| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Laboratory of Allergic Diseases and Laboratory
of Immunology, National Institute of Allergy and Infectious Diseases,
National Institutes of Health, Bethesda, MD; Laboratory of Molecular
Immunology, International Institute of Molecular and Cell Biology,
Warsaw, Poland; and Department of Genetics and Pathology, Uppsala
University, Uppsala, Sweden.
The D816V mutation of c-kit has been detected in
patients with mastocytosis. This mutation leads to constitutive
tyrosine kinase activation of Kit. Because stem cell factor (SCF), the ligand for Kit (CD117+), is a chemoattractant for
CD117+ cells and one feature of mastocytosis is an abnormal
collection of mast cells in tissues derived from
CD34+CD117+ mast cell precursors, the
hypothesis was considered that the D816V mutation would enhance
chemotaxis of these precursor cells. Constructs encoding wild-type Kit
or Kit bearing the D816V mutation were transfected into Jurkat cells,
labeled with Calcein-AM, and migration to SCF assessed in
the presence or absence of tyrosine kinase inhibitors. Chemotaxis to
SCF was enhanced in D816V transfectants compared to wild-type Kit
transfectants (P < .002). Migration of both
transfectants was inhibited by tyrosine kinase inhibitors, although
D816V transfectants were more sensitive. Chemotaxis was next performed
on CD34+CD117+ circulating mast cell precursors
obtained from patients with mastocytosis. Analysis of prechemotaxis and
migrated cells showed that whereas less than 10% in the prechemotaxis
sample had the D816V mutation, 40% to 80% of migrated cells had this
mutation. These results demonstrate that the D816V Kit mutation
enhances chemotaxis of CD117+ cells, offering one
explanation for increased mast cells observed in tissues of patients
with mastocytosis.
(Blood. 2001;98:1195-1199) Signaling through Kit, the receptor for stem cell
factor (SCF), is crucial for the proliferation of
CD34+CD117+ mast cell precursors as well as
their subsequent migration into tissues where they differentiate into
mast cells.1-8 Activating mutations in Kit (D816V and
V560G; single-letter amino acid codes) have been described in
the human mast cell leukemia cell line HMC-1.9 In
addition, activating mutations corresponding to D816V in the murine
mastocytoma cell line p815 (D814Y)10 and in the rat
RBL-2H3 mast cell line (D817Y)11 have been identified. These mutations are associated with the constitutive tyrosine kinase
activation and phosphorylation of Kit as well as cell proliferation in
the absence of the Kit ligand, SCF.9,12-14
The D816V mutation first reported in the peripheral blood mononuclear
cells of patients with mastocytosis with an associated hematologic
disorder15,16 has now been found in the urticaria pigmentosa lesional skin of all adult patients and a subset of children
with severe disease.17,18 Because mastocytosis is a
disease characterized by increased mast cell numbers in the skin,
spleen, liver, and bone marrow, and because the D816V mutation is
associated with increased cell proliferation, it has been concluded that one effect of the mutation is to increase mast cell proliferation in patients with mastocytosis who have this mutation in hematopoietic lineage cells.15-18
However, increased proliferation of mast cell precursors alone would
not appear to account for increased tissue mast cell numbers,
particularly in the skin at sites of lesions of urticaria pigmentosa
where the D816V mutation may be identified even in circumstances where
it cannot be identified in marrow or peripheral blood. One alternative
explanation would be a preferential accumulation of cells bearing the
D816V mutation at these skin sites.19 We thus hypothesized
that the D816V mutation in Kit enhances cell migration of
CD34+CD117+ circulating mast cell precursors
over that observed dependent on wild-type Kit.
As will be shown, the activating Kit mutation D816V does, as
hypothesized, enhance cell migration to the Kit ligand, SCF. This
enhanced migration was demonstrated both in transfected Jurkat cells
encoding the D816V mutation and in CD34+CD117+
circulating mast cell precursors isolated from patients with mastocytosis. These findings thus provide a companion explanation for
the excessive numbers of mast cells in lesional tissues of patients
with mastocytosis and suggests that mastocytosis is, in part, a disease
of disordered cell trafficking.
Reagents and antibodies
Construction of plasmid complementary
DNA3-kitD816V
Transient transfection of Jurkat cells The human T-cell leukemia cell line, Jurkat, was maintained in complete medium comprising RPMI 1640 medium supplemented with L-glutamine (2 mM), penicillin (100 U/mL), streptomycin (100 µg/mL), and 10% heat-inactivated fetal calf serum (FCS) prior to transfection. Jurkat cells (4.0 × 107/0.4 mL RPMI) were transiently transfected with 50 µg pcDNA3-kitwt, pcDNA3-kitD816V, and the vector pcDNA-3 by electroporation (250 V, 960 µF capacitance, pulse time 29-30 ms) using a gene pulser (Bio-Rad, Richmond, CA). Following electroporation, the transfected cells were transferred to complete medium and incubated overnight at 37°C in a 5% CO2 incubator. Viabilities of transfectants ranged from 60% to 80%.Determination of transfection efficiency by flow cytometric analysis Transfection efficiency of the D816V and wild-type Kit transfectants was assessed by measuring Kit (CD117+) surface expression by flow cytometry. Briefly, immunofluorescence staining was performed by incubating transfected cells (1 × 106) with either PE-conjugated antihuman CD117 or an IgG1 isotype-matched control for 30 minutes at 4°C. After washing and resuspension in cold phosphate-buffered saline (PBS)/0.1% bovine serum albumin (BSA), the cells were analyzed on a FACScan (Becton Dickinson, San Jose, CA). CD117+ expression on transfectants was compared to a CD117+-expressing human mast cell leukemia cell line, HMC-1.2.Chemotaxis of Jurkat transfectants Jurkat transfectants were labeled with the intracellular fluorescent dye, calcein-AM, at 1 µM for 45 minutes at 37°C in a 5% CO2 incubator. Following labeling, cells were washed twice with PBS. A concentration of 2 × 105 cells in 50 µL migration buffer (RPMI without phenol red, supplemented with 0.5% BSA) were loaded on the top filter of the chemotaxis chamber (96-well Chemotx, 5-µm pore size, 6-mm diameter, Neuroprobe, Gaithersburg, MD). Increasing concentrations of rhSCF (1-400 ng/mL) or SDF-1 (1-400 ng/mL; ligand for the CXCR4 chemokine
receptor, which is endogenously expressed on Jurkat cells) were placed
in the bottom wells of the chemotaxis chamber. After incubation for 3 hours at 37°C in a 5% CO2 incubator, fluorescence of
cells migrating into the bottom chamber was measured using a
fluorescence reader (excitation filter 485 nm and emission filter 535 nm) (HTS 7000 Bio Assay Reader, PerkinElmer, San Francisco, CA).
Percent migration was calculated by expressing the fluorescence of
migrated cells as a percentage of the fluorescence of the total number
of cells loaded on the top filter of the chemotaxis chamber.
Chemokinesis was assessed by standard analysis using the optimal SCF concentration for migration (10 ng/mL). In selected experiments, Jurkat cells labeled with calcein-AM were incubated with the tyrosine kinase inhibitors Genistein and Tyrphostin AG1296 (Calbiochem, San Diego, CA) for 30 minutes prior to performing the chemotaxis assay. Isolation and culture of CD34+CD117+ mast cell precursors from patients with mastocytosis Peripheral blood mononuclear cells from 2 patients with indolent mastocytosis16 (collected by leukapheresis) and known to have the D816V mutation were obtained and processed after informed consent. Progenitor CD34+CD117+ cells from which mast cells are derived were enriched by immunomagnetic positive selection (Miltenyi Biotec, Auburn, CA).20 Approximately 45% of the enriched cell population consisted of CD34+/CD117+ cells as assessed by FACS analysis (Becton Dickinson). CD34+CD117+cells were then cultured in media consisting of Stempro-34 with nutrient supplement (Life Technologies, Grand Island, NY), L-glutamine (2 mM), penicillin (100 U/mL), streptomycin (100 µg/mL), rhIL-3 (30 ng/mL), rhIL-6 (100 ng/mL), and rhSCF (100 ng/mL). CD34+CD117+ cells were harvested for the chemotaxis assay after 1 and 3 days of culture.21Chemotaxis of CD34+CD117+ cells The CD34+CD117+ cells were washed twice with Stempro-34 media without IL-3, IL-6, and SCF. The cells were then suspended in Stempro-34 media supplemented with 0.5% BSA (migration buffer). A total of 2.5 × 104 cells in 25 µL migration buffer was loaded on the top filter of the chemotaxis chamber (96-well Chemotx, 5-µm pore size, 3.2-mm diameter, Neuroprobe). The optimal concentration for SCF (10 ng/mL) in 30 µL was added to the bottom wells of the chemotaxis chamber. Cells were left to migrate for 3 and 6 hours at 37°C in a 5% CO2 incubator. The migrated cells were then collected from the bottom wells of the chemotaxis chamber. Nested polymerase chain reaction (PCR) followed by HinfI restriction digestion was performed on the migrated cells as described below.Nested PCR, restriction digestion, and quantitation of D816V mutation by gel fluorescence imaging A 111-bp region of c-kit DNA spanning D816V was amplified by nested PCR. The primers Kit-1-F (TCCTCCAACCTAATAG TGTATTCACAG) and Kit-1-R (TTTGCAGGACTGTCAAGCAGAGAATG) were used for the first round and Kit-2-F (TATCCTCCTTACTCATGGTCGG) and Kit-2-R (AGAGAATGGGTACTCACGTTTCC) for the second round of amplification. The PCR was performed in a final volume of 50 µL containing 50 mM KCl, 10 mM Tris-HCl, 200 µM of each dNTP, 5 U Amplitaq DNA polymerase and 0.5 µM of each primer. One microliter of the PCR product from the first round was used as the template for the second round of PCR. The rest of the components in the reaction mixture were the same as described above for the first round. The same temperature conditions were used for the first and second round touchdown PCR. There was an initial 95°C 1-minute denaturation step followed by denaturation at 94°C for 1 minute and an extension at 72°C for 2 minutes; for the first cycle, annealing was at 68°C for 30 seconds, which dropped down to 58°C at the end of the fifth cycle at the rate of 2°C/cycle. The annealing temperature for the remaining 23 cycles was 58°C. The PCR ended with a 5-minute extension at 72°C. The PCR was performed on a PTC-100 programmable thermal cycler (MJ Research, Watertown, MA).To detect the mutation that creates an additional HinfI site, the second-round PCR product was digested with the restriction enzyme HinfI for 2 hours at 37°C. The digested product was electrophoresed on a 20% tris-borate EDTA (TBE) polyacrylamide gel (Novex, San Diego, CA). Predicted sizes for the wild-type c-kit sequence were 68 and 43 bp and for the heterozygous mutated sequence were 68, 54, 43, and 14 bp. Because the mutation is found on only one of the 2 alleles, cells with mutations also have the wild-type fragment of 68 and 43 bp generated from the wild-type copy of the c-kit gene. Control cell lines, HMC-1.1 (without the Kit D816V mutation) and HMC-1.2 (heterozygous for the Kit D816V mutation) were analyzed in parallel. The proportion of cells bearing the D816V mutation in both the starting and migrated cells was calculated following gel fluorescence imaging (Gel Expert, Nucleotech, San Carlos, CA) of the restriction enzyme digestion products. A ratio was obtained by dividing the fluorescence of the 54-bp band with that of the 68-bp band. This value was then expressed as a percentage of the ratio of fluorescence of the positive control HMC-1.2. Statistical analysis Values are presented as mean ± SEM. Comparative analysis was achieved using the unpaired 2-tailed t test using statistical software (Statview, Abacus Concepts, Berkeley, CA). A P value of .05 or less was considered significant.
Assessment of transfection efficiency by flow cytometric analysis Efficiency of transfection was assessed by measuring CD117+ expression on wild-type Kit- and D816V-transfected Jurkat cells. There were similar percentages of CD117+ expression on both the wild-type Kit (18% ± 1.8%, n = 3) and the D816V (19% ± 1.3%, n = 3) transfectants (Figure 1). As expected, Jurkat cells transfected with the vector pcDNA-3 alone expressed background levels of CD117+ (0.6% ± 0.01%, n = 3). The corresponding value for the HMC-1.2 cell line was 75% ± 2.2% (n = 3).
SCF-dependent chemotaxis of transfected cells We next determined the chemotaxis responses of the wild-type Kit and D816V transfectants to SCF compared to SDF-1 (Figure 2). There was a significant enhancement
of migration to SCF of the D816V transfectants, peaking at
18.2% ± 1.9% (n = 3; 10 ng/mL) compared to the wild-type Kit
transfectants (9.3% ± 1.0%, n = 3; P < .002;
Figure 2A). As expected, there was minimal migration to SCF by Jurkat
cells transfected with the pcDNA-3 vector alone (1.4% ± 0.18%;
n = 3). In contrast, migration of Jurkat cells to SDF-1 was
comparable in the wild-type Kit and D816V transfectants, as well as in
Jurkat cells transfected with the pcDNA-3 vector alone (Figure 2B). To
determine whether the differences in migration to SCF observed between
the D816V and wild-type Kit transfectants were due to random migration,
we performed control chemokinesis experiments. Briefly, standard
analysis using the optimal SCF concentration for cell migration (10 ng/mL) was performed. The results confirmed that the enhanced migration
observed in D816V transfectants was due mainly to chemotaxis and not
chemokinesis, because significant random migration was not demonstrated
when SCF was added either to the top well or to both the top and bottom wells of the chemotaxis chamber (Figure 2C). However, there was more
chemokinesis in Jurkat cells expressing the mutant receptor compared to
the wild-type Kit as would be expected when comparing a receptor with
an activating mutation to the wild-type receptor.
Effect of tyrosine kinase inhibitors on migration to SCF of transfected cells Because the D816V mutation results in constitutive activation of the tyrosine kinase activity of Kit, we next assessed whether the enhanced migration displayed by D816V transfectants would be differentially effected by tyrosine kinase inhibitors. Migration to SCF of both the D816V and wild-type Kit transfectants was partially inhibited by both tyrosine kinase inhibitors Genistein and Tyrphostin AG 1296 (Figure 3). However, migration of the D816V transfectants was inhibited to a greater degree by both Genistein (100 µM; 52% versus 33%; Figure 3A; P < .009) and Tyrphostin AG 1296 (100 µM; 53% versus 31%; Figure 3B; P < .007) compared to the wild-type Kit transfectants (n = 2).
Preferential migration to SCF of mutant CD34+CD117+ cells from patients with mastocytosis To determine whether these observations are clinically relevant in mastocytosis, we performed chemotaxis of CD34+CD117+ cells from which mast cells are derived. Samples taken from 1- and 3-day cultures of CD34+CD117+ cells from patients with mastocytosis were analyzed for the presence of the D816V mutation both in the starting prechemotaxis sample as well as 3 and 6 hours after chemotaxis. A schematic diagram of the HinfI restriction sites in the 111-bp PCR product from HMC-1.1 and HMC-1.2 as well as the predicted sizes for the HinfI restriction products from the positive control cell line HMC-1.2 (68, 54, 43, and 14 bp) and wild-type control cell line HMC-1.1 (68 and 43 bp) are shown in Figure 4A. HinfI restriction digestion of the PCR product from the positive control HMC-1.2 (heterozygous for Kit D816V mutation) revealed 3 bands at 68, 54, and 43 bp (Figure 4B; the 14-bp band is not shown in this figure) confirming the presence of the mutation, whereas 2 bands were detected in the wild-type control cell line HMC-1.1 (without the Kit D816V mutation) at 68 and 43 bp. Mutant cells were below the limits of detection in the prechemotaxis day 1 and 3 cultured CD34+CD117+-enriched cells, consistent with published data on the presence of the D816V mutation in this cell population.22 However, analysis of PCR products from migrated cells at both 3 and 6 hours following HinfI digestion of CD34+CD117+ cells revealed the presence of the mutation after chemotaxis in both 1- and 3-day cultures. Moreover, mutated cells were not detected in the upper chamber after chemotaxis (data not shown).
The proportion of mutated cells both in the starting population (prechemotaxis) as well as the migrated cells (after chemotaxis) from both day 1 and 3 cultures was estimated following gel fluorescence imaging. The ratio of the fluorescence intensity of the 54-bp band and the 68-bp band was calculated and expressed as a percentage of the ratio obtained for HMC-1.2, the positive control. We concluded that whereas less than 10% (< ratio of 0.05) mutated cells were detectable in the prechemotaxis sample (both day 1 and 3 cultures), the sample after chemotaxis contained 40% to 80% (ratio of 0.18-0.42) of mutated cells (both day 1 and 3 cultures; Figure 4B), demonstrating preferential migration to SCF of cells bearing mutated Kit.
The D816V mutation is the most commonly detected activating Kit
mutation in patients with mastocytosis, a disease characterized by
abnormal proliferation and subsequent accumulation of mast cells in
various tissues. In the present study, we have demonstrated that this
activating mutation enhances cell migration to its ligand, SCF. This
was first demonstrated in Jurkat cells (Figure 1) transfected with Kit
bearing the D816V mutation. SCF induced a standard bell-shaped dose-dependent chemotactic response in both D816V and wild-type Kit
transfectants (Figure 2A). However, SCF induced an enhanced chemotactic
response in the D816V compared to the wild-type Kit transfectants. In
contrast, there was comparable migration to SDF-1 To assess whether the enhanced tyrosine kinase activity conferred by the D816V mutation is responsible for the observed effects on chemotaxis, we compared the effect of tyrosine kinase inhibition on cell migration in both D816V and wild-type Kit transfectants (Figure 3). Although both transfectants were partially inhibited by the tyrosine kinase inhibitors Genistein and Tyrphostin AG1296, suggesting that both the wild-type and mutant transfectant use the same signal transduction pathway, the D816V transfectants were more sensitive to the inhibitory effect. This is consistent with evidence from murine studies that activating Kit mutations similarly enhance tyrosine kinase signaling.23-25 Previous work from our laboratory has similarly demonstrated that CD34+ mast cell precursors from patients with mastocytosis are hypersensitive to SCF, in that CD34+ precursors from patients with mastocytosis (when cultured in SCF) give rise to more mast cells per CD34+ cell plated than when CD34+ precursors are obtained from normal donors.26 To extend the observation of enhanced cell migration to SCF by the D816V transfectants to patients with mastocytosis, chemotaxis was performed on CD34+CD117+ cells enriched from the peripheral blood of these patients. Although the mutated cultured CD34+CD117+ cells were minimally detected (< 10%) in the starting population, between 40% and 80% of the migrated cells carried the mutation at both 3 and 6 hours following cell migration to SCF (Figure 4). Moreover, mutated cells were not detected in the upper chamber following chemotaxis (data not shown). These results demonstrate preferential migration of CD34+CD117+ mast cell precursors bearing the activating Kit mutation D816V to SCF and support our findings in transfected cells. Furthermore, the short time frame in which these experiments were performed (3-6 hours) precludes local proliferation as a plausible explanation for the increased numbers of CD34+CD117+ mast cell precursors found in the bottom wells of the chemotaxis chamber. In view of these data, we speculate that in patients with mastocytosis, CD34+CD117+ mast cell precursor cells bearing the D816V mutation preferentially migrate to SCF produced by stroma cells, endothelial cells, fibroblasts, and keratinocytes found in tissues such as the skin. Differentiation of the mutant CD34+CD117+ progenitor cells into mature mast cells then occurs as a result of the microenvironment. Thus, enhanced cell migration in addition to aberrant proliferation, the other known effect of the D816V mutation, may contribute to the extensive mast cell hyperplasia observed in these tissues. In conclusion, our studies demonstrate enhanced migration of cells bearing the activating Kit mutation D816V both in a transfected cell model and in human hematopoietic mast cell progenitor cells isolated from patients with mastocytosis. These findings offer a plausible mechanism in addition to aberrant proliferation for excessive mast cell numbers at tissue sites that produce SCF.
Submitted February 8, 2001; accepted April 16, 2001.
Supported by Fogarty Fellowship, National Institutes of Health, and the Swedish Cancer Society. M.S. and G.N. are supported by the Swedish Cancer Society.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Marcia L. Taylor, Laboratory of Allergic Diseases, NIAID, NIH, Bldg 10, Rm 11C207, 10 Center Dr, MSC1881, Bethesda, MD 20892-1881; e-mail: mtaylor{at}niaid.nih.gov.
1.
Meininger CJ, Yano H, Rottapel R, Bernstein A, Zsebo KM, Zetter BR.
The c-kit receptor ligand functions as a mast cell chemoattractant.
Blood.
1992;79:958-963 2. Galli SJ, Tsai M, Wershil BK. The c-kit receptor, stem cell factor, and mast cells: what each is teaching us about the others. Am J Pathol. 1993;142:965-974[Abstract]. 3. Nilsson G, Butterfield JH, Nilsson K, Siegbahn A. Stem cell factor is a chemotactic factor for human mast cells. J Immunol. 1994;153:3717-3723[Abstract]. 4. Vosseller K, Stella G, Yee NS, Besmer P. c-kit receptor signaling through its phosphatidylinositide-3'-kinase-binding site and protein kinase C: role in mast cell enhancement of degranulation, adhesion, and membrane ruffling. Mol Biol Cell. 1997;8:909-922[Abstract]. 5. Nilsson G, Hjertson M, Andersson M, et al. Demonstration of mast-cell chemotactic activity in nasal lavage fluid: characterization of one chemotaxin as c-kit ligand, stem cell factor. Allergy. 1998;53:874-879[Medline] [Order article via Infotrieve]. 6. Mekori YA, Oh CK, Metcalfe DD. IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3: prevention of apoptosis by c-kit ligand. J Immunol. 1993;151:3775-3784[Abstract].
7.
Tsai M, Shih LS, Newlands GFJ, et al.
The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo: analysis by anatomical distribution, histochemistry, and protease phenotype.
J Exp Med.
1991;174:125-131
8.
Tsai M, Takeishi T, Thompson H, et al.
Induction of mast cell proliferation, maturation, and heparin synthesis by the rat c-kit ligand, stem cell factor.
Proc Natl Acad Sci U S A.
1991;88:6382-6386 9. Furitsu T, Tsujimura T, Tono T, et al. Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product. J Clin Invest. 1993;92:1736-1744.
10.
Tsujimura T, Furitsu T, Morimoto M, et al.
Ligand-independent activation of c-kit receptor tyrosine kinase in a murine mastocytoma cell line P-815 generated by a point mutation.
Blood.
1994;83:2619-2626 11. Tsujimura T, Furitsu T, Morimoto M, et al. Substitution of an aspartic acid results in constitutive activation of c-kit receptor tyrosine kinase in a rat tumor mast cell line RBL-2H3. Int Arch Allergy Immunol. 1995;106:377-385[Medline] [Order article via Infotrieve]. 12. Hashimoto K, Tsujimura T, Moriyama Y, et al. Transforming and differentiation-inducing potential of constitutively activated c-kit mutant genes in the IC-2 murine interleukin-3-dependent mast cell line. Am J Pathol. 1996;148:189-200[Abstract].
13.
Kitayama H, Kanakura Y, Furitsu T, et al.
Constitutively activating mutations of c-kit receptor tyrosine kinase confer factor-independent growth and tumorigenicity of factor-dependent hematopoietic cell lines.
Blood.
1995;85:790-798
14.
Kitayama H, Tsujimura T, Matsumura I, et al.
Neoplastic transformation of normal hematopoietic cells by constitutively activating mutations of c-kit receptor tyrosine kinase.
Blood.
1996;88:995-1004
15.
Nagata H, Worobec AS, Oh CK, et al.
Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder.
Proc Natl Acad Sci U S A.
1995;92:10560-10564 16. Worobec AS, Semere T, Nagata H, Metcalfe DD. Clinical correlates of the presence of the Asp816Val c-kit mutation in the peripheral blood mononuclear cells of patients with mastocytosis. Cancer. 1998;83:2120-2129[CrossRef][Medline] [Order article via Infotrieve].
17.
Longley BJ Jr, Metcalfe DD, Tharp M, et al.
Activating and dominant inactivating c-KIT catalytic domain mutations in distinct clinical forms of human mastocytosis.
Proc Natl Acad Sci U S A.
1999;96:1609-1614 18. Longley BJ, Tyrrell L, Lu SZ, et al. Somatic c-KIT activating mutation in urticaria pigmentosa and aggressive mastocytosis: establishment of clonality in a human mast cell neoplasm. Nat Genet. 1996;12:312-314[CrossRef][Medline] [Order article via Infotrieve]. 19. Nagata H, Okada T, Worobec AS, Semere T, Metcalfe DD. c-kit mutation in a population of patients with mastocytosis. Int Arch Allergy Immunol. 1997;113:184-186[Medline] [Order article via Infotrieve].
20.
Berardi AD, Wang A, Levine J.
Functional isolation and characterization of human hematopoietic stem cells.
Science.
1995;267:104-108
21.
Kirshenbaum AS, Goff JP, Semere T, Foster B, Scott LM, Metcalfe DD.
Demonstration that human mast cells arise from a progenitor cell population that is CD34+, c-kit+ and express aminopeptidase N (CD13).
Blood.
1999;94:2333-2342 22. Akin C, Kirshenbaum AS, Semere T, Worobec AS, Scott LM, Metcalfe DD. Analysis of the surface expression of c-kit and occurrence of the c-kit Asp816Val activating mutation in T cells, B cells, and myelomonocytic cells in patients with mastocytosis. Exp Hematol. 2000;28:140-147[CrossRef][Medline] [Order article via Infotrieve].
23.
Piao X, Paulson R, van der Geer P, Pawson T, Bernstein A.
Oncogenic mutation in the Kit receptor tyrosine kinase alters substrate specificity and induces degradation of the protein tyrosine phosphatase SHP-1.
Proc Natl Acad Sci U S A.
1996;93:14665-14669
24.
Kozlowski M, Larose L, Lee F, Le DM, Rottapel R, Siminovitch KA.
SHP-1 binds and negatively modulates the c-Kit receptor by interaction with tyrosine 569 in the c-Kit juxtamembrane domain.
Mol Cell Biol.
1998;18:2089-2099 25. Ma Y, Longley BJ, Wang X, Blount JL, Langley K, Caughey GH. Clustering of activating mutations in c-KIT's juxtamembrane coding region in canine mast cell neoplasms. J Invest Dermatol. 1999;112:165-170[CrossRef][Medline] [Order article via Infotrieve].
26.
Rottem M, Okada T, Goff JP, Metcalfe DD.
Mast cells cultured from the peripheral blood of normal donors and patients with mastocytosis originate from a CD34+/Fc epsilon RI
© 2001 by The American Society of Hematology.
| |||||||||||||
![]() |
T. Yoshikawa, G. Dent, J. Ward, G. Angco, G. Nong, N. Nomura, K. Hirata, and R. Djukanovic Impaired Neutrophil Chemotaxis in Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., March 1, 2007; 175(5): 473 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Heissig, S. Rafii, H. Akiyama, Y. Ohki, Y. Sato, T. Rafael, Z. Zhu, D. J. Hicklin, K. Okumura, H. Ogawa, et al. Low-dose irradiation promotes tissue revascularization through VEGF release from mast cells and MMP-9-mediated progenitor cell mobilization J. Exp. Med., September 19, 2005; 202(6): 739 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lennartsson, T. Jelacic, D. Linnekin, and R. Shivakrupa Normal and Oncogenic Forms of the Receptor Tyrosine Kinase Kit Stem Cells, January 1, 2005; 23(1): 16 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Taylor, D. Sehgal, M. Raffeld, H. Obiakor, C. Akin, R. G. Mage, and D. D. Metcalfe Demonstration That Mast Cells, T Cells, and B Cells Bearing the Activating Kit Mutation D816V Occur in Clusters within the Marrow of Patients with Mastocytosis J. Mol. Diagn., November 1, 2004; 6(4): 335 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Dent, C. Hadjicharalambous, T. Yoshikawa, R. L. C. Handy, J. Powell, I. K. Anderson, R. Louis, D. E. Davies, and R. Djukanovic Contribution of Eotaxin-1 to Eosinophil Chemotactic Activity of Moderate and Severe Asthmatic Sputum Am. J. Respir. Crit. Care Med., May 15, 2004; 169(10): 1110 - 1117. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fumo, C. Akin, D. D. Metcalfe, and L. Neckers 17-Allylamino-17-demethoxygeldanamycin (17-AAG) is effective in down-regulating mutated, constitutively activated KIT protein in human mast cells Blood, February 1, 2004; 103(3): 1078 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Liao, M. B. Chien, N. Shenoy, D. B. Mendel, G. McMahon, J. M. Cherrington, and C. A. London Inhibition of constitutively active forms of mutant kit by multitargeted indolinone tyrosine kinase inhibitors Blood, June 28, 2002; 100(2): 585 - 593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||