infotrieve]. 10. Russell DW, Miller AD. Foamy virus vectors. J Virol. 1996;70:217-222[Abstract]. 11. Schmidt M, Rethwilm A. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology. 1995;210:167-178[CrossRef][Medline] [Order article via Infotrieve].
12.
Hirata RK, Miller AD, Andrews RG, Russell DW.
Transduction of hematopoietic cells by foamy virus vectors.
Blood.
1996;88:3654-3661 13. Flugel RM. Spumaviruses: a group of complex retroviruses. J Acquir Immune Defic Syndr. 1991;4:739-750.
14.
Hooks JJ, Gibbs CJ Jr.
The foamy viruses.
Bacteriol Rev.
1975;39:169-185 15. Ali M, Taylor GP, Pitman RJ, et al. No evidence of antibody to human foamy virus in widespread human populations. AIDS Res Hum Retroviruses. 1996;12:1473-1483[Medline] [Order article via Infotrieve]. 16. Brown P, Nemo G, Gajdusek DC. Human foamy virus: further characterization, seroepidemiology, and relationship to chimpanzee foamy viruses. J Infect Dis. 1978;137:421-427[Medline] [Order article via Infotrieve]. 17. Schweizer M, Turek R, Hahn H, et al. Markers of foamy virus infections in monkeys, apes, and accidentally infected humans: appropriate testing fails to confirm suspected foamy virus prevalence in humans. AIDS Res Hum Retroviruses. 1995;11:161-170[Medline] [Order article via Infotrieve].
18.
Venkatesh LK, Theodorakis PA, Chinnadurai G.
Distinct cis-acting regions in U3 regulate trans-activation of the human spumaretrovirus long terminal repeat by the viral bel1 gene product.
Nucleic Acids Res.
1991;19:3661-3666
19.
Rethwilm A, Erlwein O, Baunach G, Maurer B, ter Meulen V.
The transcriptional transactivator of human foamy virus maps to the bel 1 genomic region.
Proc Natl Acad Sci U S A.
1991;88:941-945
20.
Keller A, Partin KM, Lochelt M, Bannert H, Flugel RM, Cullen BR.
Characterization of the transcriptional trans activator of human foamy retrovirus.
J Virol.
1991;65:2589-2594
21.
Baunach G, Maurer B, Hahn H, Kranz M, Rethwilm A.
Functional analysis of human foamy virus accessory reading frames.
J Virol.
1993;67:5411-5418
22.
Yu SF, Linial ML.
Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay.
J Virol.
1993;67:6618-6624 23. Yu SF, Baldwin DN, Gwynn SR, Yendapalli S, Linial ML. Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science. 1996;271:1579-1582[Abstract]. 24. Moebes A, Enssle J, Bieniasz PD, et al. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J Virol. 1997;71:7305-7311[Abstract]. 25. Trobridge GD, Russell DW. Helper-free foamy virus vectors. Hum Gene Ther. 1998;9:2517-2525[CrossRef][Medline] [Order article via Infotrieve].
26.
Macpherson I, Stoker M.
Polyoma transformation of hamster cell clones
27.
DuBridge RB, Tang P, Hsia HC, Leong PM, Miller JH, Calos MP.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.
Mol Cell Biol.
1987;7:379-387 28. Hawley RG, Lieu FH, Fong AZ, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136-138[Medline] [Order article via Infotrieve]. 29. Sambrook J,Fritsch EF,Maniatis T, eds. Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
30.
Tanaka T, Suda T, Suda J, et al.
Stimulatory effects of granulocyte colony-stimulating factor on colony-forming units-spleen (CFU-S) differentiation and pre-CFU-S proliferation in mice.
Blood.
1991;77:2597-2602 31. Hanenberg H, Xiao XL, Dilloo D, Hashino K, Kato I, Williams DA. Colocalization of retrovirus and target cells on specific fibronectin fragments increases genetic transduction of mammalian cells. Nat Med. 1996;2:876-882[CrossRef][Medline] [Order article via Infotrieve]. 32. Moritz T, Patel VP, Williams DA. Bone marrow extracellular matrix molecules improve gene transfer into human hematopoietic cells via retroviral vectors. J Clin Invest. 1994;93:1451-1457.
33.
Bodine DM, Seidel NE, Gale MS, Nienhuis AW, Orlic D.
Efficient retrovirus transduction of mouse pluripotent hematopoietic stem cells mobilized into the peripheral blood by treatment with granulocyte colony-stimulating factor and stem cell factor.
Blood.
1994;84:1482-1491
34.
Heberling RL, Kalter SS.
Isolation of foamy viruses from baboon (Papio cynocephalus) tissues.
Am J Epidemiol.
1975;102:25-29
35.
McClure MO, Bieniasz PD, Schulz TF, et al.
Isolation of a new foamy retrovirus from orangutans.
J Virol.
1994;68:7124-7130 36. Rhodes Feuillette A, Saal F, Lasneret J, Dubouch P, P'Eries J. Isolation and characterization of a new simian foamy virus serotype from lymphocytes of a Papio cynocephalus baboon. J Med Primatol. 1979;8:308-320[Medline] [Order article via Infotrieve]. 37. Saib A, Puvion Dutilleul F, Schmid M, P'Eries J, de Th'e H. Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step. J Virol. 1997;71:1155-1161[Abstract].
38.
Hill CL, Bieniasz PD, McClure MO.
Properties of human foamy virus relevant to its development as a vector for gene therapy.
J Gen Virol.
1999;80:2003-2009
39.
Palmer TD, Rosman GJ, Osborne WR, Miller AD.
Genetically modified skin fibroblasts persist long after transplantation but gradually inactivate introduced genes.
Proc Natl Acad Sci U S A.
1991;88:1330-1334
40.
Challita PM, Kohn DB.
Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo.
Proc Natl Acad Sci U S A.
1994;91:2567-2571 41. Lange C, Blankenstein T. Loss of retroviral gene expression in bone marrow reconstituted mice correlates with down-regulation of gene expression in long-term culture initiating cells. Gene Ther. 1997;4:303-308[CrossRef][Medline] [Order article via Infotrieve].
42.
Heinkelein M, Schmidt M, Fischer N, et al.
Characterization of a cis-acting sequence in the pol region required to transfer human foamy virus vectors.
J Virol.
1998;72:6307-6314
43.
Erlwein O, Bieniasz PD, McClure MO.
Sequences in pol are required for transfer of human foamy virus-based vectors.
J Virol.
1998;72:5510-5516
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
Y. Si, A. C. Pulliam, Y. Linka, S. Ciccone, C. Leurs, J. Yuan, O. Eckermann, S. Fruehauf, S. Mooney, H. Hanenberg, et al. Overnight transduction with foamyviral vectors restores the long-term repopulating activity of Fancc-/- stem cells Blood, December 1, 2008; 112(12): 4458 - 4465. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Kiem, J. Allen, G. Trobridge, E. Olson, K. Keyser, L. Peterson, and D. W. Russell Foamy virus-mediated gene transfer to canine repopulating cells Blood, January 1, 2007; 109(1): 65 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Trobridge, D. G. Miller, M. A. Jacobs, J. M. Allen, H.-P. Kiem, R. Kaul, and D. W. Russell Foamy virus vector integration sites in normal human cells PNAS, January 31, 2006; 103(5): 1498 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Patton, O. Erlwein, and M. O. McClure Cell-cycle dependence of foamy virus vectors J. Gen. Virol., October 1, 2004; 85(10): 2925 - 2930. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Trobridge and D. W. Russell Cell Cycle Requirements for Transduction by Foamy Virus Vectors Compared to Those of Oncovirus and Lentivirus Vectors J. Virol., March 1, 2004; 78(5): 2327 - 2335. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burke, S. Sumner, N. Maitland, and C. E. Lewis Macrophages in gene therapy: cellular delivery vehicles and in vivo targets J. Leukoc. Biol., September 1, 2002; 72(3): 417 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Josephson, G. Vassilopoulos, G. D. Trobridge, G. V. Priestley, B. L. Wood, T. Papayannopoulou, and D. W. Russell Transduction of human NOD/SCID-repopulating cells with both lymphoid and myeloid potential by foamy virus vectors PNAS, June 11, 2002; 99(12): 8295 - 8300. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Heinkelein, M. Dressler, G. Jarmy, M. Rammling, H. Imrich, J. Thurow, D. Lindemann, and A. Rethwilm Improved Primate Foamy Virus Vectors and Packaging Constructs J. Virol., March 19, 2002; 76(8): 3774 - 3783. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||