|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Department of Pediatric Oncology, Dana-Farber
Cancer Institute, Harvard Medical School, Boston, MA.
Protein ubiquitination is an important regulator of
cytokine-activated signal transduction pathways and hematopoietic cell growth. Protein ubiquitination is controlled by the coordinate action
of ubiquitin-conjugating enzymes and deubiquitinating enzymes. Recently a novel family of genes encoding growth-regulatory
deubiquitinating enzymes (DUB-1 and DUB-2) has been identified.
DUBs are immediate-early genes and are induced rapidly and
transiently in response to cytokine stimuli. By means of polymerase
chain reaction amplification with degenerate primers for the
DUB-2 complementary DNA, 3 murine bacterial artificial
chromosome (BAC) clones that contain DUB gene sequences were isolated. One BAC contained a novel DUB gene
(DUB-2A) with extensive homology to DUB-2. Like
DUB-1 and DUB-2, the DUB-2A gene
consists of 2 exons. The predicted DUB-2A protein is highly related to
other DUBs throughout the primary amino acid sequence, with a
hypervariable region at its C-terminus. In vitro, DUB-2A had functional deubiquitinating activity; mutation of its conserved amino acid residues abolished this activity. The 5' flanking sequence of the DUB-2A gene has a hematopoietic-specific functional
enhancer sequence. It is proposed that there are at least 3 members of the DUB subfamily (DUB-1, DUB-2,
and DUB-2A) and that different hematopoietic cytokines
induce specific DUB genes, thereby initiating a
cytokine-specific growth response.
(Blood. 2001;98:636-642) Protein ubiquitination controls many intracellular
processes, including cell cycle progression.1,2
transcriptional activation,3 and signal
transduction4 (reviewed in Ciechanover5 and
D'Andrea and Pellman6). Like protein phosphorylation,
protein ubiquitination is dynamic, involving enzymes that add ubiquitin
(ubiquitin-conjugating enzymes) and enzymes that remove ubiquitin
(deubiquitinating enzymes). Considerable progress has been made in
understanding ubiquitin conjugation and its role in regulating protein
degradation. Recent studies have demonstrated that regulation also
occurs at the level of deubiquitination. Deubiquitinating enzymes are
cysteine proteases that specifically cleave ubiquitin from
ubiquitin-conjugated protein substrates. Deubiquitinating enzymes have
significant sequence diversity and may therefore have a broad range of
substrate specificity.
There are 2 major families of deubiquitinating enzymes, the
ubiquitin-processing proteases (ubp) family7-9 and the
ubiquitin carboxy-terminal hydrolase (uch) family.10,11
The ubp family and the uch family have also been referred to as the
type 1 uch and type 2 uch families.12 Both ubps and uchs
are cysteine proteases containing an active site cysteine, aspartate,
and histidine residue. Ubps vary greatly in size and structural
complexity, but all contain 6 characteristic conserved homology
domains.13 Uchs, in contrast, include a group of small,
closely related proteases that lack the 6 characteristic homology
domains of the ubps.11
Little is known regarding the precise cellular function of ubps and
uchs. For instance, despite the broad range and structural diversity of
these enzymes, only a few specific candidate substrates have been
identified.14-16 Also, whether these enzymes act
exclusively on ubiquitinated substrates or on substrates with
ubiquitinlike modifications, such as SUMO-117,18 and
NEDD8,19 remains unknown. Recently, a distinct family of
cysteine proteases, acting on SUMO-1-conjugated substrates, has been
identified.20 Finally, the precise cellular level of
action of these enzymes is unknown. Some deubiquitinating enzymes may
act before the proteasome, thereby removing ubiquitin and rescuing a
substrate protein from degradation.6 Other
deubiquitinating enzymes may act as a component of the proteasome,
thereby promoting the net degradation of a specific ubiquitinated
substrate.21
Despite this lack of information regarding substrate specificity,
substrate selection, and level of action, it is clear that some
deubiquitinating enzymes exert distinct growth-regulatory activities or
growth effects on cellular differentiation. The tre-2 oncoprotein, for
example, is a deubiquitinating enzyme with transforming
activity.8,22 The FAF protein is a ubp that regulates Drosophila eye development.23 Other ubps, such
as UBP324 and Drosophila
ubp-64E,25 play an important role in transcriptional silencing.
We have recently identified a hematopoietic-specific growth-regulatory
subfamily of ubps, referred to as DUBs.26,27
DUB-1 was originally cloned as an immediate-early gene
induced by the cytokine interleukin-3 (IL-3). Several lines of evidence
suggest that DUB-1 plays a growth-regulatory role in the
cell. First, the expression of DUB-1 has the characteristics
of an immediate-early gene. Following IL-3 stimulation, the
DUB-1 messenger RNA (mRNA) is rapidly induced and is
superinduced in the presence of cyclohexamide. Second, high-level
expression of DUB-1 from an inducible promoter results in
cell cycle arrest prior to S phase. This result suggests that
DUB-1 controls the ubiquitin-dependent proteolysis or the ubiquitination state of an important regulator at the G1/S
transition of the cell cycle. Finally, the induction of DUB proteins
may be a general feature of the response to cytokines. Another family member, DUB-2, is induced by IL-2.28
DUB proteins are highly related to each other, not only within the 6 characteristic ubp domains, but also throughout their protein sequence.
One short peptide region within the C-terminal extension of
DUB family members shows remarkable sequence diversity. This
"hypervariable region" may have a role in the recognition of
specific substrates.28 A tandem repeat of DUB
genes maps to a region of murine chromosome 7,28
suggesting that the DUB subfamily arose by tandem
duplication of an ancestral DUB gene.
In the current study, we have cloned the complementary DNA (cDNA) and
gene for a new member of the hematopoietic-specific DUB
subfamily of deubiquitinating enzymes. Because the new DUB is highly related to DUB-2, in terms of its sequence,
genomic organization, and expression pattern, we have named the new
gene DUB-2A. DUB-2A encodes a functional
deubiquitinating enzyme, which is rapidly induced in response to
cytokine stimulation of hematopoietic cells. A minimal catalytic domain
in the N-terminal region of DUB-2A is necessary and
sufficient for functional activity, and the carboxy-terminal region,
which is hypervariable among DUBs, is not required for
activity. Moreover, we propose that DUB-2A regulates
cellular growth by controlling the ubiquitin-dependent degradation or
the ubiquitination state of an unknown intracellular growth-regulatory protein.
Cells and cell culture
Southern and Northern blot analyses
Isolation of the genomic DUB-2A gene and construction of luciferase reporter plasmids The murine genomic library in pBeloBAC11 vector was screened by genomic PCR by means of 2 primers (Bam5', GCGGATCCTTTGAAGAGGTCTTTGGAAA, and Xho3', ATCTCGAGGTGTCCACAGGAGCCTGTGT) derived from the DUB-2 DNA sequence. By means of the same primers, genomic PCR products from 1 of the 3 positive bacterial artificial chromosome (BAC) clones were generated and sequenced.DUB-1 and DUB-2A enhancer elements were
identified and subcloned into the PGL2Promoter plasmid (Promega,
Madison, WI), which contains the simian virus SV40 basal promoter
upstream of the luciferase reporter gene. The enhancer region of the
DUB-2A gene corresponds to the minimal IL-3 response element
of the murine DUB-1 gene (nucleotides Deubiquitination assay A deubiquitination assay, based on the cleavage of ubiquitin- -galactosidase (ub--gal) fusion proteins, has
been described previously.8 A 1638-base pair (bp)
fragment from the wild-type DUB-2A cDNA (corresponding to
amino acids 1 to 545) and a cDNA containing a missense mutant form,
DUB-2A (C60S [single-letter amino acid codes]),
were generated by PCR and inserted, in frame, into pGEX-2TK (Pharmacia,
Piscataway, NY), downstream of the glutathione S-transferase (GST) coding element. Ub-Met--gal was
expressed from a pACYC184-based plasmid. Plasmids were cotransfomed
into MC1061 Escherichia coli. Plasmid-bearing E
coli MC1061 cells were lysed and analyzed by immunoblotting with a
rabbit anti--gal antiserum (Cappel, Durham, NC), a rabbit anti-GST
antiserum (Santa Cruz Biotechnology, CA), and the ECL system (Amersham,
Buckinghamshire, United Kingdom).
Transient transfection and transactivation experiments All plasmid DNAs were purified with Qiagen columns. Transient transfections of Ba/F3 cells and luciferase reporter gene assays were performed as previously described,27 with the following modification. Ba/F3 cells were washed free of serum and IL-3 and cultured in plain RPMI for 2 hours. Afterwards, they were resuspended at 1 × 107 cells per 0.8 mL RPMI and transferred to an electroporation cuvette. Cells were incubated with 10 µg of the indicated luciferase reporter vector, along with 1 µg of a cytomegalovirus-promoter-driven-galactosidase (-gal) reporter
gene construct to monitor transfection efficiencies. After
electroporation with a Bio-Rad (Hercules, CA) electroporator (350 V,
960 microfarads [µF]), cells were divided into 2 pools and either
restimulated with 10 pM IL-3 for 4 hours or left untreated. Then,
luciferase and -galactosidase levels were assayed by, respectively, the Luciferase assay kit (Analytical Luminescence Laboratory, San
Diego, CA) and the Galacto-Light Kit (Tropix, Bedford, MA) according to
vendor specifications. Each luciferase reporter construct was tested at
least 3 times by independent transfection.
Isolation of an enhancer sequence from the BAC clone containing the DUB-2A gene A 1516-base pair fragment, corresponding to the promoter region of the DUB-2A gene, was amplified by PCR from the DUB-2A BAC clone. Primers used were DUB1e1 (5'-CTAGTAAGGATATAACAGG-3') and T14/CS (5'-CATTCAGGTAGCAGCTGTTGCC-3'). The amplified PCR product was subcloned into a pCR2.1-TOPO vector and sequenced. The 100-bp fragment derived from the promoter region was further subcloned into the pGL2Promoter.
Identification and cloning of a novel DUB gene, DUB-2A We have previously characterized a genomic clone of the murine DUB-2 gene28 (Figure 1A). In an attempt to isolate additional DUB-2 genomic clones with longer 5' and 3' genomic sequence, we screened a murine genomic BAC library, using PCR with DUB-2-specific primers (Figure 1A). We isolated 3 BAC clones that yielded a 1.5-kb PCR product, consistent with the presence of a DUB sequence. Two of the BAC clones (BAC2 and BAC3) contained the DUB-2 gene. An additional BAC clone (BAC1) contained a different DUB gene (DUB-2A), which was subjected to further analysis.
To distinguish the new DUB gene from DUB-2, the BAC1 clone was analyzed by Southern blot analysis (Figure 1B). In parallel, we analyzed restriction enzyme-digested genomic DNA samples from multiple murine cell lines, corresponding to 6 independent strains of mice (lanes 1 through 7). We also analyzed genomic DNA from a DUB-2 genomic clone (lane 8). For analysis, we used a 32P-labeled DNA probe from the indicated region downstream of the DUB-2 gene (Figure 1A). This labeled probe identified 2 distinct bands in genomic DNA from all mouse species tested (Figure 1B, lanes 1 through 7). The genomic DUB-2 clone yielded the upper band (lane 8), but the genomic DUB-2A clone (BAC1) yielded the lower band (lane 10). Taken together, these results demonstrate that DUB-2 and DUB-2A are distinct genes found in the genome of multiple mouse strains. The structure of the genomic DUB-2A gene was further
examined by PCR of various regions of the BAC1 clone (Figure
2B). Distinct regions of the
DUB-2A gene, including the 5' and 3' genomic sequences, were
amplified by PCR with the indicated oligonucleotide primer pairs
(Figure 2A). Sequencing of these amplified PCR products indicated that
the DUB-2A gene is composed of 2 exons and 1 intron (Figure
2B) and therefore has a structural organization identical to that of
the DUB-2 gene.28 The DUB-2A gene is
predicted to encode a protein of 545 amino acids. Exon 1 encodes the 9 amino acid amino terminal region of DUB-2A, and exon 2 encodes amino acids 10 through 545. The single intron is 792 bp. The
sequence of the intron-exon junction conforms to a consensus sequence
for a eukaryotic splice site. A region of the DUB-2A genomic
clone, 5' to the ATG translation start site, contains a stop
codon.
We next compared the predicted amino acid sequence of DUB-2A with the
previously cloned DUB-1 and DUB-2 proteins28 (Figure 3). DUB-2A has 95% amino acid identity
with DUB-2 and 86% amino acid identity with DUB-1. The DUB-2A protein
contains the highly conserved C (cystein) and H (histidine)
domains of other known ubps.8,13 In addition, there is a
highly conserved D residue at DUB-2A, position 133. These domains are
likely to form the enzyme's active site. The putative active site
nucleophile of DUB-2A is a cysteine residue (C60) in the C
domain. In addition, DUB-2A contains a lysine-rich region
(amino acids 74 to 84) and a short hypervariable region (amino acids
431 to 450) in which the DUB-2 sequence diverges from DUB-1 and DUB-2
(Figure 3). The hypervariable region of DUB-2A contains the
sequence VPQEQNHQKLGQKHRNNEIL, extending from amino acid residue 432 to 451.
DUB-1, DUB-2, and DUB-2A proteins are more related to each other than to other members of the ubp family of deubiquitinating enzymes. For instance, DUB-1, DUB-2, and DUB-2A contain sequence similarity not only in the conserved C and H domains (common to all ubps), but also throughout the carboxy-terminal region of the proteins. Taken together, these results further support the existence of a DUB subfamily of ubps, as previously described.28 Expression pattern of the DUB-2A mRNA We next used DUB-2A-specific PCR primers to determine the expression pattern of the DUB-2A mRNA (Figure 4). Using PCR from genomic DUB clones (indicated in Figure 2A), we demonstrated that one primer pair (exon 1 and DUB-2A-b) specifically amplifies the DUB-2A sequence (lane 1) but does not amplify the highly related DUB-2 sequence (lane 2). We used these primer pairs and RT-PCR to examine the expression of the DUB-2A mRNA in various murine cell lines (lanes 3 through 7). The DUB-2A mRNA was expressed in CTLL (T cells), 32D (myeloid cells), and ES cells but was not expressed in F9 (carcinoma cells) or NIH3T3 (fibroblasts). The DUB-2A mRNA was also detected in Ba/F3 cells (data not shown). The identification of the cDNA isolated from CTLL, 32D, and ES cells was confirmed as DUB-2A by direct DNA sequencing of the amplified cDNA product (data not shown). As a control, degenerate DUB primers, capable of amplifying other DUB family members, yielded an amplified RT-PCR product from all murine cell lines tested. Taken together, these data demonstrate that DUB-2A is expressed primarily in hematopoietic cells, a pattern that is similar but not identical to the expression pattern of DUB-2.
The DUB-2A gene encodes a functional deubiquitinating enzyme To determine whether DUB-2A has deubiquitinating activity, we expressed DUB-2A as a GST fusion protein (Figure 5). The open reading frame of DUB-2A was subcloned into the bacterial expression vector pGEX. The pGEX-DUB-2A was cotransformed into E coli (MC1061) with a plasmid encoding Ub-Met--gal, in which
ubiquitin is fused to the NH2-terminus of -galactosidase.
As shown by immunoblot analysis, a cDNA clone encoding
GST-DUB-2A fusion protein resulted in cleavage of
Ub-Met--gal (lane 2) to an extent comparable to that observed with
GST-DUB-1 (lane 6) and GST-DUB-2 (lane 4). As a
control, cells transformed with the pBlueScript vector with a
nontranscribed DUB-2A insert (lane 1) or with the pGEX
vector (data not shown) failed to cleave Ub-Met--gal. A mutant
DUB-2A polypeptide, containing a C60S mutation, was unable
to cleave the Ub-Met--gal substrate (lane 3).
Taken together, these results demonstrate that DUB-2A has deubiquitinating enzyme activity and that C60 is critical for its thiol protease activity. An anti-GST immunoblot confirmed that the GST-DUB-1, GST-DUB-2, and GST-DUB-2A proteins were synthesized at comparable levels (Figure 5, lower blot). The difference in sizes of the DUB-1, DUB-2, and DUB-2A GST fusion proteins reflects the difference in size of these full-length DUB enzymes. Expression of full-length wild-type DUB proteins in transfected COS cells reveals that DUB-1, DUB-2, and DUB-2A are 59 kd, 62 kd, and 64 kd, respectively (data not shown). The carboxy-terminal region of DUB-2A is not required for enzymatic activity As previously described, the amino terminal region of DUB-1, DUB-2, and DUB-2A contains a putative catalytic region, consisting of C and H domains. The carboxy-terminal region contains a hypervariable region that may not be required for functional activity and that may confer substrate specificity. In order to determine the structural requirements of DUB-mediated deubiquitinating activity, we next generated a series of DUB-1 and DUB-2A mutant polypeptides (Figure 6A) and synthesized these as GST-fusion proteins in E coli (Figure 6B). The mutant DUB polypeptides displayed differential activities in cleaving Ub--galactosidase in the E coli-based
cotransformation assay. The C60 residue was required for
deubiquitinating activity. In addition, mutations of the indicated D or
H residue resulted in loss of activity, suggesting that these residues
also play a critical role in the catalytic core of the enzyme. The
carboxy-terminal 67 amino acids of DUB-1 (B/V mutant) and
the carboxy-terminal 70 amino acids of DUB-2A (M/H mutant)
were not required for deubiquitinating activity. Taken together, these
data demonstrate that the core catalytic domain of DUB-1 and
DUB-2A is sufficient for deubiquitinating activity.
The DUB-2A gene contains a cytokine-inducible enhancer element We have previously identified a cytokine-response enhancer element of the murine DUB-1 gene.27 This minimal enhancer element of DUB-1 is 112 bp in size and contains an ets site, 2 AP-1 sites, and 2 GATA sites. The enhancer is located approximately 1500 bp 5' to the ATG translational start site of DUB-1. In an attempt to identify an enhancer region of the DUB-2A gene, we compared the 5' sequences of DUB-1 and DUB-2A, within the region of the DUB-1 enhancer element. The complete 5' region of the DUB-2A gene is shown (Figure 7A). A comparison of the DUB-1 enhancer with the corresponding region of the DUB-2A gene is also shown (Figure 7B). Interestingly, there is considerable base-pair identity in this region of DUB-1 and DUB-2A, suggesting conserved enhancer functional activity. The DUB-2A 5' region contains conserved ets, AP1, and GATA sequences.
To assess the putative enhancer activity of the DUB-2A region, we next performed transfection assays in the murine hematopoietic pro-B lymphocyte cell line, Ba/F3 (Figure 7C). Ba/F3 cells are dependent on murine IL-3 for growth and survival. Ba/F3 cells were transiently transfected with various reporter constructs, and IL-3-induced DUB-1-luc and DUB-2A-luc activity were measured. The DUB-2A sequence, shown in Figure 7B, had an enhancer activity that was comparable to the activity of the known DUB-1 enhancer.27 Taken together, these data further support the notion that DUBs are cytokine-inducible, immediate-early gene products expressed in hematopoietic cells.
We have previously described a family of hematopoietic-specific, cytokine-inducible immediate-early genes encoding growth-regulatory deubiquitinating enzymes (DUBs).28 DUB mRNA is induced rapidly by cytokines, and this is followed by a rapid decline. DUB induction requires the activation of a cytokine receptor and a Janus kinase (JAK).29 Sustained overexpression of DUB mRNA results in cell cycle arrest,26 suggesting that these enzymes regulate cell growth by controlling the ubiquitin-dependent degradation or the ubiquitination state of a critical intracellular substrate. Several cellular proteins involved in hematopoietic cell growth, including cytokine receptors, cbl, and cyclin/cdk inhibitors, are ubiquitinated and are potential physiologic substrates of DUB activity. In the current study, we have identified a novel DUB enzyme, DUB-2A, which is another member of the DUB subfamily of deubiquitinating enzymes. DUB-2A is highly related to DUB-2, containing the same 2 exon genomic structure and encoding an enzyme of remarkable similarity (95% amino acid identity with DUB-2). DUB-2A is a discrete gene, however, and not an allele of the DUB-2 gene. For instance, both DUB-2 and DUB-2A genes are found in 6 independent strains of inbred mice. Interestingly, DUB-2A differs from DUB-2 and DUB-1 in the carboxy-terminal hypervariable region, further suggesting that this region of the DUB enzyme regulates substrate specificity. For instance, this region may determine specific binding partner proteins of the various DUB enzymes. The existence of hypervariable regions outside of a core catalytic domain is also a feature of regulatory kinase and phosphatase enzyme families. The DUB genes map to a region of murine chromosome 7 that contains a head-to-tail repeat of DUB genes.28 This tandem repeat array suggests that the DUB genes arose by the tandem duplication of an ancestral DUB gene. While the tandem repeat length is unknown, recent evidence suggests a relatively short amplified unit. For instance, one of our murine BAC clones (120 kb) contains 2 complete DUB genes, suggesting that the amplified unit is less than 120 kb (K.-H.B., unpublished observation, December 2000). Other studies have recently identified a 4.7-kb highly repeated motif that has homology to the murine DUB genes.31,32 According to RT-PCR analysis (Figure 4) and Northern blot analysis (data not shown), the DUB-2A mRNA is expressed primarily in hematopoietic cells. This is similar to the expression pattern of the DUB-2 mRNA. Interestingly, a highly related DUB mRNA (not DUB-2A) is expressed in some nonhematopoietic cell lines, such as ES cells and 3T3 fibroblasts (Figure 4), suggesting that DUB mRNA induction is a common feature of growth responses in other cell types as well. While the function of the DUB-2A cDNA remains unknown, several features of DUB-2A suggest that it plays a role in hematopoietic cell growth control. First, the temporal expression of the DUB-2A gene is precisely regulated. The DUB-2A mRNA has a cytokine-inducible immediate-early pattern of expression and a short half-life. Second, the DUB-2A mRNA is expressed in a precise, hematopoietic-specific pattern, suggesting that it regulates growth and differentiation of a specific subset of cellular lineages. Several recent studies suggest that hematopoietic cell growth is regulated by ubiquitin-dependent proteolysis of critical proteins involved in cytokine signaling pathways. First, cytokine receptors have been shown to undergo ubiquitin-dependent internalization and turnover.4,33 Second, recent evidence suggests that the mitogenic signaling protein, signal transducer and activator of transcription 1 (STAT1), is regulated, at least in part, by ubiquitin-dependent degradation.34 Inhibition of proteasome activity also modulates signaling by the JAK/STAT pathway.35,36 Third, other hematopoietic signaling proteins, such as cbl37 and CIS,38 are thought to be directly or indirectly modulated by the ubiquitin pathway. Recent studies have shown that the hematopoietic transforming protein cbl has a Ring Finger domain and is a functional E3 ubiquitin ligase.39 Whether DUB enzymes regulate the ubiquitin-dependent degradation or the ubiquitination state of any of these hematopoietic protein substrates, leading to modulation of cellular growth, remains to be determined.
We thank members of the D'Andrea laboratory for helpful discussions and Barbara Keane for preparation of the manuscript.
Submitted February 7, 2001; accepted April 2, 2001.
Supported by National Institutes of Health grants RO1 DK 43889 and PO1 DK 50654.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Alan D. D'Andrea, Dana-Farber Cancer Institute, Department of Pediatric Oncology, Harvard Medical School, 44 Binney St, Boston, MA 02115; e-mail: alan_dandrea{at}dfci.harvard.edu.
1.
King RW, Deshaies RJ, Peters J-M, Kirschner MW.
How proteolysis drives the cell cycle.
Science.
1996;274:1652-1658 2. Glotzer M, Murray AW, Kirschner MW. Cyclin is degraded by the ubiquitin pathway. Nature. 1991;349:132-138[CrossRef][Medline] [Order article via Infotrieve]. 3. Palombella VJ, Rando OJ, Goldberg AL, Maniatis T. The ubiquitin-proteasome pathway is required for processing the NF-kB1 precursor protein and the activation of NF-kB. Cell. 1994;78:773-785[CrossRef][Medline] [Order article via Infotrieve].
4.
Strous GJ, van Kerkhof P, Govers R, Rotwein P, Schwartz AL.
Growth hormone-induced signal transduction depends on an intact ubiquitin system.
J Biol Chem.
1997;272:40-43 5. Ciechanover A. The ubiquitin-proteasome proteolytic pathway. Cell. 1994;79:13-21[CrossRef][Medline] [Order article via Infotrieve]. 6. D'Andrea AD, Pellman D. Deubiquitinating enzymes: a new class of biological regulators. Crit Rev Biochem Mol Biol. 1998;33:337-352[CrossRef][Medline] [Order article via Infotrieve].
7.
Baker RT, Tobias JW, Varshavsky A.
Ubiquitin-specific proteases of saccharomyces cerevisiae.
J Biol Chem.
1992;267:23364-23375 8. Papa FR, Hochstrasser M. The yeast DOA4 gene encodes a deubiquitinating enzyme related to a product of the human tre-2 oncogene. Nature. 1993;366:313-319[CrossRef][Medline] [Order article via Infotrieve].
9.
Tobias JW, Varshavsky A.
Cloning and functional analysis of the ubiquitin-specific protease gene UBP1 of saccharomyces cerevisiae.
J Biol Chem.
1991;266:12021-12028
10.
Wilkinson KD, Lee K, Deshpande S, Duerksen-Hughes P, Boss J, Pohl J.
The neuron-specific protein PGP 9.5 is a ubiquitin carboxyl-terminal hydrolase.
Science.
1989;246:670-673 11. Larsen CN, Price JS, Wilkinson KD. Substrate binding and catalysis by ubiquitin C-terminal hydrolases: identification of two active site residues. Biochemistry. 1996;35:6735-6744[CrossRef][Medline] [Order article via Infotrieve]. 12. Wilkinson KD. Regulation of ubiquitin-dependent processes by deubiquitinating enzymes. FASEB J. 1997;11:1245-1256[Abstract]. 13. Wilkinson KD, Tashayev VL, O'Connor LB, Larsen CN, Kasperek E, Pickart CM. Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T. Biochemistry. 1995;34:14535-14546[CrossRef][Medline] [Order article via Infotrieve]. 14. Amerik AY, Swaminathan S, Krantz BA, Wilkinson KD, Hochstrasser M. In vivo disassembly of free polyubiquitin chains by yeast Ubp14 modulates rates of protein degradation by the proteasome. EMBO J. 1997;16:4826-4838[CrossRef][Medline] [Order article via Infotrieve].
15.
Li Q, Hariharan IK, Chen F, Huang Y, Fischer JA.
Genetic interactions with Rap1 and Ras1 reveal a second function for the fat facets deubiquitinating enzyme in Drosophila eye development.
Proc Natl Acad Sci U S A.
1997;94:12515-12520
16.
Taya S, Yamamoto T, Kano K, et al.
The Ras target AF-6 is a substrate of the fam deubiquitinating enzyme.
J Cell Biol.
1998;142:1053-1062
17.
Matunis MJ, Coutavas E, Blobel G.
A novel ubiquitin-like modification modulate the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex.
J Cell Biol.
1996;135:1457-1470 18. Mahajan R, Delphin C, Guan T, Gerace L, Melchior F. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell. 1997;88:97-107[CrossRef][Medline] [Order article via Infotrieve].
19.
Kamitani T, Kito K, Nguyen HP, Yeh ETH.
Characterization of NEDD8, a developmentally down-regulated ubiquitin-like protein.
J Biol Chem.
1997;272:28557-28562 20. Li S-J, Hochstrasser M. A new protease required for cell-cycle progression in yeast. Nature. 1999;398:246-251[CrossRef][Medline] [Order article via Infotrieve].
21.
Papa FR, Amerik AY, Hochstrasser M.
Interaction of the Doa4 deubiquitinating enzyme with the yeast 26S proteasome.
Mol Biol Cell.
1999;10:741-756 22. Nakamura T, Hillova J, Mariage-Samson R, et al. A novel transcriptional unit of the tre oncogene widely expressed in human cancer cells. Oncogene. 1992;7:733-741[Medline] [Order article via Infotrieve].
23.
Huang Y, Baker RT, Fischer-Vize JA.
Control of cell fate by a deubiquitinating enzyme encoded by the fat facets gene.
Science.
1995;270:1828-1831 24. Moazed D, Johnson D. A deubiquitinating enzyme interacts with SIR4 and regulates silencing in S. cerevisiae. Cell. 1996;86:667-677[CrossRef][Medline] [Order article via Infotrieve]. 25. Henchoz S, De Rubertis F, Pauli D, Spierer P. The dose of a putative ubquitin-specific protease affects position-effect variegation in Drosophila melanogaster. Mol Cell Biol. 1996;16:5717-5725[Abstract].
26.
Zhu Y, Carroll M, Papa FR, Hochstrasser M, D'Andrea AD.
DUB-1, a deubiquitinating enzyme with growth-suppressing activity.
Proc Natl Acad Sci U S A.
1996;93:3275-3279 27. Zhu Y, Pless M, Inhorn R, Mathey-Prevot B, D'Andrea AD. The murine DUB-1 gene is specifically induced by the bc common subunit of the interleukin-3 receptor. Mol Cell Biol. 1996;16:4808-4817[Abstract].
28.
Zhu Y, Lambert K, Corless C, et al.
DUB-2 is a member of a novel family of cytokine-inducible deubiquitinating enzymes.
J Biol Chem.
1997;272:51-57 29. Jaster R, Zhu Y, Pless M, Bhattacharya S, Mathey-Prevot B, D'Andrea A. JAK2 is required for induction of the murine DUB-1 gene. Mol Cell Biol. 1997;17:3364-3372[Abstract]. 30. Jaster R, Baek K-H, D'Andrea AD. Analysis of cis-acting sequences and trans-acting factors regulating the interleukin-3 response element of the DUB-1 gene. Biochim Biophys Acta. 1999;1446:308-316[Medline] [Order article via Infotrieve]. 31. Gondo Y, Okada T, Matsuyama N, Saitoh Y, Yanagisawa Y, Ikeda J-E. Human megasatellite DNA RS447: copy-number polymorphisms and interspecies conservation. Genomics. 1998;54:39-49[CrossRef][Medline] [Order article via Infotrieve]. 32. Kogi M, Fukushige S, Lefevre C, Hadano S, Ikeda J-E. A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization. Genomics. 1997;42:278-283[CrossRef][Medline] [Order article via Infotrieve]. 33. Strous GJ, van Kerkhof P, Govers R, Ciechanover A, Schwartz AL. The ubiquitin conjugation system is required for ligand-induced endocytosis and degradation of the growth hormone receptor. EMBO J. 1996;15:3806-3812[Medline] [Order article via Infotrieve].
34.
Kim TK, Maniatis T.
Regulation of interferon-g-activated STAT1 by the ubiquitin-proteasome pathway.
Science.
1996;273:1717-1719
35.
Callus BA, Mathey-Prevot B.
Interleukin-3-induced activation of the JAK/STAT pathway is prolonged by proteasome inhibitors.
Blood.
1998;91:3182-3192
36.
Yu CL, Burakoff SJ.
Involvement of proteasomes in regulating Jak-STAT pathways upon interleukin-2 stimulation.
J Biol Chem.
1997;272:14017-14020
37.
Wang Y, Yeung Y-G, Langdon WY, Stanley ER.
c-Cbl is transiently tyrosine-phosphorylated, ubiquitinated, and membrane-targeted following CSF-1 stimulation of macrophages.
J Biol Chem.
1996;271:17-20
38.
Verdier F, Chretien S, Muller O, et al.
Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription 5 (STAT5) activation: possible involvement of the ubiquitinated Cis protein.
J Biol Chem.
1998;273:28185-28190
39.
Joazeiro CAP, Wing SS, Huang H-K, Leverson JD, Hunter T, Liu Y-C.
The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase.
Science.
1999;286:309-312
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  B. S. Ajjappala, Y.-S. Kim, M.-S. Kim, M.-Y. Lee, K.-Y. Lee, H.-Y. Ki, D.-H. Cha, and K.-H. Baek 14-3-3{gamma} Is Stimulated by IL-3 and Promotes Cell Proliferation J. Immunol., January 15, 2009; 182(2): 1050 - 1060. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Burrows, M. J. McGrattan, A. Rascle, M. Humbert, K.-H. Baek, and J. A. Johnston DUB-3, a Cytokine-inducible Deubiquitinating Enzyme That Blocks Proliferation J. Biol. Chem., April 2, 2004; 279(14): 13993 - 14000. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. S. Puente and C. Lopez-Otin A Genomic Analysis of Rat Proteases and Protease Inhibitors Genome Res., April 1, 2004; 14(4): 609 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-H. Baek, M.-S. Kim, Y.-S. Kim, J.-M. Shin, and H.-K. Choi DUB-1A, a Novel Deubiquitinating Enzyme Subfamily Member, Is Polyubiquitinated and Cytokine-inducible in B-lymphocytes J. Biol. Chem., January 23, 2004; 279(4): 2368 - 2376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Kim, K. C. Park, S. S. Chung, O. Bang, and C. H. Chung Deubiquitinating Enzymes as Cellular Regulators J. Biochem., July 1, 2003; 134(1): 9 - 18. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
1528 to
) or 10 pM IL-3 (
).
Luciferase assays were performed after 8 hours.